ID: 1184001164

View in Genome Browser
Species Human (GRCh38)
Location 22:41674670-41674692
Sequence CAGAGCAGACAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 929
Summary {0: 1, 1: 0, 2: 10, 3: 105, 4: 813}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184001164_1184001170 8 Left 1184001164 22:41674670-41674692 CCACCCTGCTTCTGTCTGCTCTG 0: 1
1: 0
2: 10
3: 105
4: 813
Right 1184001170 22:41674701-41674723 TTCCAAAAAGGGAGGATAAAAGG 0: 1
1: 0
2: 5
3: 37
4: 388
1184001164_1184001175 26 Left 1184001164 22:41674670-41674692 CCACCCTGCTTCTGTCTGCTCTG 0: 1
1: 0
2: 10
3: 105
4: 813
Right 1184001175 22:41674719-41674741 AAAGGATGAAGGATGGCAGAGGG 0: 1
1: 0
2: 1
3: 71
4: 834
1184001164_1184001172 15 Left 1184001164 22:41674670-41674692 CCACCCTGCTTCTGTCTGCTCTG 0: 1
1: 0
2: 10
3: 105
4: 813
Right 1184001172 22:41674708-41674730 AAGGGAGGATAAAAGGATGAAGG 0: 1
1: 0
2: 4
3: 91
4: 956
1184001164_1184001173 19 Left 1184001164 22:41674670-41674692 CCACCCTGCTTCTGTCTGCTCTG 0: 1
1: 0
2: 10
3: 105
4: 813
Right 1184001173 22:41674712-41674734 GAGGATAAAAGGATGAAGGATGG 0: 1
1: 0
2: 8
3: 112
4: 1213
1184001164_1184001177 30 Left 1184001164 22:41674670-41674692 CCACCCTGCTTCTGTCTGCTCTG 0: 1
1: 0
2: 10
3: 105
4: 813
Right 1184001177 22:41674723-41674745 GATGAAGGATGGCAGAGGGAGGG 0: 1
1: 0
2: 12
3: 102
4: 951
1184001164_1184001174 25 Left 1184001164 22:41674670-41674692 CCACCCTGCTTCTGTCTGCTCTG 0: 1
1: 0
2: 10
3: 105
4: 813
Right 1184001174 22:41674718-41674740 AAAAGGATGAAGGATGGCAGAGG 0: 1
1: 1
2: 4
3: 41
4: 585
1184001164_1184001169 0 Left 1184001164 22:41674670-41674692 CCACCCTGCTTCTGTCTGCTCTG 0: 1
1: 0
2: 10
3: 105
4: 813
Right 1184001169 22:41674693-41674715 AACACTTGTTCCAAAAAGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 151
1184001164_1184001167 -4 Left 1184001164 22:41674670-41674692 CCACCCTGCTTCTGTCTGCTCTG 0: 1
1: 0
2: 10
3: 105
4: 813
Right 1184001167 22:41674689-41674711 TCTGAACACTTGTTCCAAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 189
1184001164_1184001168 -3 Left 1184001164 22:41674670-41674692 CCACCCTGCTTCTGTCTGCTCTG 0: 1
1: 0
2: 10
3: 105
4: 813
Right 1184001168 22:41674690-41674712 CTGAACACTTGTTCCAAAAAGGG 0: 1
1: 0
2: 1
3: 25
4: 208
1184001164_1184001176 29 Left 1184001164 22:41674670-41674692 CCACCCTGCTTCTGTCTGCTCTG 0: 1
1: 0
2: 10
3: 105
4: 813
Right 1184001176 22:41674722-41674744 GGATGAAGGATGGCAGAGGGAGG 0: 1
1: 0
2: 10
3: 74
4: 826

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184001164 Original CRISPR CAGAGCAGACAGAAGCAGGG TGG (reversed) Exonic
900153978 1:1196740-1196762 CACAGTAGACAGATGCAAGGAGG + Intronic
900331546 1:2137262-2137284 CAAAGCAGGCGGAAGCAGGTGGG - Intronic
900371462 1:2334039-2334061 CAGAGCAGACAGAAGGCATGGGG + Intronic
900644321 1:3702215-3702237 GAGAGCAGAGAGGAGCAGTGTGG - Intronic
900714863 1:4137858-4137880 CAGACCTGGCAGATGCAGGGAGG - Intergenic
901130502 1:6959878-6959900 CAGAGCAGAGAGACCCAGGGTGG + Intronic
901692963 1:10985732-10985754 CACACCAAACAGAAGCAGGCAGG + Intergenic
901915225 1:12494284-12494306 CAGAGAATACAAAAGCAGAGTGG - Intronic
902157200 1:14498310-14498332 CAGAGCAGGCAGGAGAAGGCTGG - Intergenic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903583274 1:24388271-24388293 AAGTGGAGACAGAAACAGGGAGG + Intronic
903737770 1:25541245-25541267 GAGAGCATTCTGAAGCAGGGAGG - Intergenic
903938929 1:26915335-26915357 CAAAGCAGGCAGCAGCAAGGTGG - Intronic
903967768 1:27100886-27100908 CAGGGCAGACTGACTCAGGGAGG - Intronic
904385624 1:30140323-30140345 CAGAGCAGAGAATAGCAGGTAGG + Intergenic
904501954 1:30918211-30918233 CAGAGCAGACAAAACCAGTTAGG - Intergenic
904943977 1:34185654-34185676 CAGAGGAGAGACGAGCAGGGAGG - Intronic
905110275 1:35589729-35589751 CAGCCAAGACAGAGGCAGGGGGG - Intronic
905120664 1:35679428-35679450 CAGAGAAGCCAGGAGGAGGGAGG - Intergenic
905894003 1:41533650-41533672 CAAAGGAGACACAAGCAGGAGGG - Intronic
906197824 1:43939947-43939969 CAGAGCAGGCTGGAGAAGGGTGG - Intergenic
906535060 1:46546911-46546933 ATAGGCAGACAGAAGCAGGGAGG + Intronic
907266192 1:53262942-53262964 CTGAGGAGACAAAAGCAGGGAGG - Intronic
907519814 1:55015798-55015820 CTGAGCAGAGGGAAGCACGGCGG + Intergenic
907886639 1:58598151-58598173 CAGAAGCCACAGAAGCAGGGAGG - Intergenic
909227996 1:73050120-73050142 CAGAGCAAACAAAATCAGAGTGG + Intergenic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
909675484 1:78234923-78234945 CTGAGCAGACTGAAGCATGGGGG - Intergenic
910101481 1:83582845-83582867 CAGGGCAGCCTGAAGCATGGGGG - Intergenic
910137134 1:83985374-83985396 CAAAGCAGCCAGAAGAAGGTGGG - Intronic
910330918 1:86071855-86071877 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
910589934 1:88919449-88919471 CTGAGCAGCCTGCAGCAGGGAGG + Intergenic
910606339 1:89088831-89088853 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
910635784 1:89405728-89405750 GAGAGCGAGCAGAAGCAGGGTGG - Intergenic
912235253 1:107844165-107844187 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
913112015 1:115665427-115665449 CAGAGCAGCCAGAATCAGCAAGG + Intronic
913159543 1:116132770-116132792 CAGAAGAGGCAGAAGCAGGGAGG + Intronic
913550770 1:119915410-119915432 CTGACCAGTCAGAAGCAGAGTGG + Exonic
914224362 1:145707863-145707885 CAGGGCAGAGGGAAGCAGGATGG - Intronic
914320651 1:146556412-146556434 TAGAGCAAACTGAAGAAGGGTGG - Intergenic
914344387 1:146785942-146785964 CAGAGAAGACTGGAGCAGGAAGG - Intergenic
914448628 1:147771737-147771759 CAGAGCAGAGAGTACCAGGAGGG - Intronic
914457972 1:147854715-147854737 GAGGGCAAGCAGAAGCAGGGAGG + Intergenic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915196491 1:154193727-154193749 CATATCACACAGAAGCAGGCAGG + Intronic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
916215374 1:162389106-162389128 CAGTGCAAACAGTAGCAGGGAGG - Intergenic
916312307 1:163410721-163410743 GAGAGCAGACTGAATGAGGGAGG - Intergenic
916496759 1:165354467-165354489 CAGAGCAGGCAGTACCCGGGCGG - Intronic
916943699 1:169702598-169702620 ATGAGCAGAGAGAGGCAGGGAGG - Intronic
916973368 1:170048683-170048705 GAGAGCAAGCAGAAGCGGGGTGG + Intronic
917023455 1:170614823-170614845 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917638097 1:176956474-176956496 CAGAGCAGAGACAAGCTGTGAGG - Intronic
917968965 1:180195240-180195262 CTGAGAGGCCAGAAGCAGGGTGG + Intronic
918360474 1:183751845-183751867 GAGAGCAAGCATAAGCAGGGTGG - Intronic
918632154 1:186730806-186730828 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
918657504 1:187046481-187046503 CAAAGCAGGCAGAAGAAGGTAGG - Intergenic
918682021 1:187367595-187367617 CAGAGGAGAGAGAGGCAGGAAGG + Intergenic
919425272 1:197422026-197422048 CATAGCAGGCAGAAGCAGTCTGG - Intronic
919724348 1:200872545-200872567 CAGAGAAGACAGCAGCCGGTGGG + Intergenic
919824206 1:201492318-201492340 CAAAGCAGAAAGGAGCAGGGAGG - Intronic
920087101 1:203425490-203425512 CAGAGAAGACAGACGTGGGGAGG - Intergenic
920183141 1:204144825-204144847 CATGGCAGAAATAAGCAGGGAGG - Intronic
920297335 1:204967091-204967113 CAGAGCTGCCAGGAGCTGGGAGG - Intronic
920299634 1:204980651-204980673 GAGAGGAGACAGGAGCAGAGGGG + Intronic
920725574 1:208431774-208431796 CGGAGAAGAGAGAAGCTGGGAGG - Intergenic
920808405 1:209257049-209257071 CAGAGCAGACAGCAGACGGGAGG + Intergenic
921399085 1:214700614-214700636 CAGAGGAAACAGTCGCAGGGTGG - Intergenic
921519711 1:216145051-216145073 TAGAGCAGAGAGCAGCAGAGAGG - Intronic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
922156915 1:223047764-223047786 CAAAGCAGGCAGAAGAAGGTGGG - Intergenic
922236455 1:223726256-223726278 CAGACCCCACAGAAGAAGGGAGG - Intronic
922494580 1:226046640-226046662 CAAAGCAGACAGAGGAAGGTGGG - Intergenic
922941710 1:229472768-229472790 CATACCTTACAGAAGCAGGGAGG - Intronic
923600416 1:235397996-235398018 CAAAGCAGACAGAAGGAGCAAGG - Intronic
923922013 1:238577499-238577521 CAGAGAACACAGAAGCAGCTGGG + Intergenic
924255331 1:242177366-242177388 GAGAACAGACAGACACAGGGAGG + Intronic
924557366 1:245129595-245129617 CAGAGGAGATAGAACCTGGGAGG - Intergenic
924615306 1:245607369-245607391 TAGAGCAGGCAGGAGCAGGCTGG - Intronic
1062840738 10:669299-669321 AAGACAAGACAGAAGCAAGGGGG + Intronic
1063442944 10:6088537-6088559 CGTCGCTGACAGAAGCAGGGAGG - Intergenic
1063472326 10:6298053-6298075 CAGAACAGAAAGAAGGGGGGAGG + Intergenic
1063520404 10:6735833-6735855 CAGATAAGCCAGAAGCAAGGTGG - Intergenic
1063977916 10:11431740-11431762 CTGAGCAGACAGAGGCATGATGG + Intergenic
1064354565 10:14605075-14605097 AAACGCAGACAGAATCAGGGAGG + Intronic
1064973407 10:21089047-21089069 CAGAGGAGACAGAAAAAGGGAGG + Intronic
1065021515 10:21505888-21505910 CAGTGCTGAGAGAAGCAGTGTGG - Intergenic
1065121067 10:22530754-22530776 GAGGGCAAACAGAAGCCGGGTGG - Intergenic
1065225002 10:23534508-23534530 CCGTGCAGGCAGAAGCAGTGGGG - Intergenic
1065881126 10:30038743-30038765 GAGAGAAGAGAGAAGCAGGATGG + Intronic
1067293516 10:44961032-44961054 CAGAGGAGAAAGAGGAAGGGAGG + Intronic
1067465501 10:46495244-46495266 CAGAGCAGGAACATGCAGGGGGG + Intergenic
1067621686 10:47889357-47889379 CAGAGCAGGAACATGCAGGGGGG - Intergenic
1068118000 10:52755882-52755904 CAGCCCAGACCGAAGCATGGAGG - Intergenic
1068495306 10:57778992-57779014 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1068648877 10:59499701-59499723 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
1069911140 10:71760666-71760688 CAGAGCAGATGGAAGGAGAGTGG + Intronic
1069913107 10:71771800-71771822 CAGAGCACCCAGTAGCAGAGAGG - Intronic
1069984779 10:72275572-72275594 CAGAGCAGCCGGAGGGAGGGGGG + Exonic
1070625092 10:78045418-78045440 GATAGCAGACAGACACAGGGAGG - Intronic
1070949370 10:80418657-80418679 CTAAGCACACAGAAGCAGGCTGG + Intronic
1071998275 10:91168291-91168313 CTGAGAAGAAAGAAGCAGGAGGG + Intronic
1072044795 10:91643987-91644009 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1073559026 10:104481395-104481417 CAGAGCAAACAGAAACTGGGAGG - Intergenic
1073592944 10:104773581-104773603 CAGAGCAGAAGGCAGCAGGGTGG + Intronic
1074368047 10:112875956-112875978 CAGGGCTGCCAGGAGCAGGGAGG + Intergenic
1074422064 10:113317824-113317846 CAGAGCAGAGAGAAGCCCCGTGG + Intergenic
1074799963 10:116990000-116990022 CAGAACAGGCAGAAGCTGGTAGG + Intronic
1074954858 10:118378916-118378938 CAGATATGACAGAAACAGGGAGG + Intergenic
1075090677 10:119442528-119442550 CAGAGCAGACTGAGGAAAGGTGG - Intronic
1075165736 10:120066768-120066790 CAAAGCAGGCAGAAGAAGGTCGG - Intergenic
1075257202 10:120934725-120934747 CAAAGCAGGCAGAGGGAGGGGGG - Intergenic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1076202104 10:128567028-128567050 CTGAGCAGGCAGGGGCAGGGAGG - Intergenic
1076222199 10:128743252-128743274 CAGAGGGGCCAGAGGCAGGGTGG + Intergenic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076589804 10:131575189-131575211 CTGAGCAGCCAGGAGCAGAGCGG + Intergenic
1076603057 10:131671464-131671486 CAGAGCCGAGAGAGGCAGAGTGG + Intergenic
1077297922 11:1834714-1834736 CCCAGGAGAGAGAAGCAGGGAGG + Intronic
1077298804 11:1838001-1838023 CAGAGGAGACAGCAGCGTGGAGG - Intergenic
1077305092 11:1865348-1865370 CAGAGCCTACCGAAGCTGGGGGG - Intronic
1077361025 11:2140091-2140113 CAGAGGAGAGAGGATCAGGGCGG + Intronic
1077369088 11:2173214-2173236 CACAGCTGACAGGAGCAGAGTGG - Intergenic
1077428395 11:2499017-2499039 GAGGGCACACAGAAGCAGGTGGG - Intronic
1077799584 11:5524748-5524770 GAGGGTAGACAGAAACAGGGAGG - Intronic
1078061003 11:8043982-8044004 AAGAGCAGCCAGAAGAAGGGGGG - Intronic
1078185008 11:9044729-9044751 GAGAGCTGAGAGAGGCAGGGAGG - Intronic
1078582026 11:12546163-12546185 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
1078932863 11:15926316-15926338 CAAAGCAGACAGAAGAAGGTGGG + Intergenic
1079264794 11:18920943-18920965 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079266969 11:18943090-18943112 GAGAGCAAGGAGAAGCAGGGTGG + Intergenic
1079396644 11:20069331-20069353 GAGAGGGGACAGAAGTAGGGAGG + Intronic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1079584358 11:22107404-22107426 CAAAGCAGGCAGAAGAAGTGGGG + Intergenic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079791972 11:24749570-24749592 CAAAGCAGGCAGAAGAAGGTAGG + Intronic
1080405968 11:31979262-31979284 CAAAGCAGAAAGAAGCAGAGAGG + Intronic
1080822159 11:35817841-35817863 CAGAGCAGAAGGAAGGTGGGGGG - Exonic
1080883065 11:36340689-36340711 AAAAGGAGAGAGAAGCAGGGAGG + Intronic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081804551 11:45883390-45883412 CAGAGCAGACTGGAGCAGCTTGG + Intergenic
1082628372 11:55511826-55511848 GAGAGAAGAAAGAAGCAGGAAGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082757052 11:57087731-57087753 GAGAGCAGAAAGCAGGAGGGAGG + Intergenic
1083311930 11:61788183-61788205 CAAAGGAGAGAGAAGAAGGGAGG - Exonic
1083323600 11:61862407-61862429 CAGTCCAGCCAGAGGCAGGGAGG + Intronic
1083499097 11:63087281-63087303 GAGGGCAGGCAGAAGCAGGGTGG + Intronic
1083620364 11:64046350-64046372 CAGAGGTGACAAAGGCAGGGTGG + Intronic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083683329 11:64361288-64361310 CAGAGCAGGAAGAGGCAGGAAGG - Intronic
1084297323 11:68221480-68221502 CAGACCAGGCAGCAGCTGGGAGG - Intergenic
1084667048 11:70582111-70582133 GACAGCAGACAGACCCAGGGCGG + Intronic
1084965365 11:72741665-72741687 CAGGGCTGACCGCAGCAGGGTGG + Intronic
1085247605 11:75116247-75116269 CAAAGCAGGCAGAAGGTGGGTGG + Intronic
1085435090 11:76493115-76493137 CGGAGCAGACAGCAGGAGCGGGG - Intronic
1085493602 11:76946378-76946400 CACAGCAGTCTGTAGCAGGGTGG + Intronic
1085791559 11:79501396-79501418 ATAAGCAAACAGAAGCAGGGCGG - Intergenic
1085801382 11:79593251-79593273 CAGAGCACACAGCAGCATTGTGG + Intergenic
1086000757 11:81983383-81983405 CAGAGAAGACAGAAAAAAGGAGG - Intergenic
1086164410 11:83761055-83761077 CAGATCAGAGTGAAGAAGGGTGG - Intronic
1086612250 11:88771552-88771574 CAAAGCAGGCAGAAGAAGGTGGG - Intronic
1087272090 11:96122100-96122122 CATAGCAGACAGGGGCCGGGCGG - Intronic
1087684330 11:101245981-101246003 CAGAGGAGAGAGAGGCAGAGAGG + Intergenic
1087684333 11:101246015-101246037 CAGAGGAGAGAGAGGCAGAGAGG + Intergenic
1087684338 11:101246070-101246092 CAGAGGAGAGAGAGGCAGAGAGG + Intergenic
1087684343 11:101246125-101246147 CAGAGGAGAGAGAGGCAGAGAGG + Intergenic
1087684365 11:101246360-101246382 CAGAGGAGAGAGAGGCAGAGAGG + Intergenic
1087695375 11:101370067-101370089 GAGGTCAGACCGAAGCAGGGTGG - Intergenic
1088408085 11:109502764-109502786 CACAGGAGAAGGAAGCAGGGTGG + Intergenic
1088696258 11:112368591-112368613 CAGAGCACAGAGAATCAGGGTGG + Intergenic
1088702462 11:112425917-112425939 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1088846310 11:113671269-113671291 GAGACCAGACAGAAGGAAGGTGG - Intergenic
1088984482 11:114893512-114893534 CAGAGCCAACAGTGGCAGGGTGG - Intergenic
1089254524 11:117187277-117187299 CAGAGAAGACAGCCACAGGGAGG - Intronic
1089353318 11:117833717-117833739 CAGAGCAGCCAGGAACAAGGTGG + Intronic
1089500510 11:118929075-118929097 CCAAGCGGAGAGAAGCAGGGCGG + Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089569166 11:119391348-119391370 CTGAGCAGACAAAACCAGTGAGG - Intergenic
1089666492 11:120023550-120023572 CACAGCAGCCAGAAGTATGGAGG - Intergenic
1089766113 11:120766748-120766770 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1090073285 11:123562234-123562256 CAGAAAAGAGAGAAGCAGGGAGG - Intronic
1090307407 11:125703289-125703311 GAGCGCAAGCAGAAGCAGGGTGG + Intergenic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090460312 11:126885720-126885742 CAGAGCAGAGGGCAGCAGGCTGG + Intronic
1090667866 11:128926874-128926896 CAGAGGACACAGAAGCGGGATGG - Intergenic
1090720326 11:129466893-129466915 GAGGGCGGGCAGAAGCAGGGTGG + Intergenic
1090981693 11:131728137-131728159 CACAGCAGACACCAGCTGGGTGG + Intronic
1091213613 11:133885545-133885567 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1092304277 12:7283398-7283420 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1092313289 12:7382606-7382628 CAGAGCCCACAGAAGCTGAGGGG - Intronic
1092567777 12:9686143-9686165 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1093740429 12:22679384-22679406 CAAAGCAGGCAGAAGAAGGTAGG - Intronic
1094265476 12:28554528-28554550 TAGAGTAGAAAGAAGCAGGCAGG - Intronic
1094472068 12:30812133-30812155 CAAAGCAGGCAGAAGAAGGTGGG - Intergenic
1094710451 12:32956711-32956733 CAGAGCCTACAGAGGCAGGCAGG - Intergenic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096750190 12:53753737-53753759 CTGAGGAGACCGAGGCAGGGAGG + Intergenic
1098394420 12:70003088-70003110 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1098840077 12:75467402-75467424 TAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099536205 12:83848179-83848201 AGGAGAAGACAGAAGTAGGGAGG - Intergenic
1099745056 12:86690608-86690630 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1100768822 12:97898597-97898619 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1101018707 12:100529730-100529752 AAGAGTAGCCAGAATCAGGGAGG - Intronic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101319581 12:103661777-103661799 CAGAGCAGAAAGGAGCATGCTGG + Intronic
1101736726 12:107468857-107468879 TACAGCAGACACGAGCAGGGTGG + Intronic
1101835092 12:108289429-108289451 CAGAGCAGCCAGAAAGAGGGAGG + Exonic
1102052956 12:109876503-109876525 CAGAGAAGAAAGAAAGAGGGAGG + Intronic
1103118857 12:118363551-118363573 CAAAGCAGAGAGTAGCAAGGAGG + Intronic
1103166664 12:118775748-118775770 GTGTGCAGACAGAAGCAGAGAGG - Intergenic
1103237440 12:119385193-119385215 CAGAGCAGGGAGGAGAAGGGTGG - Intronic
1103478983 12:121238773-121238795 CAGAGCCCACACAAGCAGGCTGG + Exonic
1103777822 12:123379596-123379618 GAGAGCAGATAGAAGCAGTCTGG - Intergenic
1103931956 12:124455496-124455518 CTCAGAAGGCAGAAGCAGGGAGG - Intronic
1104035520 12:125094668-125094690 GAGAGCAGGCAGAAGGAGGTGGG - Intronic
1104248290 12:127063880-127063902 CAGGGCAGGCAGGAGCAGGCTGG - Intergenic
1104746874 12:131216129-131216151 CAGAGCAGACAGAAACTCTGGGG - Intergenic
1104785743 12:131447054-131447076 CAGAGCAGACAGAAACTCTGGGG + Intergenic
1105019055 12:132804484-132804506 CAGAGCTGTCAGCACCAGGGAGG + Intronic
1105645865 13:22316743-22316765 GAGAGCAAACTGAAGCAGGGTGG - Intergenic
1105899399 13:24742581-24742603 CAGAGCAGACAGGAGCAGGAGGG - Intergenic
1106336667 13:28789462-28789484 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1106481003 13:30136723-30136745 CAGAGCAGCCACACACAGGGTGG + Intergenic
1106672628 13:31922897-31922919 CACAGCACAGAGCAGCAGGGAGG - Intergenic
1106937740 13:34742615-34742637 CAGAGTAGACAGACACAGAGTGG - Intergenic
1106978679 13:35252313-35252335 CAGAGCTGACTGAATCATGGGGG - Intronic
1107285167 13:38782088-38782110 CAGCGCAGGGTGAAGCAGGGTGG + Intronic
1107289913 13:38840250-38840272 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1111342610 13:86907463-86907485 CAGAGAAGACATCAGCAGGCAGG - Intergenic
1112407289 13:99132465-99132487 GAGAGGAGTCTGAAGCAGGGAGG + Intergenic
1112716811 13:102196329-102196351 AAGAGCTGACAGAAGTAGGCAGG + Intronic
1113061844 13:106330672-106330694 CAGCACAGAGAAAAGCAGGGAGG + Intergenic
1113108421 13:106796348-106796370 CAGAGGAGGCGGCAGCAGGGAGG - Intergenic
1113125244 13:106971072-106971094 CTGTGCAGACAGAAGCATTGAGG + Intergenic
1113167236 13:107455461-107455483 CATAGCAGATAGAGGCAGGGTGG - Intronic
1113595813 13:111530999-111531021 CTGGGCAGAGGGAAGCAGGGTGG - Intergenic
1113674122 13:112196369-112196391 CTGAGGAGGCAGGAGCAGGGAGG - Intergenic
1113734443 13:112668121-112668143 CAGTGCAGACCGAGGCAGGGTGG + Intronic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114307980 14:21440866-21440888 CAGAGGACACAGAAGCAGTTAGG + Intronic
1114701264 14:24680807-24680829 CAGAGGTCACAGAAGCAGTGGGG - Intergenic
1114741672 14:25104411-25104433 GAGGGCGGGCAGAAGCAGGGTGG + Intergenic
1114744901 14:25136567-25136589 AAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1114794433 14:25696514-25696536 CAGAGGAGACAGAAATAAGGGGG + Intergenic
1115339001 14:32272570-32272592 GAGGGCACACAGAAACAGGGTGG + Intergenic
1115342553 14:32307949-32307971 CATAGGAAACAGATGCAGGGAGG + Intergenic
1115584560 14:34797843-34797865 CAGGGCGGGCCGAAGCAGGGCGG + Intronic
1117255764 14:53975895-53975917 CAGCCCAGACATAAGCAGAGGGG + Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117710620 14:58525405-58525427 GAGAGCAAGCAGAAGCAGGGTGG + Intronic
1117750956 14:58923725-58923747 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1118383660 14:65238010-65238032 TAGGGCAGACAGAAGCCAGGAGG - Intergenic
1118383935 14:65239683-65239705 CAGGGCAGACAGAGGCCAGGAGG + Intergenic
1119076245 14:71642345-71642367 CAGAGCACAGAGAATCAGGGAGG + Intronic
1119189725 14:72672602-72672624 CATAGCAGACAGAACCTTGGAGG + Intronic
1119211645 14:72836439-72836461 CAGGGCAGGCAGGAGCAGGGAGG - Intronic
1119405027 14:74393197-74393219 CAGAGCAGACAAAAGCCCTGAGG - Intergenic
1119736467 14:76985833-76985855 CTGAGCAGGCAGAAGCTGGGAGG + Intergenic
1119893027 14:78197332-78197354 CAGAGAAGCAAGAAGGAGGGAGG - Intergenic
1120791743 14:88590367-88590389 CAGAGCAGAGGGAGGCAGGTGGG - Intronic
1121310661 14:92933502-92933524 CACAGCCCACAGGAGCAGGGGGG + Intronic
1121619512 14:95336570-95336592 AAGAGCAGAGACCAGCAGGGAGG - Intergenic
1121619524 14:95336632-95336654 AAGAGCAGAGACCAGCAGGGAGG - Intergenic
1121706684 14:96001704-96001726 GAGAGCAAAGAGAAGCAGGATGG + Intergenic
1121736231 14:96220100-96220122 CAGAGGAGACAGAGGTAGTGGGG - Intronic
1121780048 14:96616427-96616449 CAGAGCAGGGAGAGGCAAGGAGG + Intergenic
1121937994 14:98038151-98038173 CAGAGGAGACACAGGCAGTGTGG - Intergenic
1122098183 14:99386648-99386670 CATACCAGACAGAAGCAGCTCGG - Intergenic
1122289457 14:100672390-100672412 CAGAGCAGACAGCAGCAGAGGGG + Intergenic
1122439870 14:101723359-101723381 CACAGCAGAAAGATGCAGGCTGG - Intergenic
1122501352 14:102202150-102202172 GAGAGCACAGGGAAGCAGGGTGG - Intronic
1122538607 14:102483745-102483767 CAGAGCAGACAGAAAACAGGAGG - Intronic
1122589227 14:102834317-102834339 CAAAGCTGACAAAAGCAGTGGGG + Intronic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1124037234 15:26065839-26065861 CTGAGCAAAGAGAAGCAGAGAGG - Intergenic
1124084119 15:26531195-26531217 CAGGGCAAGCAGAAACAGGGTGG + Intergenic
1124653438 15:31489027-31489049 CAGGGCAGACACACCCAGGGAGG + Intronic
1124804413 15:32867160-32867182 CAAATCAGAGAGAGGCAGGGTGG - Intronic
1125145995 15:36469003-36469025 CAGACCAGACAGAGGGAAGGAGG + Intergenic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1126653696 15:50953480-50953502 CAGAGCAGGATGAAGCAGGATGG - Intronic
1126912793 15:53432937-53432959 GAGAGCTGAAAGAAGCAGAGAGG - Intergenic
1127608063 15:60609907-60609929 CAATGAAAACAGAAGCAGGGAGG + Intronic
1127804806 15:62509665-62509687 CTGATCACACAGAACCAGGGAGG + Intronic
1127907569 15:63387631-63387653 CAGACAAGACAGAGGCAGAGAGG + Intergenic
1128247477 15:66143052-66143074 AAGAGCAGACATGAGCAGGGAGG + Intronic
1128518526 15:68359977-68359999 CTGAGCAGACAGAGGAAGGTGGG + Intronic
1128818121 15:70629305-70629327 CAGCGCTGTCAGATGCAGGGAGG - Intergenic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1129267269 15:74400440-74400462 CACAGCAGAGAGAAGCAGTCAGG - Intergenic
1129393929 15:75234200-75234222 CAGAGCTGAGGGAAGCAGGAGGG + Intergenic
1129639873 15:77364517-77364539 CAGAGCAGTCAGACTCAAGGTGG + Intronic
1129855449 15:78821438-78821460 CAGTCCAGACAGAAACAGGAAGG + Intronic
1130106507 15:80932497-80932519 CAGAGAAGGCAGAAGAGGGGCGG + Intronic
1130119874 15:81038587-81038609 CAGCACTGACAGAAGCAGGAGGG + Intronic
1130258091 15:82335061-82335083 TAGAACAGACAGAGCCAGGGAGG - Intergenic
1130333015 15:82935780-82935802 CAGAGGAGACAGAAGTGGGTGGG - Intronic
1130596840 15:85254902-85254924 TAGAACAGACAGAGCCAGGGAGG + Intergenic
1130662832 15:85844051-85844073 CAGAGAAGACAGCATAAGGGAGG + Intergenic
1130987229 15:88852405-88852427 TAGAGGAGAAAGAATCAGGGAGG + Intronic
1131507063 15:93028521-93028543 CAGCCCAGACAGAGGAAGGGTGG + Intergenic
1131590768 15:93746548-93746570 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1202975631 15_KI270727v1_random:290323-290345 GACAGCAGACAAAAGGAGGGGGG + Intergenic
1132630024 16:912767-912789 CAAAGAAAACAGAAGCAGGTGGG - Intronic
1132739229 16:1403061-1403083 CAGAGCCTGCAGCAGCAGGGAGG + Intronic
1132739236 16:1403115-1403137 CAGAGCCCACAGCAGCAGGCAGG + Intronic
1132877771 16:2148046-2148068 CACAGCAGGCAGAAGCTGTGGGG + Intronic
1132919584 16:2379363-2379385 CAGAGCACACAGCAGCACGAAGG - Intergenic
1133103942 16:3494881-3494903 CAGAGGAGACAGCGGGAGGGTGG + Intronic
1133234069 16:4379568-4379590 CAGGGCAGACAGAAGAAAGCAGG - Intronic
1133863171 16:9616224-9616246 CAGAGCAGAGTGGAGAAGGGTGG - Intergenic
1134062014 16:11205031-11205053 CAGAGAAGTCAGAGGCAGTGAGG - Intergenic
1135947939 16:26881977-26881999 CAAAGCAGAGAGCAGAAGGGTGG - Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136395138 16:29988407-29988429 CAAAGCAGACAGAGGCAGCCTGG - Intronic
1136398005 16:30003509-30003531 CTGTGAAGACAGAAGCAGGTTGG + Intronic
1136922739 16:34345578-34345600 CTGAGCAGACAGGAGTAGGAGGG + Intergenic
1136981834 16:35066228-35066250 CTGAGCAGACAGGAGTAGGAGGG - Intergenic
1137696403 16:50464935-50464957 GACAGCACACAGAAGCGGGGTGG - Intergenic
1137976838 16:53039314-53039336 CAGAGCAGAGTGGAGCAGAGTGG - Intergenic
1138513354 16:57521563-57521585 CAAAACAGACAGGAGCAGGGTGG - Intronic
1138513721 16:57524177-57524199 CAAAACAGACAGGAGCAGGGTGG + Intronic
1138643808 16:58407907-58407929 CAGAACAGACAGACACAGAGTGG - Intergenic
1138748843 16:59394785-59394807 TAAAGCAGACAGAAGAAGGTGGG + Intergenic
1139041499 16:63004460-63004482 CAGAGCAGGGAGAGGAAGGGGGG - Intergenic
1139923063 16:70471558-70471580 CAGAGCAGATGCAAGGAGGGAGG - Intronic
1139989610 16:70929407-70929429 CAGAGAAGACTGGAGCAGGAAGG + Intronic
1140012882 16:71153693-71153715 TAGAGCAAACTGAAGAAGGGTGG + Intronic
1140031210 16:71340696-71340718 CTGAGCAGACAGGAGGTGGGAGG - Intergenic
1140200642 16:72891887-72891909 AACATCAGACAGAAGCAGTGTGG - Intronic
1141551591 16:84810010-84810032 CAAAGCTGGCAGAGGCAGGGAGG + Intergenic
1141617097 16:85216068-85216090 GGGAGCAGGCAGAGGCAGGGTGG - Intergenic
1141704645 16:85658181-85658203 CAGGGCAGGCAGGGGCAGGGAGG - Intronic
1142275272 16:89115094-89115116 CTGCGCAGAAAGCAGCAGGGTGG - Intronic
1143557272 17:7669692-7669714 TGTAGGAGACAGAAGCAGGGAGG + Intronic
1143972240 17:10804030-10804052 CAGAGAAGGCAGCAGCAGGCAGG - Intergenic
1144046908 17:11462174-11462196 CAGAGAGGACAGAAGCAAGAGGG - Intronic
1144175917 17:12707407-12707429 AAAAGCACACAGAAGCAGGCTGG + Intronic
1144434202 17:15224397-15224419 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1145294643 17:21578568-21578590 CAGAGCAGACAGAGGCTTGGTGG + Intergenic
1146746419 17:35334220-35334242 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1146798509 17:35800036-35800058 CAGTGCAGAGAGAGGGAGGGAGG - Intronic
1146803354 17:35844865-35844887 TGGAGGAGACAGAAGCCGGGGGG + Exonic
1147139689 17:38454072-38454094 CAGGGCAGCCAGAGGCAGCGCGG - Intronic
1147337829 17:39737974-39737996 CAGAGAAGTCAGAGGCGGGGGGG - Intronic
1147529496 17:41262120-41262142 CAGAACACACAGACACAGGGAGG + Intergenic
1147606214 17:41775234-41775256 CACAACAGACAGAAGAAGGCTGG + Intronic
1148552717 17:48560112-48560134 CAGAGAAGGCAGAGGAAGGGAGG + Intronic
1148678387 17:49458427-49458449 AAGAGCAGACAGAATCCAGGTGG + Intronic
1150138578 17:62709987-62710009 CAGAGCAAAAAGCAGCAGGAGGG - Intronic
1150193705 17:63271649-63271671 CAGAACACACAGACACAGGGAGG - Intronic
1150212811 17:63450720-63450742 CAGAGCAGCCAGCAGCACAGCGG + Intergenic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1150960488 17:69906835-69906857 CAGATCCCAGAGAAGCAGGGCGG - Intergenic
1151045984 17:70919865-70919887 CAAAGCAGGCAGAAGAAGGTGGG - Intergenic
1151236907 17:72727349-72727371 CAGAACAGAAAGAAGCAAGCTGG + Intronic
1151444965 17:74157475-74157497 CACAGCAGGCAGAAGGAGGTGGG + Intergenic
1151692201 17:75693565-75693587 CACAGCAGACAGAAGCCCTGTGG - Intronic
1151851766 17:76694840-76694862 CACCACAGCCAGAAGCAGGGAGG - Intronic
1151934521 17:77253879-77253901 CTTAGCAGACAGGAACAGGGAGG + Intergenic
1152016259 17:77752721-77752743 CCAAGCAGACAGAAGCACGAAGG + Intergenic
1152113184 17:78368598-78368620 GAGAGCTGGCAGAGGCAGGGAGG + Intergenic
1152157997 17:78647553-78647575 GAGAGGAGAGAGAGGCAGGGTGG + Intergenic
1152171049 17:78748929-78748951 CAGAGCAAACTGAACCAGCGCGG + Intronic
1152866444 17:82726577-82726599 CAGAGCAGACCAAAGCTGGAGGG - Exonic
1153798378 18:8646574-8646596 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1153820607 18:8828362-8828384 CAGTGCAGAGAGAAGCCGTGAGG + Intronic
1154253724 18:12765616-12765638 CAGAGCAGGCAGGAGGAGGGCGG + Intergenic
1155160235 18:23189628-23189650 CAGGGCAGGCGGCAGCAGGGAGG + Intronic
1155775981 18:29762130-29762152 GAGAAGAGAAAGAAGCAGGGAGG - Intergenic
1155825646 18:30439357-30439379 TAGAGCAGAGGGAGGCAGGGAGG - Intergenic
1155911905 18:31513686-31513708 CAGGGCAGAGGGAAGCGGGGAGG - Intronic
1156384504 18:36593420-36593442 CAGAGGAGAGGGAAGCAAGGGGG + Intronic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1157128482 18:44980601-44980623 CAGAGGAGGGAGAGGCAGGGAGG + Intronic
1157131763 18:45013856-45013878 CACAGCAGAAAGAAACATGGTGG - Intronic
1157180809 18:45496458-45496480 CAAAGCAGGCAGAAGAAGGTGGG + Intronic
1158380700 18:56926995-56927017 CATCACAGACAGAAGCAAGGCGG - Intronic
1159386052 18:67726322-67726344 GAGAGCAAATAGAAGCAGGGTGG - Intergenic
1159855027 18:73576244-73576266 CAGAGCAAACAGAACAAGGCTGG - Intergenic
1160076953 18:75686638-75686660 CAGAGCAGAGAGGAGCCTGGCGG + Intergenic
1160123922 18:76153566-76153588 TAGTGCAGACACAGGCAGGGAGG + Intergenic
1160585653 18:79911959-79911981 CAGAGGGGACAGGAGCAGTGAGG + Intronic
1160835944 19:1124482-1124504 AAGAGGAGACAGAGGCAGTGGGG + Intronic
1161511190 19:4672692-4672714 CAGAACAGACAGCTGCATGGAGG - Intergenic
1161574670 19:5048887-5048909 CCAGCCAGACAGAAGCAGGGGGG + Intronic
1162403399 19:10459570-10459592 GAGAGCAGGCAGGGGCAGGGTGG - Intronic
1162410107 19:10500558-10500580 CAGAGCTGACAACTGCAGGGAGG + Intronic
1162425316 19:10591666-10591688 CAAAGCAGGCGGAAGCAGGCTGG - Intergenic
1163388552 19:17015509-17015531 CAGAGCAGACAGGAGGTGGGTGG - Intronic
1163504496 19:17697411-17697433 AAGAGAAGACAGAAGCAGCATGG - Intergenic
1163618344 19:18342659-18342681 CAGAGCGGACAGGTGCAGGACGG + Intronic
1163815226 19:19460938-19460960 CAGAGCACACAGAGGGACGGGGG - Intronic
1163910158 19:20182421-20182443 CAGAACAAACAGAAGCTGTGGGG - Intronic
1164593497 19:29519083-29519105 CAAAGCAGAACGAAGCAGAGTGG - Intergenic
1164982456 19:32624555-32624577 GAGAGAAGCCAGAAGGAGGGCGG + Intronic
1165316050 19:35055988-35056010 CAGAGCAGAGTGAGCCAGGGAGG - Intronic
1166178202 19:41089285-41089307 CGGGGCAGAGAGAGGCAGGGAGG - Intronic
1166213798 19:41323217-41323239 CAGCGCAGACATAAACAGAGAGG - Exonic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1166945981 19:46396546-46396568 CAAAGCAGACAAAAGCAGTTAGG + Intergenic
1167200157 19:48059563-48059585 CAAAGCAGACAGAAGAAGGTGGG + Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168304759 19:55429430-55429452 CAGAGCAGCTAGAAGCCGTGGGG + Exonic
925204785 2:1996661-1996683 CAGCCCACACTGAAGCAGGGTGG - Intronic
925204825 2:1996868-1996890 CAGTCCACACTGAAGCAGGGCGG - Intronic
925204851 2:1997002-1997024 CAGCCCACACTGAAGCAGGGCGG - Intronic
925204877 2:1997136-1997158 CAGCCCACACTGAAGCAGGGTGG - Intronic
926266882 2:11331005-11331027 AGGAGCAGAAAGAAGGAGGGAGG + Intronic
926970680 2:18464164-18464186 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
928032701 2:27795305-27795327 CAAACCACAAAGAAGCAGGGAGG + Intronic
928070931 2:28215760-28215782 GAGAGCAGAAAGAAGCAGAGGGG - Intronic
928099330 2:28426444-28426466 CGGAGGAGACAGATGCGGGGCGG - Intergenic
928263385 2:29788084-29788106 AAGAGCAGACAGAGGCTGTGAGG - Intronic
928650274 2:33396659-33396681 AAGACCAGAGAGAAGCAGGCTGG - Intronic
928963664 2:36955560-36955582 GAGAAGAGACAGAAGAAGGGAGG - Intronic
929072206 2:38043575-38043597 CAGAGAAGGCAGAAGAAGAGGGG - Intronic
929256220 2:39813973-39813995 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
929531162 2:42753766-42753788 CTGAGCGGACACATGCAGGGTGG - Exonic
929837934 2:45425661-45425683 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
930223386 2:48767867-48767889 GAGGGCAGGCAGAAGCAGGGTGG - Intronic
930997443 2:57737503-57737525 CAGAGCAGAAAGAAGGAGACTGG + Intergenic
931077693 2:58734988-58735010 GAGAGGAGAGAGAAGGAGGGAGG - Intergenic
931212254 2:60208354-60208376 CAGTGGAGACAGAGGCAGGTTGG - Intergenic
931288005 2:60848877-60848899 GAGAGAAGACAAATGCAGGGCGG + Intergenic
932699122 2:73981503-73981525 TAGAGCAGACAGAGGGAGAGAGG - Intergenic
933395119 2:81721548-81721570 CAGAATAGACAGAAGCAGTGAGG + Intergenic
933655419 2:84882547-84882569 CAGCTCAGAGAGAAGCTGGGCGG - Intronic
934059721 2:88282998-88283020 CAGAGCACACAGAATGAGGTGGG - Intergenic
934818188 2:97348472-97348494 CAGTGCAGACAGGAGGAGGCAGG + Intergenic
935641276 2:105292698-105292720 CAGACCAGACAGTAAAAGGGGGG + Intronic
936146050 2:109981267-109981289 CTGAGCAGAGAGAGGCAGGGTGG - Intergenic
936198640 2:110390212-110390234 CTGAGCAGAGAGAGGCAGGGTGG + Intergenic
936327980 2:111522087-111522109 CAGAGCAGGGAGGAGCAGGCTGG + Intergenic
936463151 2:112726159-112726181 CAGGGCAGACACAGGCAGGCAGG + Intronic
936506882 2:113115292-113115314 TAGACCACACACAAGCAGGGGGG - Intronic
936559814 2:113527481-113527503 CCGTGCAGACAGGAGCAGAGGGG + Intergenic
936815259 2:116452760-116452782 CAGACCAAAAACAAGCAGGGAGG - Intergenic
937096732 2:119240562-119240584 AAGAGCAGACAGGAGCTGGCAGG + Intronic
937321869 2:120965803-120965825 GAGGACAGAAAGAAGCAGGGAGG - Intronic
938265731 2:129926873-129926895 CATAGCCGAAAGCAGCAGGGAGG + Intergenic
938886442 2:135654157-135654179 CATAGGAGACAGAAGCAGATTGG - Intronic
939298184 2:140297164-140297186 CATAGGAGAAAGAAGCTGGGGGG + Intronic
939470582 2:142615562-142615584 CAGAGCAAGCAGAAGCAATGTGG + Intergenic
939640930 2:144638977-144638999 TAGGGCAAGCAGAAGCAGGGTGG - Intergenic
939937848 2:148313935-148313957 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
940565240 2:155351827-155351849 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
940995069 2:160140399-160140421 CAGAGCAAGCAGAGGCATGGCGG + Intronic
941043503 2:160648588-160648610 CAGAGCTGGCAGGAGCAGGCAGG + Intergenic
941239471 2:163017909-163017931 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
941494927 2:166188068-166188090 CCAAGGAGACAGAAGCAGGGAGG + Intergenic
941518799 2:166511843-166511865 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
941641389 2:167992438-167992460 CAGAGCAGAAAGAAGGATGTGGG + Intronic
941957279 2:171217533-171217555 AAAAGCAGACAGCAGGAGGGAGG + Intronic
942244764 2:173997435-173997457 CTGAGCAGCCAGAAGCATGCAGG - Intergenic
942644532 2:178095934-178095956 CAGAGCACAGAGCAGCAGTGGGG + Intronic
942851660 2:180494747-180494769 CACAGCAGCCTGTAGCAGGGTGG + Intergenic
942898673 2:181089066-181089088 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
943006101 2:182389799-182389821 CAGTGCAGACAGAATAAGGCAGG + Intronic
943147767 2:184066433-184066455 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
944619386 2:201498447-201498469 CAAAGCAGACAGAGGAAGGAGGG - Intronic
944764265 2:202848983-202849005 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
945020169 2:205562835-205562857 CAGAGAAGACAGGAGGAGGTAGG - Intronic
945398314 2:209348794-209348816 CAAAGCAGACAGCAGGAGGGAGG - Intergenic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
946236501 2:218327517-218327539 GAGAGCAGAGAGCAGCAGGGAGG - Intronic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
946647521 2:221853993-221854015 CAGAGCAGGCAAAATCAGGTTGG - Intergenic
947309325 2:228783249-228783271 CAGAGCAGAAGGAAGCAGCTGGG - Intergenic
947311659 2:228809614-228809636 AAGAGCAAGCAGAAACAGGGTGG - Intergenic
947481759 2:230507137-230507159 CTCAGAAGACAGAAGCAGGAGGG + Intronic
947722830 2:232379964-232379986 CTGGGCAGAGAGTAGCAGGGAGG + Intronic
947727175 2:232408045-232408067 CTGGGCAGAGAGTAGCAGGGAGG + Intronic
948038459 2:234879233-234879255 GAGAGGAGACAGGAGAAGGGTGG + Intergenic
948384979 2:237575632-237575654 CTGAGCAGCCAGGACCAGGGAGG + Intronic
948704210 2:239779133-239779155 CACAGCGGACAGATGCAGGAGGG + Intronic
948800516 2:240431331-240431353 CAGAGCAGACAGGACCTGGCAGG + Intergenic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1168805531 20:670310-670332 CAGAGCAGAAAGTAGGAGGCCGG - Intronic
1168841249 20:911387-911409 CTGAGCAGCCAGCTGCAGGGTGG + Intronic
1169263758 20:4155424-4155446 CAGAGCAGAGAGAAGCATCCAGG - Intronic
1169786722 20:9367047-9367069 CAGAGCAGAATGAAGCAGCTGGG - Intronic
1169928272 20:10805759-10805781 AAGAGCAGCCAGAAGCAGGCAGG - Intergenic
1170872066 20:20214877-20214899 CAGGGCAGGCAGAAGGAGAGTGG + Intronic
1170960274 20:21019683-21019705 CACAGCAGCCAGAAGCAGAAAGG - Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1172084303 20:32367681-32367703 CAGTGCAGACAGCAGCATGATGG - Intronic
1172393408 20:34581932-34581954 CAGAGCTGGCAGAGGCAGAGGGG - Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1172787670 20:37479911-37479933 CAGAGAGGAAAGCAGCAGGGGGG - Intergenic
1172950435 20:38720014-38720036 CAGAGCAGACAGCACCATGGGGG - Intergenic
1172955580 20:38755827-38755849 CAGAGCAGTCACAAACAGGAAGG - Intronic
1173547258 20:43908312-43908334 CAGATCAGAAAGATGCAGTGAGG + Intergenic
1173585710 20:44181667-44181689 CAGAGCATGCAAAAGCTGGGAGG - Intronic
1173722579 20:45272519-45272541 CAGAGGAGACAGAACCAGGTTGG - Intergenic
1173849189 20:46207244-46207266 CAGTGCAGATAAAAGCAGGAGGG + Intronic
1173908881 20:46649461-46649483 CAGAGCAGAGAGAAGCTGTCGGG + Intronic
1174288397 20:49488860-49488882 TAGAGCAGGCAGAAGAAGGTGGG + Intergenic
1174380158 20:50151139-50151161 GTGAGCAGATAGAAGCAGAGAGG + Intronic
1176177783 20:63736847-63736869 CAGCAGAGACAGAAGCTGGGGGG - Intronic
1176193324 20:63824626-63824648 CAGAGCACCCAGAAGAACGGGGG - Intronic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1176891697 21:14327002-14327024 GAGGGCACGCAGAAGCAGGGTGG + Intergenic
1178070343 21:28958430-28958452 CAGAGCAGACAAATGTAGGAAGG + Exonic
1179108463 21:38424599-38424621 CAGAGTAGACAGATGCTGTGGGG + Intronic
1179285351 21:39973200-39973222 CAGGGGAGACAGATGCAGGGCGG - Intergenic
1179365365 21:40754156-40754178 CAGAGCTGGCAGAAACACGGAGG - Intronic
1179939600 21:44629017-44629039 CAGACCAGACAGCAGGAAGGAGG + Intronic
1180079857 21:45481732-45481754 CAGAGCCGACAGCACCACGGCGG - Intronic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1180904201 22:19397066-19397088 CACACCAGACAGAAGCAGAAGGG + Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181528818 22:23504443-23504465 GAGAGCAGTCAGACCCAGGGAGG - Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181667511 22:24408351-24408373 CAGAGCAGAGAGCCGCATGGAGG + Intronic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181851270 22:25751632-25751654 CAGAACAGACAGACTCAGAGAGG - Intronic
1181968993 22:26676009-26676031 CAAAGCAGACTGAATGAGGGAGG - Intergenic
1182088836 22:27580335-27580357 CAAAGCCCAGAGAAGCAGGGAGG - Intergenic
1182530042 22:30948257-30948279 CAGAACTGACAGAACCAGGTAGG + Intronic
1182847467 22:33443412-33443434 CAGTGCAGACAGGAGCAGGTGGG - Intronic
1183589263 22:38770381-38770403 CAGTGCAGTGAGAAGCAAGGGGG - Intronic
1183773875 22:39949804-39949826 CTGAGCAGTCAGAAGCAGCGGGG - Intronic
1183794793 22:40107602-40107624 TATAGCTGACAGAAGCAGAGAGG - Intronic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184095685 22:42315098-42315120 CTGAGGAGACCCAAGCAGGGAGG + Intronic
1184118083 22:42433502-42433524 CTGAGCAGGCAGTAGCAGGGTGG - Intergenic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184428017 22:44424449-44424471 CAGAGCAGAAAGATGGAGAGAGG - Intergenic
1184692491 22:46123629-46123651 AGGGGCAGACAGCAGCAGGGAGG + Intergenic
1184947122 22:47811378-47811400 CAGCACACACAGAAGCAGGCAGG - Intergenic
1184989626 22:48158121-48158143 GGGAGGAGACAGACGCAGGGTGG - Intergenic
1185013812 22:48331993-48332015 CAGGGCAGACAGGTACAGGGAGG - Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949437132 3:4041601-4041623 CAGACCAGACACAAGTTGGGGGG + Intronic
949750903 3:7351641-7351663 CAAAGCAGGCAGAAGAAGTGGGG + Intronic
949953046 3:9245292-9245314 CAGTGCAGGCAGTAGAAGGGTGG - Intronic
949954967 3:9259995-9260017 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
950127049 3:10516229-10516251 CAGGGCAGCCTGCAGCAGGGAGG - Intronic
950495781 3:13333493-13333515 CAGAGCACAGAGGAGCTGGGAGG - Intronic
950544063 3:13628657-13628679 CAGAGCAGCTGGAGGCAGGGCGG - Intronic
951915371 3:27795466-27795488 CATAGCAAACAGATTCAGGGTGG - Intergenic
952820519 3:37482070-37482092 CAGTGCAGCCAGAAGCTGTGTGG - Intronic
953102438 3:39842755-39842777 GAGGGCAGACAGAAGCAGGGGGG - Intronic
953167839 3:40481487-40481509 AAGACCAGAAAGAAGCTGGGTGG + Intronic
953201663 3:40783318-40783340 AAGGGCAGACAGTAGAAGGGAGG + Intergenic
953262805 3:41356734-41356756 CAGGGAAGACAGAATCAGAGTGG + Intronic
953315777 3:41925248-41925270 GAGGGCAGGCAGAAGCAAGGTGG + Intronic
953580053 3:44145626-44145648 CAGACCTGGCAGAAGCACGGAGG - Intergenic
953903949 3:46858859-46858881 CACAGCACACAGAAGTACGGAGG - Intronic
953916402 3:46923559-46923581 CAGGACACACAGAAGCAGCGAGG + Intronic
954521062 3:51227012-51227034 AAAAACAGAGAGAAGCAGGGTGG - Intronic
955006191 3:54970778-54970800 TGGAGCAGGCAGAAGCATGGTGG + Intronic
955454051 3:59100804-59100826 GAGAGCAATCAGAAGCAGGGTGG - Intergenic
955506116 3:59634872-59634894 CAGAAAACACAGAAGTAGGGTGG - Intergenic
956255160 3:67275629-67275651 CAGAGCAACCAGGACCAGGGTGG + Intergenic
956721509 3:72122111-72122133 CAGAGCAGACAGGCCCAGTGGGG - Intergenic
957495847 3:80990648-80990670 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
959345664 3:105191471-105191493 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
959562150 3:107795222-107795244 CAAAGCAGACAAAAGCTTGGTGG - Intronic
959734897 3:109647734-109647756 GAGAGCAAGCTGAAGCAGGGTGG + Intergenic
959871161 3:111330019-111330041 CAGAGAAGAATGCAGCAGGGTGG + Intronic
959905993 3:111712027-111712049 CACAGCAGACAGAGGTTGGGGGG + Intronic
959992821 3:112647492-112647514 CAGAGCTGACAGAAGCAGTTTGG + Intronic
960753565 3:120983133-120983155 CAGGCCAGAAAGAAGCAGGCAGG - Intronic
961127243 3:124430802-124430824 CAGAGCAGAAAGGCGAAGGGAGG - Intronic
961551007 3:127670739-127670761 CTTAGCAGAGAGAAGCAGGAGGG - Intronic
961743829 3:129050740-129050762 CTGAGCTGACAGCAGCAGGCCGG - Intergenic
962403811 3:135083293-135083315 CAGAGGAGAAAGCAGCAGGGGGG + Intronic
962739988 3:138356627-138356649 CAGAGATGATAGAAGGAGGGTGG + Intronic
963401818 3:144807281-144807303 GAGAGCGAACAGAAGCAGGGTGG - Intergenic
963410933 3:144926793-144926815 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
963629376 3:147713457-147713479 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
963998639 3:151740288-151740310 GAGGGCGAACAGAAGCAGGGTGG - Intronic
964122172 3:153196329-153196351 CAGAGCACACAGAGGCTGGCAGG + Intergenic
964904752 3:161706934-161706956 GAGGGTGGACAGAAGCAGGGTGG + Intergenic
965000622 3:162947996-162948018 CAAAGCAGGCAGAAGAAGGTGGG - Intergenic
965505511 3:169510732-169510754 CAGAGCAGAAAAATGCAGTGTGG + Intronic
965614991 3:170585067-170585089 CACAGGAGAGAGAAGGAGGGTGG + Intronic
965622031 3:170651444-170651466 GAGAGCAAGCAGAAGCAGGGCGG - Intronic
965773092 3:172201291-172201313 GAGAGCAGCCAGAAGCAGGGTGG - Intronic
965878690 3:173361041-173361063 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
966010122 3:175064749-175064771 CAAAGCAGCCTGAAGAAGGGTGG + Intronic
966309322 3:178576191-178576213 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
967342816 3:188419446-188419468 CAGAGAAGAAAGACTCAGGGAGG + Intronic
967419653 3:189259293-189259315 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
967773484 3:193359914-193359936 CAAAAGGGACAGAAGCAGGGTGG + Intronic
968151102 3:196337308-196337330 TAGAGCAGACATGAGCAGGGCGG + Intronic
968548493 4:1210592-1210614 TAAAGCAGAAAGAAGCGGGGGGG - Intergenic
968566575 4:1316619-1316641 CTGGTTAGACAGAAGCAGGGAGG - Intronic
968589026 4:1448607-1448629 CAGAGGTGAGAGAGGCAGGGAGG - Intergenic
968903455 4:3441540-3441562 CAGCACAGACAGTAGCAGTGGGG - Intergenic
968942923 4:3648476-3648498 CAGAGGAAAGAGAGGCAGGGTGG - Intergenic
969079913 4:4610388-4610410 GACAGCAGACAGAGCCAGGGAGG - Intergenic
969155385 4:5205458-5205480 CAGGGCACACAGAGACAGGGAGG + Intronic
969164902 4:5299092-5299114 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
969204065 4:5629147-5629169 CAGAGGAGACAAAACCAGGATGG + Intronic
969214580 4:5711564-5711586 CCGAGCAGACAGCGGCGGGGCGG + Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969351398 4:6600026-6600048 CAGCCCAGGCAGAGGCAGGGAGG + Intronic
969450645 4:7271147-7271169 CAGAGGAGATAGAAGCAGCAGGG - Intronic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
970679290 4:18489024-18489046 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
970719838 4:18973540-18973562 CAGAGCACACAAAGCCAGGGAGG - Intergenic
971151181 4:24033201-24033223 AAGAGGAAACTGAAGCAGGGAGG - Intergenic
971417809 4:26449602-26449624 CATTGGAGACAGAAGCAGGGAGG + Intergenic
971551338 4:27960643-27960665 CAGAGCAGAGAAAAGAATGGTGG + Intergenic
972372531 4:38438493-38438515 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
972943164 4:44221746-44221768 AAAAGCAGACAGAAGAACGGTGG - Intronic
972962661 4:44473557-44473579 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973118882 4:46492917-46492939 CTAAGCAGACATAAGCAGGGAGG - Intergenic
973629023 4:52801797-52801819 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973669365 4:53199908-53199930 CATGGCAGAGAGAAGGAGGGAGG + Intronic
973851700 4:54967284-54967306 CACACGAGAGAGAAGCAGGGAGG - Intergenic
975291152 4:72679481-72679503 GAGAGCAAGCTGAAGCAGGGTGG + Intergenic
975379713 4:73685014-73685036 GAGAGGACACAGAAGCAGGAAGG + Intergenic
975493849 4:75016563-75016585 CAGAGAATACAAGAGCAGGGAGG - Intronic
975635823 4:76446922-76446944 CAGAGCAGACAGATTGAGCGTGG - Intronic
975848043 4:78546192-78546214 CAAGGCAGAAGGAAGCAGGGAGG - Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976548899 4:86371727-86371749 GAGGGCAGACCAAAGCAGGGTGG + Intronic
976549949 4:86382225-86382247 CAGAGCAGAGAGACGAATGGAGG + Intronic
977039729 4:92001637-92001659 GAGAGCAAGAAGAAGCAGGGTGG + Intergenic
977792852 4:101128592-101128614 GAGGGCAAGCAGAAGCAGGGCGG + Intronic
978120617 4:105074703-105074725 CAAAGCAGAGAGAGGGAGGGAGG - Intergenic
978326620 4:107564599-107564621 CAGAGATGACAGCAGCAGAGAGG + Intergenic
979022949 4:115525565-115525587 GAGAGCAAGTAGAAGCAGGGTGG - Intergenic
979417372 4:120460483-120460505 GAGAGCAAGCAGAAGCAAGGTGG + Intergenic
979450902 4:120870123-120870145 CGGAGGAGACAGAGGAAGGGAGG + Intronic
979621540 4:122804070-122804092 GAGAGCAGGCAGCAGAAGGGTGG + Intergenic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
980365803 4:131803400-131803422 CTGAGCAGACAAAAGCAGTTAGG - Intergenic
980494243 4:133570584-133570606 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
980512395 4:133811962-133811984 GAAAGCAAACAAAAGCAGGGTGG + Intergenic
980769254 4:137350722-137350744 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
980888224 4:138786034-138786056 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
980892273 4:138828851-138828873 ATGAGCAGACAGAAGCAAAGAGG - Intergenic
981085510 4:140679133-140679155 CACATCAGGCAGAAGCAGGGTGG + Exonic
981650454 4:147051538-147051560 CAGAGGAGACAGAACCAGAGAGG + Intergenic
982323790 4:154108627-154108649 GAGAGCAAGCTGAAGCAGGGTGG + Intergenic
982794622 4:159630013-159630035 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
983176722 4:164596855-164596877 CAGAACTCACAGAAGCAGAGTGG + Intergenic
983316139 4:166134654-166134676 CAAAGCAAAGAAAAGCAGGGTGG - Intergenic
984526142 4:180861031-180861053 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
984559957 4:181256570-181256592 CAGAGCAGAGTGGAGAAGGGTGG - Intergenic
984609549 4:181822162-181822184 GAGAGCAGCCAGAAGTGGGGGGG - Intergenic
984982032 4:185291594-185291616 CAGCGCATTCAGAAGCAGCGTGG - Intronic
985811664 5:2094711-2094733 CAGAGGAGACAGGATCGGGGAGG + Intergenic
985835675 5:2270229-2270251 GAGGGCAGGCAGAGGCAGGGTGG + Intergenic
985884035 5:2662475-2662497 CACTGCAGACAGTAGCAAGGAGG + Intergenic
985986068 5:3517467-3517489 CAGAGCAGAAAGACGGGGGGAGG - Intergenic
986289048 5:6383982-6384004 CAGGGCAACTAGAAGCAGGGAGG + Intergenic
986358458 5:6951964-6951986 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986367858 5:7052580-7052602 AAGAGCAGAAAGAACCATGGTGG - Intergenic
986418611 5:7553660-7553682 CTGAGGGGACAGAAGCAGGGAGG + Intronic
986496827 5:8350867-8350889 CAGCCCACAGAGAAGCAGGGAGG + Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986645180 5:9910324-9910346 TAGAGTAGACAGAGGCAGAGAGG + Intergenic
986675110 5:10177546-10177568 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986986488 5:13506325-13506347 CAGAGGAGAGAGAATCAGGAGGG + Intergenic
987182881 5:15385623-15385645 AGGAGCAGAGAGCAGCAGGGTGG - Intergenic
987576030 5:19730019-19730041 CAAAGCAGAAAGAAGGTGGGAGG - Intronic
988110406 5:26812712-26812734 CAGAGCAAGGAAAAGCAGGGTGG + Intergenic
988209366 5:28183526-28183548 CAAAGCAGGCAGAAGAAGGTGGG - Intergenic
988739740 5:34058610-34058632 CAGAGCAGACTGGAGCAAGGAGG + Intronic
988977234 5:36527323-36527345 CAGAGTACACAGTAACAGGGGGG - Intergenic
989608831 5:43272429-43272451 GAGAGCAGAATGAAGAAGGGTGG - Intronic
990009788 5:50983041-50983063 CAGAGGCAACAGAAGCAGAGAGG - Intergenic
990803426 5:59631592-59631614 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
992190219 5:74284679-74284701 CAGAGCATCAGGAAGCAGGGTGG - Intergenic
992383936 5:76265769-76265791 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
992992259 5:82296181-82296203 CATAGCAGACAGCAGCAAGCAGG + Intronic
993145327 5:84086448-84086470 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
994011919 5:94914742-94914764 GAGAACAGACAGGAGCAGAGGGG - Intronic
994831727 5:104792234-104792256 CATAGGAGAAAGAAGGAGGGGGG + Intergenic
995865523 5:116686073-116686095 CTGAGCAGACAAAACCAGTGAGG + Intergenic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
996681323 5:126230360-126230382 CAAAGCTGACATAAGCAGTGGGG + Intergenic
997217924 5:132129718-132129740 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
997593070 5:135087352-135087374 AAGAGCAAGCAGAAGCAAGGAGG + Intronic
997751076 5:136346444-136346466 CAGAACAGATAAAAGGAGGGAGG - Intronic
998069105 5:139182777-139182799 CTGAGGACACAGGAGCAGGGGGG + Intronic
998723163 5:144976784-144976806 CAGAGTAGACAGCAGCAGAATGG - Intergenic
998819246 5:146043168-146043190 CAGAGAAGAGAGAAACTGGGTGG - Intronic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999502466 5:152160601-152160623 GAGGGCAGGCAGAAGCCGGGTGG - Intergenic
999523102 5:152372903-152372925 CTGAACAAATAGAAGCAGGGGGG + Intergenic
999556730 5:152751813-152751835 TGGAGCAAGCAGAAGCAGGGTGG + Intergenic
1000956986 5:167554905-167554927 CAGAGTAGACAGATGCTTGGGGG + Intronic
1001415017 5:171539610-171539632 CAAAGCAGACAGTAGAAGGAAGG - Intergenic
1001733820 5:173981962-173981984 CAGGGCAGAATCAAGCAGGGAGG - Intronic
1001924577 5:175626984-175627006 CCCAGCAGCCAGAAGCAGGTTGG - Intergenic
1002161291 5:177315276-177315298 CAGAGATGGCAGAGGCAGGGAGG - Intergenic
1002299968 5:178252469-178252491 CAGAGCAGACAGGAAGAGGGAGG + Intronic
1002306670 5:178287626-178287648 CAGGGCAGGAAGATGCAGGGAGG - Intronic
1002594595 5:180313723-180313745 CAGAGCAGGCCGGAGGAGGGCGG + Intronic
1002685697 5:181007882-181007904 GAAGGCAGGCAGAAGCAGGGCGG + Intergenic
1002801086 6:522131-522153 GAGAGGAGACACAAGCAGGAGGG + Intronic
1003051695 6:2786409-2786431 CACTCCAGACAGAAGGAGGGAGG - Intronic
1003749822 6:9042713-9042735 CAGCGAAGGCAGAAGCACGGTGG + Intergenic
1003790704 6:9544201-9544223 CAGAGGAAACAGAAATAGGGTGG + Intergenic
1004058804 6:12170382-12170404 CAGAACAGACAGAAGCACTGTGG + Intergenic
1004082068 6:12404522-12404544 CAGACAAGACAGAAGGAGAGAGG - Intergenic
1004483237 6:16040587-16040609 CAGAGCAGGCAGCCGCAGTGAGG - Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005658175 6:27965390-27965412 CAGAGCCCAGAGAAGCAGAGAGG - Intergenic
1005893033 6:30155256-30155278 CACAGATGACAGAAGGAGGGCGG - Intronic
1006335811 6:33420127-33420149 AGGAGCAGAGAGAAGCAGAGAGG - Intronic
1006371924 6:33650146-33650168 AAGGGCAGAGAGAAGGAGGGTGG - Intronic
1006463878 6:34179432-34179454 CAGAGCAGGCAGTAGAAGTGGGG + Intergenic
1006972869 6:38065016-38065038 GAGAGCAAAGAAAAGCAGGGAGG + Intronic
1007197933 6:40079290-40079312 CTGAGCAGACAGAAACAGCACGG + Intergenic
1007221823 6:40284687-40284709 CAGAGCAGAAAGGAGAAGGAAGG - Intergenic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007254766 6:40520881-40520903 CCCAGCAGCCAGGAGCAGGGTGG + Intronic
1008176281 6:48271341-48271363 AAGGGCAAATAGAAGCAGGGTGG - Intergenic
1008759070 6:54832288-54832310 TAGAACAGACAAAATCAGGGAGG - Intergenic
1009195930 6:60684371-60684393 AAGAGAAGAGAGAAGGAGGGAGG + Intergenic
1009335972 6:62491866-62491888 GAGTGCAAGCAGAAGCAGGGTGG + Intergenic
1009455181 6:63848530-63848552 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
1009457924 6:63878576-63878598 CAGAGTCTACAGAAGCAGGCAGG + Intronic
1009707206 6:67266774-67266796 GAGAGCAAGGAGAAGCAGGGTGG - Intergenic
1009950252 6:70387147-70387169 AAGAGCAAAAAGAAGCAGGGAGG - Intergenic
1010003834 6:70974315-70974337 GAGGGCAAACTGAAGCAGGGTGG + Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1012129103 6:95468877-95468899 TAGAGATGACAGAAGCAGTGAGG - Intergenic
1012231718 6:96768259-96768281 CAGAGCAAGGAAAAGCAGGGTGG + Intergenic
1012922495 6:105234284-105234306 GAGAGCAAGCAGAAACAGGGTGG - Intergenic
1013274643 6:108572425-108572447 CAGAGCAGACATAAGCCTGAAGG - Intronic
1013558363 6:111280317-111280339 CAGAGCAGAGGGCAGCAGGTTGG - Intergenic
1013721892 6:113040201-113040223 CAAAGAAGAGAGAAGCAAGGAGG - Intergenic
1014523981 6:122479044-122479066 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
1014640098 6:123898892-123898914 GAGAGAAGACAGAGGCAGAGAGG - Intronic
1014907078 6:127043393-127043415 CAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1015264978 6:131281762-131281784 CTCAGCAGAGGGAAGCAGGGAGG - Exonic
1015577806 6:134691180-134691202 AAGAGGAGAAAGAAGGAGGGAGG + Intergenic
1016593050 6:145766940-145766962 GAGGGCAGGCCGAAGCAGGGTGG - Intergenic
1016751402 6:147634312-147634334 CAGAGCAGAAGGAAGAAAGGAGG + Intronic
1017595933 6:156028558-156028580 CAAAGCACACGGAAGCAGGCTGG - Intergenic
1017658107 6:156649140-156649162 CTGAGCAGACAGAAGCTGGGAGG + Intergenic
1018173691 6:161161584-161161606 CAGAGCTGACAAAACCATGGCGG + Intronic
1018810500 6:167294907-167294929 AGGAGGAGACAGAAGCAGTGGGG - Intronic
1018853591 6:167659155-167659177 CACTGCAGCCAGAAGAAGGGAGG - Intergenic
1018949377 6:168369232-168369254 CAGTACATACAGAAGGAGGGAGG - Intergenic
1019131893 6:169883038-169883060 CACATCAGAGAGAACCAGGGTGG - Intergenic
1019212400 6:170417286-170417308 CAGAGCAGAGAGGCCCAGGGAGG + Intergenic
1019271236 7:150224-150246 CAGTCCAGACACAGGCAGGGCGG + Intergenic
1019374334 7:681173-681195 CATAGCAGAAGGCAGCAGGGGGG - Intronic
1019454986 7:1122357-1122379 CAGCACTGACAGCAGCAGGGAGG + Intronic
1020077204 7:5266270-5266292 CAGAGGAGACAGGAGCGGAGGGG + Intergenic
1020734848 7:11935041-11935063 CAGAGTAGGAAGAAGCAGGCAGG + Intergenic
1021402387 7:20224202-20224224 TGGAGCAGAGAGCAGCAGGGTGG + Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022237090 7:28472790-28472812 CAGAGCACAGAGAAGCACTGAGG - Intronic
1023366399 7:39468284-39468306 CGGAGCAGGCAGCAGGAGGGAGG + Intronic
1023382590 7:39623585-39623607 CAGAGCCGCCAGGAGGAGGGTGG + Exonic
1023677668 7:42647464-42647486 CAGAGAATAAAGAAGCAAGGTGG + Intergenic
1023988941 7:45116548-45116570 AGGAGCAGACAGAAACAGGGTGG - Intergenic
1024017643 7:45332692-45332714 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1024270142 7:47635771-47635793 GAGAGGAGAGGGAAGCAGGGGGG + Intergenic
1024292999 7:47819203-47819225 CAGAGCACCCAGAGGCAGTGAGG + Intronic
1024664993 7:51537073-51537095 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1024886657 7:54149746-54149768 CAGAGCAGACAGAAGCCTGGGGG + Intergenic
1025201910 7:56967395-56967417 CAGAGGAGACAGGAGCAGAGGGG - Intergenic
1025227562 7:57178176-57178198 CAGTGCAGCCAGGAGCAGGCAGG - Intergenic
1025670036 7:63609533-63609555 CAGAGGAGACAGGAGCAGAGGGG + Intergenic
1025730313 7:64102136-64102158 CAGTGCAGCCAGGAGCAGGCAGG + Intronic
1026242280 7:68586854-68586876 AAGAACAGTCAGAAGCAGTGGGG + Intergenic
1026622406 7:71961650-71961672 CAGGGCAGAGAGGTGCAGGGAGG - Intronic
1027682045 7:81233433-81233455 CAGAGCAGACTGAGGCAGCTGGG + Intergenic
1027692855 7:81369928-81369950 CAAAGCAGGCAGAAGAAGGTAGG + Intergenic
1028070769 7:86447326-86447348 CAGAACAGAAAGAAGTAGTGAGG + Intergenic
1028555911 7:92124821-92124843 CAGAGCAGGTAGAAACAGGCAGG + Intronic
1029677085 7:102077230-102077252 CAGAGAAAGCAGCAGCAGGGAGG + Intronic
1029731121 7:102438986-102439008 CAGGGCAGGCAGGAGCAGAGGGG - Exonic
1029806387 7:103001620-103001642 CAAAGCAGGCAGAAGGAGGTGGG + Intronic
1030694734 7:112572384-112572406 CAGAGCAGAGAAGAGCAGGGTGG + Intergenic
1030748307 7:113196698-113196720 CAGTGCAGACATAATCTGGGAGG + Intergenic
1030781053 7:113600590-113600612 GAGTGCAAGCAGAAGCAGGGTGG + Intergenic
1031613852 7:123857477-123857499 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1031903065 7:127430581-127430603 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1031923508 7:127618174-127618196 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1032189761 7:129757884-129757906 CAGGGCATGCAGAAGCATGGAGG - Intergenic
1032605490 7:133346315-133346337 AGAAGCAGACAGAAGCAGGCTGG - Intronic
1032626375 7:133595886-133595908 CAGAGAAGACAGAGGCAAGGTGG - Intronic
1032839568 7:135703446-135703468 CGGAGGTGACAGGAGCAGGGAGG + Intronic
1032957201 7:136984741-136984763 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1032966369 7:137103246-137103268 GAGAGCAAGCAGAAGCAAGGTGG + Intergenic
1033087684 7:138357408-138357430 AAAAGCAGACACAGGCAGGGAGG - Intergenic
1034031094 7:147764430-147764452 CAGAGAAGATAAAATCAGGGAGG - Intronic
1034378721 7:150669710-150669732 CTGAGCAGACAAAAGCAGTTAGG - Intergenic
1034448737 7:151126360-151126382 CAGAGCAGAGCGGAGCGGGGCGG + Intronic
1035488559 7:159252133-159252155 CAGAGCAGGCAGAGCCAGGTAGG - Intergenic
1035741359 8:1930598-1930620 CAGAGCAGAGAGAACGGGGGTGG - Intronic
1035930619 8:3776242-3776264 CAGGGAGGATAGAAGCAGGGAGG - Intronic
1036210995 8:6841399-6841421 CACAGCAGACAGAAGAGGGATGG - Intergenic
1036546260 8:9772036-9772058 GAGAGGAGACAGAGGTAGGGAGG + Intronic
1036969099 8:13334206-13334228 CACAGAGGAGAGAAGCAGGGGGG + Intronic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1037753875 8:21699260-21699282 AGGAGCAGACAGGAGGAGGGAGG + Intronic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1037836974 8:22220317-22220339 GAGAGCAGACAGAGCCAGTGGGG + Exonic
1038086779 8:24206723-24206745 CAGAGATGAGAGAAGCAGCGAGG + Intergenic
1039102068 8:33951527-33951549 CACAGCAGCCTGTAGCAGGGTGG + Intergenic
1039365434 8:36923499-36923521 CACAGCATTCAGAAGCAGTGAGG + Intronic
1039743923 8:40406781-40406803 CAGAGCAGACAGGAGCCAGTTGG - Intergenic
1040947329 8:52897271-52897293 CATGGCAGAAAGAGGCAGGGGGG + Intergenic
1041019507 8:53624220-53624242 GAAAGCAGACAGAAGCAGACAGG + Intergenic
1041442508 8:57912201-57912223 CAAAGCACACAGAAGCTTGGGGG + Intergenic
1041457018 8:58072008-58072030 CACAGCAGGCAGAGGGAGGGAGG - Intronic
1041630658 8:60083230-60083252 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1041744038 8:61186647-61186669 AAGAGAAGACAAAAGAAGGGAGG + Intronic
1041765139 8:61411407-61411429 CAGTGGAGACAGAGGCTGGGTGG + Intronic
1041900718 8:62979009-62979031 GAGGGCAAGCAGAAGCAGGGTGG - Exonic
1042110836 8:65379781-65379803 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1042622799 8:70724671-70724693 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
1042969386 8:74391475-74391497 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1043784496 8:84380934-84380956 CAGCTCAGACAGAAGCTGGGTGG + Intronic
1044595354 8:93953565-93953587 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1046153560 8:110258200-110258222 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1047767772 8:128003306-128003328 CAGAGGAGACAGAAGGGGAGGGG - Intergenic
1048132926 8:131717516-131717538 AAGAGCAGAAAGAAGATGGGAGG + Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048342704 8:133553161-133553183 CAAAGCAGAGTGGAGCAGGGAGG - Intronic
1048736704 8:137510172-137510194 CTAAGCAGATAGAAGCAGTGAGG + Intergenic
1048930944 8:139315094-139315116 CACAGCTAACAGAAGCATGGTGG + Intergenic
1049343915 8:142128456-142128478 CAGAGGCCACAGAAGCTGGGTGG + Intergenic
1049385352 8:142340334-142340356 CAGAGCAGACAGAGGCACATGGG + Intronic
1049804110 8:144531183-144531205 CAGGGCAGAGAGCAGCAGGTGGG + Intronic
1049893054 9:88891-88913 CCGTGCAGACAGGAGCAGAGGGG - Intergenic
1050194288 9:3064457-3064479 CAGAGGTTACAGAAGTAGGGTGG - Intergenic
1051298200 9:15618802-15618824 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1052217288 9:25982668-25982690 CAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1052829332 9:33202356-33202378 CAGGGCAGACAGAGCAAGGGTGG + Intergenic
1053734272 9:41088944-41088966 CCGTGCAGACAGGAGCAGAGGGG - Intergenic
1054694122 9:68342628-68342650 CCGTGCAGACAGGAGCAGAGGGG + Intronic
1055199002 9:73634156-73634178 CAGAGAACACTGAAGCAGGAAGG + Intergenic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1057055815 9:91959864-91959886 AAGAACAGAGAGAAGCAGGCTGG - Intergenic
1057254083 9:93529327-93529349 CAGTGCAGAGAGCAGAAGGGAGG - Intronic
1057442522 9:95092322-95092344 CAGAGCAGCCAGATGCTGGGTGG - Intergenic
1057500100 9:95590031-95590053 CAGAGAAGACAGAAGGACCGAGG - Intergenic
1057722891 9:97547024-97547046 AAGAGCAGAGAGAATCTGGGTGG - Intronic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058887907 9:109336690-109336712 CTGAGAAGACAGAGGCAGAGAGG - Intergenic
1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG + Intronic
1059551692 9:115235593-115235615 CAGAGCAGACAGAAACTGATTGG - Intronic
1059789013 9:117619670-117619692 CAGATCAAACAGAAACAGGCAGG + Intergenic
1061467278 9:130791556-130791578 CAAAGCAGGCAGAAGAAGGTGGG + Intronic
1061661490 9:132133256-132133278 CAGAGCTGACAAAAGAAGTGAGG + Intergenic
1061756285 9:132814719-132814741 CACAGCAGACTGAAGGAGAGGGG + Exonic
1061825823 9:133257634-133257656 CAGAGGAGGCAGAAGCTGAGTGG - Intronic
1061846131 9:133389436-133389458 CAGAGCAGCCAGCAGGATGGTGG - Intronic
1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG + Intronic
1062184142 9:135207664-135207686 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
1062197442 9:135282101-135282123 CAGAACAGCCAGAACCAGGCTGG - Intergenic
1062398599 9:136362723-136362745 GAGGGCAGGCAGAGGCAGGGAGG + Intronic
1062447275 9:136600225-136600247 CAGAGCAGACAGAGGCTGGGAGG - Intergenic
1062542530 9:137047970-137047992 CAGAGCAGAAGGCAGTAGGGAGG + Intergenic
1062697038 9:137880794-137880816 CAGAGCAGGCCGAGGCTGGGTGG + Intronic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1185747159 X:2583011-2583033 CAGGGCAGACAGAAGCTGTTTGG - Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186383359 X:9084493-9084515 AAGACCAGATGGAAGCAGGGAGG - Intronic
1186695050 X:12021594-12021616 GGGAGCAGATAGAAGCAGGCAGG - Intergenic
1186832432 X:13404141-13404163 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1186962608 X:14752928-14752950 CAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1187399540 X:18947379-18947401 CAAACCAGACAGAAGCTCGGAGG + Intronic
1187479374 X:19641004-19641026 CAGAGCGGACAGCAGCATAGGGG - Intronic
1187840210 X:23479216-23479238 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
1188276478 X:28207292-28207314 CAGAGCCTACAGAGGCAGGCAGG - Intergenic
1188387182 X:29575512-29575534 CAAAGCAGGCAGAAGAAGGTGGG - Intronic
1189018757 X:37312457-37312479 CAAAGCAGACAGAATCTGGTGGG - Intergenic
1189088795 X:38055463-38055485 CAGAGGAGACAGACACTGGGAGG - Intronic
1189818035 X:44843982-44844004 GAGAGGAGACAGAAAGAGGGTGG + Exonic
1191094428 X:56659427-56659449 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1191132703 X:57031301-57031323 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1191657374 X:63613313-63613335 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191802632 X:65098592-65098614 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1192157011 X:68754190-68754212 CAAAGCAGACAGTATGAGGGAGG - Intergenic
1192207568 X:69106415-69106437 CAGAACAGGCACAAGGAGGGGGG - Intergenic
1192495840 X:71616286-71616308 CAGAGCCGGCAGAGGGAGGGAGG + Exonic
1192960561 X:76126613-76126635 GAGAGCAAAGAGAAGCAGGGTGG + Intergenic
1193254102 X:79325977-79325999 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1193258658 X:79379852-79379874 AAGAGCGAAGAGAAGCAGGGTGG + Intergenic
1193404398 X:81083781-81083803 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1193742982 X:85241274-85241296 GAGAGGAGAGAGAAGGAGGGCGG + Intergenic
1193897181 X:87128461-87128483 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1194182793 X:90734655-90734677 GAAAGCAGCCAGAAGCAGGGGGG + Intergenic
1194215502 X:91126128-91126150 CAAAGCAGAAAAAAGCAGGAAGG - Intergenic
1194798481 X:98241138-98241160 CAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1195140021 X:101950016-101950038 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1195250720 X:103043549-103043571 CAGAGAAGACAGAAAAAGAGTGG - Intergenic
1195434774 X:104829425-104829447 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1195510348 X:105709171-105709193 CAGAGCCAACAGAAGCAGCCAGG + Intronic
1195810708 X:108825504-108825526 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195820952 X:108944660-108944682 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195861482 X:109388078-109388100 CAGAGCAGAGAGAAAAAGGTGGG + Intronic
1196320324 X:114280280-114280302 AAAAGCAGACAGTAGCATGGTGG - Intergenic
1196946678 X:120833355-120833377 CAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1197505917 X:127305663-127305685 GAGGGCGAACAGAAGCAGGGTGG + Intergenic
1197549391 X:127870261-127870283 AAGAGCAGACAGCAGAATGGTGG + Intergenic
1198545010 X:137682300-137682322 CCCAGCAGACAGAAGAAAGGAGG - Intergenic
1198889516 X:141377465-141377487 CACAGCTGACAGAAGCACAGAGG - Intergenic
1199243196 X:145572665-145572687 AAAAGCAGGCAGAAGCAGGGTGG - Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199830608 X:151545915-151545937 GAGAGCAAGCAGAAGCAGAGTGG + Intergenic
1200529412 Y:4316610-4316632 GAAAGCAGCCAGAAGCAGGGGGG + Intergenic
1200740347 Y:6847096-6847118 GAGAGCAAGCAGGAGCAGGGTGG - Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201543145 Y:15131532-15131554 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic