ID: 1184015083

View in Genome Browser
Species Human (GRCh38)
Location 22:41779957-41779979
Sequence CTGTAGCCACAGGTGAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184015083 Original CRISPR CTGTAGCCACAGGTGAAGAT GGG Intronic
902552798 1:17229292-17229314 CTGCAGCCACAGGACAGGATGGG - Intronic
904317354 1:29674088-29674110 CTTAAGCCCCAGGTCAAGATAGG - Intergenic
908683916 1:66692886-66692908 CTGATGCCACAGGTGAAAACAGG + Intronic
910730056 1:90385319-90385341 CTGCAGCCACTGGTGGAGAATGG - Intergenic
911477095 1:98387073-98387095 CTGTAGCTAGAGGCGAAGAAAGG + Intergenic
913478472 1:119261693-119261715 CTGTAACCATAGATGAGGATGGG - Intergenic
914929306 1:151916196-151916218 CAGCAGCCAGAGGTGAAGAAAGG + Intergenic
919772242 1:201169955-201169977 CAGGAGTCACAGCTGAAGATTGG - Intronic
920628468 1:207627329-207627351 GTGTATCCATTGGTGAAGATAGG - Intronic
1066162552 10:32749118-32749140 CTGGAGAAACAGGTAAAGATAGG - Intronic
1067345170 10:45433057-45433079 CTCTAACTACAGGTGAAGTTAGG - Intronic
1067533868 10:47093961-47093983 CTGTTGCCCCAGGTGAAGGCAGG - Intergenic
1070723021 10:78769702-78769724 CTGTAGCCGTAGGTGTAGGTGGG - Intergenic
1073938795 10:108669246-108669268 CTTGAGCCACAGGAGAAAATAGG - Intergenic
1075201648 10:120409468-120409490 CTGCAGCCACAGGTCCAGCTGGG - Intergenic
1075646931 10:124102800-124102822 CTGAAGCCACAGGGGAAGGATGG + Intergenic
1077401296 11:2359094-2359116 ATGCAGCCACAGGTGCAGACAGG - Intergenic
1078772335 11:14362500-14362522 CTGAAGACACAGGAGAATATGGG + Intronic
1078820455 11:14875244-14875266 ACGAAGCCACAGGTGGAGATGGG - Intergenic
1082303609 11:50543185-50543207 CTGTGGCCAAAGGTGAAAAAGGG - Intergenic
1082691352 11:56308360-56308382 CTGGAGCCACAGGAAAAGCTGGG + Intergenic
1085749394 11:79147602-79147624 CTTTAGCCAGAGGAGAAGATAGG - Intronic
1085820072 11:79782997-79783019 TTGTAACCACAGGTGATGTTGGG + Intergenic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1085927048 11:81035098-81035120 CGGGAGCCACAGGAGAATATTGG + Intergenic
1087528184 11:99345389-99345411 CTGTGTACAAAGGTGAAGATAGG - Intronic
1090329971 11:125923836-125923858 CTGCAGCCACTGGTGCAGTTTGG - Intergenic
1093761235 12:22913962-22913984 CATTAGCCCCAGGTGAAGAATGG - Intergenic
1093934647 12:24987840-24987862 GTGTGGGCACAGGTGCAGATGGG - Intergenic
1095365246 12:41395699-41395721 CTGAAGCCTAAGGTAAAGATAGG - Intronic
1097413383 12:59283221-59283243 CAGCAGCCACAGGGGAAGAGTGG - Intergenic
1098450943 12:70617556-70617578 CTGTAGCCAGAACTAAAGATGGG - Intronic
1101440238 12:104698480-104698502 CTGAAGAGACAGGTGATGATAGG - Intronic
1102906065 12:116676063-116676085 CTGTTGCCAGAGGTGGAAATTGG + Intergenic
1105634350 13:22203062-22203084 CTGAAGCCACAGGGGCAGACTGG - Intergenic
1105886742 13:24649120-24649142 GTGTGGCTACAAGTGAAGATTGG - Intergenic
1110712541 13:78665444-78665466 TTTGAGCCACAGCTGAAGATTGG + Intergenic
1113351610 13:109535036-109535058 CTGAAGCCAGAGGTGAAGGTGGG - Intergenic
1113594878 13:111524060-111524082 AAGTAGCCACAGATGAAGCTAGG - Intergenic
1114301892 14:21385789-21385811 CGGTAGTCACTGGTGAAGAGGGG + Exonic
1114652071 14:24291545-24291567 CTTTGGCAACAGGTGAAGTTTGG - Exonic
1115509327 14:34124430-34124452 CCGCAGCCACAGGGGAAGATGGG - Intronic
1118689053 14:68320772-68320794 CTGTGGCCACAGCAGATGATGGG - Intronic
1119578339 14:75750184-75750206 CTGTAGGCACAGGTTATGAGAGG + Intronic
1120863205 14:89273520-89273542 CTGTAGCCACTGGGGAAGAAGGG + Intronic
1121325637 14:93018134-93018156 CTGGAGGCACAGCAGAAGATGGG + Intronic
1123097650 14:105774025-105774047 GTGTAGCCACAGGTGAGCAGGGG - Intergenic
1124571142 15:30865122-30865144 CTGTAGTCCCAGGTGCAGATTGG + Intergenic
1125726197 15:41869459-41869481 CTGAAGCCACGGGTGGAGAGAGG - Intronic
1126195126 15:45922847-45922869 CTGCAGCCACAGAAAAAGATTGG - Intergenic
1128458521 15:67847941-67847963 CTGTATCCACATGTGGAGGTAGG + Intergenic
1129537993 15:76329860-76329882 CTGGAGCCAGAGGTGACTATGGG - Intergenic
1129689282 15:77704294-77704316 GTGTAGCCTCAGGGGCAGATTGG - Intronic
1130830032 15:87589956-87589978 CTGGTGCCCCAGGTGAAGTTGGG - Intergenic
1131344617 15:91634419-91634441 GTGTAGGCACATGTGAATATTGG - Intergenic
1132106982 15:99070084-99070106 CTGTAGCCACACATGAACATGGG - Intergenic
1132302825 15:100787109-100787131 CTCTAGACCCAGGTGAGGATCGG + Intergenic
1132856293 16:2046395-2046417 GTGGGGCCACAGGTGAAGGTAGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1135156901 16:20060216-20060238 CTGCAGCCAAAGGTGTAGAATGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1148046178 17:44746501-44746523 CTTAAACGACAGGTGAAGATGGG - Intronic
1151867497 17:76813900-76813922 CTGTAGCCACAGGCTGAGGTGGG - Intergenic
1152865154 17:82717955-82717977 GTGGAGCCCCAGGTGAGGATGGG + Intronic
1153864009 18:9245421-9245443 CTGTAGCCCCAGCTGGAGAGTGG - Intronic
1153955849 18:10095508-10095530 CTTTACCAACAGGTGAAGAGTGG - Intergenic
1154369231 18:13743530-13743552 CTGTAGACACAGGAAAAGCTGGG + Intronic
1160816672 19:1039200-1039222 CTGAAGCCACAGGTGAGTCTGGG + Intergenic
1160837609 19:1132108-1132130 CTGCAGCCACAGCTGCAGCTGGG + Intronic
1161081087 19:2310499-2310521 CTGCAGCCCCGGGAGAAGATGGG - Intronic
1161884485 19:6983279-6983301 GTGAAGACAGAGGTGAAGATTGG - Intergenic
1162760346 19:12885250-12885272 CTGTAGTTACAGGGGAAGAAGGG - Intronic
1166230752 19:41424827-41424849 CTGTAACAACAGGTGAAGAGGGG - Exonic
926776779 2:16430962-16430984 CTGTATCCACTGCTGAAGTTAGG + Intergenic
929553794 2:42911203-42911225 CTGTAGCGACAGGGGAGGCTGGG + Intergenic
931097150 2:58954014-58954036 CTGGAAGGACAGGTGAAGATGGG - Intergenic
934975691 2:98800518-98800540 CTGTGGCCACAGCTCAAGAGAGG + Intronic
935813770 2:106826991-106827013 GTGTACCCAGAGCTGAAGATGGG + Intronic
938310403 2:130285445-130285467 CTGGAGCCACAGGCCAAGCTGGG + Intergenic
941185781 2:162319696-162319718 CTGTAGCCACATGTGACTGTGGG + Intronic
945835216 2:214831627-214831649 CTGGATCCACAAGTGAACATCGG - Intergenic
946266408 2:218546143-218546165 TTGTAACCACTGGGGAAGATTGG - Intronic
946629425 2:221649974-221649996 CTGGAGGCAAAAGTGAAGATAGG + Intergenic
948657615 2:239486483-239486505 CTGGACCCACAGGTGCAGAGTGG - Intergenic
948761909 2:240197504-240197526 CTGCAGCCCCAGGTCAAGCTAGG + Intergenic
1170013328 20:11752138-11752160 CTGCAGCAACAGGGGAAGACAGG - Intergenic
1170777739 20:19392251-19392273 CTGTACCCACAGGTGATCAGAGG - Intronic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1174293512 20:49526432-49526454 CTGTAGGCACAGGGGAAAAGTGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1176375642 21:6085776-6085798 CTGTGGACACCGGTGAAGAGGGG + Intergenic
1177854681 21:26387466-26387488 CTGTAGCCACTGCAGAGGATGGG + Intergenic
1178064069 21:28884681-28884703 CTGTAGCCACATGTGAGGACTGG + Intronic
1179069328 21:38056922-38056944 CTGCAGCCAAAGGTGAGGAGTGG - Intronic
1179747832 21:43452468-43452490 CTGTGGACACCGGTGAAGAGGGG - Intergenic
1181015298 22:20065218-20065240 CTGTGGCCACAGGAGAGGAGGGG - Exonic
1182100990 22:27657209-27657231 GTGTAGCTACATTTGAAGATGGG - Intergenic
1184015083 22:41779957-41779979 CTGTAGCCACAGGTGAAGATGGG + Intronic
1184826666 22:46957183-46957205 CTGTATGCCCAGGTGAAGAGGGG - Intronic
949543879 3:5055476-5055498 CTGTAGCCACAGAAGAGGAAGGG - Intergenic
949787505 3:7758167-7758189 CTGGAGCCACAACTGAAGTTAGG - Intergenic
950395017 3:12727667-12727689 CGGTGGCCACAGGAAAAGATAGG - Intergenic
950825395 3:15813677-15813699 CTGCAGGCACTAGTGAAGATAGG - Intronic
953376439 3:42432257-42432279 CTCTTGCCACAGGGGAAAATGGG - Intergenic
953578001 3:44128639-44128661 CCTCAGCCACAGGTCAAGATGGG + Intergenic
954380019 3:50214379-50214401 CTGTAGGCACAGGTCAGGGTGGG - Intronic
954879350 3:53823229-53823251 CTGGAGCCACGGGCCAAGATGGG + Intronic
955413517 3:58671387-58671409 CTGTAACAACAAGTGAAGAGAGG - Intergenic
955506291 3:59636331-59636353 CTGTGACCACAGGTGAGGGTGGG + Intergenic
958819113 3:98952395-98952417 CTGCAGCCACTGTTGCAGATGGG + Intergenic
960931894 3:122860191-122860213 CTTTAACCACAGGTGAGCATAGG + Exonic
961445159 3:126977041-126977063 CTGTGTCCACATGTGTAGATGGG + Intergenic
963093326 3:141507860-141507882 CTGTAGCCACAAGAGAGGCTGGG + Intronic
963543982 3:146631655-146631677 CCTGAGCAACAGGTGAAGATAGG - Intergenic
966651303 3:182304069-182304091 CTGTAGCCAAAAGGGCAGATAGG - Intergenic
967171087 3:186824431-186824453 CTGGTGCCACAGGTGAGGGTGGG - Intergenic
968681328 4:1922561-1922583 CTGTGGCCACATTTGAAGAGAGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970873051 4:20838499-20838521 ATCTAGCTACAGGGGAAGATGGG - Intronic
971355129 4:25888467-25888489 CTGAAGCCACCGGTGGAGGTGGG - Intronic
973889806 4:55357517-55357539 CAGTAGCCACAGGTGGCGATTGG + Intronic
975374189 4:73623795-73623817 CGCTAGCCACAGGTGGAGAATGG - Intergenic
978703878 4:111681662-111681684 TTTTAGCCACAGGATAAGATTGG + Intergenic
979535001 4:121809504-121809526 CAGTAACCACAGGTGACTATTGG + Intronic
983552626 4:169032989-169033011 CTGTTTCCACAGGTGTAAATTGG - Intergenic
984665777 4:182427584-182427606 CTATAGCCATAGATAAAGATGGG - Intronic
984878036 4:184386738-184386760 CTGCAGCCACACATGGAGATAGG + Intergenic
985200999 4:187485488-187485510 CTGTTGGCACAGGTGGATATAGG + Intergenic
985607167 5:864045-864067 CTGGAGCCACACGTGATGCTCGG + Intronic
985914469 5:2906989-2907011 GTGTAGCTACAGGTCAAGACTGG + Intergenic
986029190 5:3879918-3879940 CTGAAAGCACAGGAGAAGATGGG - Intergenic
986195843 5:5535824-5535846 CTGCAGCTCCAGGTGCAGATGGG + Intergenic
986684430 5:10263730-10263752 CTGTAGCCACTTGTGTAGCTCGG + Intronic
987546595 5:19318208-19318230 TTGTAGCTACAGCTGCAGATAGG - Intergenic
993509284 5:88751610-88751632 ATATAGCCACAGGAGGAGATAGG + Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999262725 5:150247594-150247616 CTGTACCCAGAAGTGAAGAGAGG - Intronic
999594978 5:153192945-153192967 CTGTGGGCACAGGTGAATAGTGG - Intergenic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
1000047792 5:157535827-157535849 CTGTACCCACAGCTCAAGAATGG - Intronic
1001223811 5:169926734-169926756 CTGTAACTAGAGGTGAAGTTTGG + Intronic
1002778281 6:347389-347411 TTCTAGCAACAGGTTAAGATGGG - Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005977910 6:30814257-30814279 ATGGAGCCACACGAGAAGATGGG - Intergenic
1006186192 6:32182900-32182922 CTGAAGCTACAGGAGAAGGTGGG + Exonic
1008683750 6:53901828-53901850 GTGCAGCCACAGGGCAAGATAGG - Intronic
1011057915 6:83226048-83226070 CTGTAGGCACAGGTGAAGATAGG - Intronic
1011253701 6:85399951-85399973 CTGTAGCTGCAGGTGAACTTAGG + Intergenic
1013248911 6:108314952-108314974 CTGCAGCCACATGAGTAGATGGG + Intronic
1014234668 6:118940612-118940634 CTTTGGCCATAGGTGAACATTGG + Intergenic
1015840673 6:137473594-137473616 CTGTAGAATCAGGTGATGATTGG + Intergenic
1015936686 6:138411815-138411837 CTGGAACCACAGGTGCACATCGG - Intronic
1016885019 6:148950986-148951008 TTTTAGCCAGAGGTGAAGAGTGG + Intronic
1018239831 6:161762646-161762668 CGGTGGCCACATGTGAAGTTTGG + Intronic
1018512575 6:164541076-164541098 GTGAAGACACAGGTGGAGATTGG - Intergenic
1019647244 7:2137612-2137634 CTCTAGCCCCAGGTGCAGACAGG + Intronic
1020853842 7:13391883-13391905 CTATAGACACACGTGAAGAAAGG + Intergenic
1024229420 7:47352914-47352936 CTGTAGCCACATGAAAAGAGTGG - Intronic
1026084886 7:67254860-67254882 CATTAGCCACAGGATAAGATAGG - Intergenic
1026692288 7:72560060-72560082 CATTAGCCACAGGATAAGATAGG + Intronic
1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG + Intronic
1027846993 7:83392705-83392727 CTGTAGCAACAGCTGTATATTGG - Exonic
1032175994 7:129626415-129626437 CTGTAGCCACATCATAAGATTGG + Intronic
1034454866 7:151163460-151163482 CAGTAGCCACAGGTGAACAGTGG - Intronic
1037238265 8:16747471-16747493 CAGTAGCCACATGTGATGAGTGG + Intergenic
1038392965 8:27222216-27222238 TTGGATCCAGAGGTGAAGATGGG - Intergenic
1048619314 8:136114331-136114353 GTCTAGCCCCAGGTTAAGATGGG - Intergenic
1049468997 8:142766989-142767011 CTGTTGCCAAAGGTGGAGAAGGG + Intronic
1050119192 9:2290673-2290695 TTGTAGGCAGGGGTGAAGATGGG + Intergenic
1051154765 9:14129220-14129242 CTTTAGAGACAGGTGAAGAACGG + Intronic
1055654164 9:78436915-78436937 CTCCAGCTACAGGAGAAGATGGG - Intergenic
1055719139 9:79152215-79152237 CTGGAGGCACACGTTAAGATAGG + Intergenic
1056687066 9:88775631-88775653 CTGTGGCCACGTGTGAATATCGG - Intergenic
1061428683 9:130517499-130517521 CTATAGCCACTGGTGAACTTCGG - Intergenic
1061637143 9:131919336-131919358 CTGTAGCCAAAGGTGAACTCAGG - Intronic
1186835166 X:13430326-13430348 CTCTAGACACAGGGGAAGCTGGG + Intergenic
1193583608 X:83294251-83294273 CTCTAGCCACAGGTGAGGCCTGG + Intergenic
1195769841 X:108339001-108339023 GTGTGGCCACAGGGGAAGTTGGG - Intronic
1195966821 X:110436674-110436696 CTGTATCCCCAGGAGAGGATGGG + Intronic
1199297338 X:146174111-146174133 GTGGTGCCACAGGTAAAGATGGG - Intergenic
1199510759 X:148619223-148619245 CTGTAGCCCCAGGATAAGAGAGG - Intronic
1200036005 X:153330899-153330921 CTGTAGCTACAAGAGAAGCTGGG + Intergenic
1201419933 Y:13787408-13787430 GTAAAGCCACAGGTGAAGAAAGG - Intergenic