ID: 1184015656

View in Genome Browser
Species Human (GRCh38)
Location 22:41784052-41784074
Sequence CTCATCTGTGGTTCAGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 161}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184015656_1184015668 21 Left 1184015656 22:41784052-41784074 CCAGAGACTGAACCACAGATGAG 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1184015668 22:41784096-41784118 GAGGAGGCCAGTGAGGATGGGGG No data
1184015656_1184015667 20 Left 1184015656 22:41784052-41784074 CCAGAGACTGAACCACAGATGAG 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1184015667 22:41784095-41784117 GGAGGAGGCCAGTGAGGATGGGG 0: 1
1: 4
2: 10
3: 120
4: 1064
1184015656_1184015665 18 Left 1184015656 22:41784052-41784074 CCAGAGACTGAACCACAGATGAG 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG No data
1184015656_1184015662 2 Left 1184015656 22:41784052-41784074 CCAGAGACTGAACCACAGATGAG 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1184015662 22:41784077-41784099 CAGAGAAGGCTGTCTGATGGAGG 0: 1
1: 0
2: 2
3: 40
4: 403
1184015656_1184015666 19 Left 1184015656 22:41784052-41784074 CCAGAGACTGAACCACAGATGAG 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1184015666 22:41784094-41784116 TGGAGGAGGCCAGTGAGGATGGG No data
1184015656_1184015660 -1 Left 1184015656 22:41784052-41784074 CCAGAGACTGAACCACAGATGAG 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1184015660 22:41784074-41784096 GGCCAGAGAAGGCTGTCTGATGG 0: 1
1: 0
2: 4
3: 37
4: 329
1184015656_1184015663 5 Left 1184015656 22:41784052-41784074 CCAGAGACTGAACCACAGATGAG 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1184015663 22:41784080-41784102 AGAAGGCTGTCTGATGGAGGAGG 0: 1
1: 0
2: 4
3: 38
4: 445
1184015656_1184015664 14 Left 1184015656 22:41784052-41784074 CCAGAGACTGAACCACAGATGAG 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1184015664 22:41784089-41784111 TCTGATGGAGGAGGCCAGTGAGG 0: 1
1: 0
2: 3
3: 46
4: 322
1184015656_1184015670 29 Left 1184015656 22:41784052-41784074 CCAGAGACTGAACCACAGATGAG 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1184015670 22:41784104-41784126 CAGTGAGGATGGGGGAGATTTGG 0: 1
1: 0
2: 1
3: 47
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184015656 Original CRISPR CTCATCTGTGGTTCAGTCTC TGG (reversed) Intronic
901877771 1:12176714-12176736 CTCATCTGTGCTTCACACTGAGG - Intronic
902410263 1:16207958-16207980 CTCATCTCTGGGTCAGGCACCGG - Exonic
904540292 1:31228209-31228231 CACATCTCTGGTTCAGGCTGGGG + Intronic
906056069 1:42917938-42917960 CTGATCTGTGGTTTGGTGTCTGG - Intergenic
907606034 1:55818369-55818391 CTGATCTGTGGTTTATTCTTTGG - Intergenic
908596159 1:65690835-65690857 CTCAACTGTGGCTTAGACTCAGG + Intergenic
912342065 1:108926161-108926183 CCCACCTGAGGTTCAGTCACTGG + Intronic
914932873 1:151950199-151950221 CACATCTGTGGTCCTGTCTATGG - Intergenic
918748317 1:188236384-188236406 TTCTTTTGTGGTTCAGTTTCTGG - Intergenic
918907597 1:190518163-190518185 CTCACCTCTTTTTCAGTCTCAGG + Intergenic
919467266 1:197937303-197937325 TGCATATGTGGTGCAGTCTCAGG - Intergenic
919973535 1:202596085-202596107 CTCATCTATGGCAAAGTCTCAGG - Exonic
1064827400 10:19420560-19420582 CTCATCAGTGATTCATGCTCTGG + Intronic
1067203999 10:44198305-44198327 TCCATATGTGGTTCATTCTCAGG + Intergenic
1067337831 10:45379016-45379038 CACACCTGTGGTGCAGTCACAGG - Intronic
1067837954 10:49653147-49653169 CCCGTCTGTGATTCAGTCTCTGG - Intronic
1077219535 11:1409609-1409631 CTCAGCAGTGGCTCTGTCTCTGG - Intronic
1079815806 11:25056495-25056517 CTCTTCTGTTACTCAGTCTCAGG - Intronic
1081746601 11:45477500-45477522 CTCATCTTGGGTTAATTCTCCGG - Intergenic
1082826857 11:57586319-57586341 CTCTTCTGTGGTTCACAGTCTGG + Intergenic
1082985121 11:59162010-59162032 CTCACCTGAGCTTCAGTGTCAGG + Intergenic
1088286807 11:108198727-108198749 CCCATGTGTGGTTGAGTCTGAGG - Intronic
1088619956 11:111671642-111671664 CACATCTGTGGTTCTGTCCATGG - Intronic
1089398124 11:118149068-118149090 CTCATCTGGGGTTTTGTCTGAGG + Intronic
1090419827 11:126567048-126567070 CTGATCTGTGCTCTAGTCTCTGG - Intronic
1090551864 11:127828650-127828672 GGCATTTGTGGTTCAGTTTCAGG + Intergenic
1092832035 12:12453541-12453563 GCCATCTGGGGTTCAGTGTCAGG + Intronic
1097155516 12:57009250-57009272 CTCCTCTGTGGCTGGGTCTCCGG + Intergenic
1097693040 12:62751878-62751900 CTCATCTGTGGTTCATGGTTAGG + Intronic
1104184235 12:126413602-126413624 ATCATCTGAGGTTCAGACTAAGG + Intergenic
1104417935 12:128610892-128610914 CTCCACTGTGGTTCGTTCTCAGG + Intronic
1105885361 13:24637242-24637264 CTAATGTGTGGTTCAGCCTCGGG - Intergenic
1107104511 13:36628918-36628940 CCCATCTTAGGTTCATTCTCTGG + Intergenic
1107164323 13:37267278-37267300 CTCAGCTGTGTTTCAGTTTGAGG + Intergenic
1108595364 13:51944423-51944445 ATCCTCTGTCGTTCAATCTCAGG + Intronic
1108718042 13:53101166-53101188 CTAATCTTTGCTTCAGGCTCTGG + Intergenic
1108856113 13:54794803-54794825 CTCATCTATGTATCTGTCTCTGG - Intergenic
1112819513 13:103315039-103315061 AGCATCTGTGGTTCATCCTCAGG + Intergenic
1114941052 14:27611285-27611307 CTCAGATGTGGGTCTGTCTCAGG + Intergenic
1117435827 14:55714456-55714478 CTCACCTGTGTTCCAGACTCAGG + Intergenic
1118067228 14:62205495-62205517 CAAATCTGTGGTTTAGTGTCTGG + Intergenic
1119577057 14:75734230-75734252 CTTAGTTGTGGTTCAGCCTCAGG - Intronic
1121580260 14:95024773-95024795 CTCATCTCTAGATCAGTCACTGG + Intergenic
1122318292 14:100838330-100838352 CTCATGAGTGTTTCGGTCTCAGG + Intergenic
1123834180 15:24171097-24171119 TTCCTCTCTGGTTCAGTCTTGGG - Intergenic
1124378718 15:29146229-29146251 TTAATCTGTGGATCAGTTTCAGG - Intronic
1127882486 15:63170373-63170395 GTCATCTGTGGTAGAGCCTCAGG + Intergenic
1131049494 15:89337111-89337133 CTCTCCTGAGATTCAGTCTCAGG + Intergenic
1133309995 16:4839055-4839077 CTCACCTGTGTTTCAGCCTTCGG + Intronic
1136049962 16:27643181-27643203 CCCATCTTTGGTTTAGTGTCAGG + Intronic
1138214193 16:55188857-55188879 CACATCTGGGGTTCAGTCCCTGG - Intergenic
1138415389 16:56868509-56868531 CTCCTCCCTGGTTCAGTCTCAGG + Intronic
1139285961 16:65814275-65814297 GTCATCTGTGGCTCACTTTCTGG - Intergenic
1142553605 17:756541-756563 CAGATCTGTGGTTGTGTCTCAGG + Intergenic
1143837294 17:9702451-9702473 CTCATCTGTGATTCAGCGTGAGG + Intronic
1146652007 17:34612844-34612866 CTCAGCTTTGGTTCCGTCACTGG + Intronic
1148257857 17:46151992-46152014 CTCATCTGTGGTACAACCACAGG + Intronic
1148914080 17:50959864-50959886 CACATCTGTGGTTAGGCCTCTGG + Intergenic
1149217321 17:54372536-54372558 GTCAGCTCTGGTTCAATCTCTGG + Intergenic
1153212016 18:2777417-2777439 CTCATATGTGTCTCAGTCTTGGG + Intronic
1156205520 18:34882047-34882069 GTCATCTGTGGTTTATTTTCAGG + Exonic
1156624285 18:38889615-38889637 CTCATCAGTGGTGCTGTCCCAGG - Intergenic
1157815324 18:50725675-50725697 CTTGTCTCTGGTTCTGTCTCTGG + Intronic
1158393848 18:57064509-57064531 CTCATCTGTGTTCCAGTCATTGG - Intergenic
1160105508 18:75970774-75970796 CTAATATGTGGTTCTGTTTCTGG - Intergenic
1160390889 18:78531736-78531758 TTCATCTGTGCTTGAGGCTCCGG - Intergenic
1161657306 19:5524207-5524229 CACCTCTGTGTTTCTGTCTCTGG + Intergenic
1163381550 19:16972193-16972215 TCCATCTGTGGTTCAGGCTGGGG + Intronic
1168493609 19:56832364-56832386 CCCCTCTGTGGTACAGTCACTGG - Intronic
925996387 2:9296932-9296954 GGCATCTGTGGTTGAGTTTCTGG + Intronic
926669315 2:15561183-15561205 TTCACCTGTACTTCAGTCTCCGG + Exonic
927889917 2:26741812-26741834 CTCATTTGTGGTTTTATCTCTGG + Intergenic
928321926 2:30290797-30290819 AAGACCTGTGGTTCAGTCTCAGG - Intronic
929885166 2:45871781-45871803 CTCCTCTCTGGGGCAGTCTCAGG - Intronic
931036500 2:58250247-58250269 TACATCTGTTTTTCAGTCTCAGG - Intergenic
933757864 2:85654252-85654274 CCCATGTGTGGTTCAAACTCTGG - Intergenic
934070298 2:88377715-88377737 CTTATTTGTGGTTCAGACTTTGG - Intergenic
935401294 2:102663059-102663081 CACATCTGTGATCCTGTCTCAGG + Intronic
936644686 2:114355508-114355530 CTCATTTGTGCCTCAGCCTCAGG + Intergenic
937107105 2:119326371-119326393 CACATCTGTGTGTCTGTCTCTGG + Intronic
937115030 2:119398863-119398885 CTCATCCGTGGTTCATGCTCAGG + Intergenic
937421100 2:121755911-121755933 CTCCTCTGTCGCTCAGTCTCGGG + Intronic
938411440 2:131068096-131068118 CACAGCTGTGGTCCAGACTCAGG + Intronic
939113937 2:138039482-138039504 CTCAGCTGGGCTTCATTCTCAGG + Intergenic
939858843 2:147393596-147393618 CTCATCTGTTGTTGAGTGTTAGG + Intergenic
942562011 2:177229758-177229780 CTCAAATGTGGTTCAGCCTTTGG + Intronic
946142081 2:217700061-217700083 CTCTTCTGTGGTTCTCTCTGAGG - Intronic
946775517 2:223136169-223136191 ATCATCTGTTGTTCAGGGTCGGG + Intronic
948017934 2:234705311-234705333 GTCATCTGTGGTTCTGGCTAGGG - Intergenic
948809357 2:240466891-240466913 CTCAGCAGTGGTGCTGTCTCAGG - Exonic
1168835155 20:872925-872947 CTCCTGTGTGGTCCAGCCTCTGG + Exonic
1170506709 20:17034072-17034094 CACATCTGTGTTTGAGACTCTGG - Intergenic
1171338931 20:24412051-24412073 CTCATCTGGGCTTCAGGATCTGG + Intergenic
1172432182 20:34901412-34901434 GTAATCTGTGGTTCAGTTTTTGG + Intronic
1174560428 20:51427135-51427157 CTCATCTGTGGCTGAGTCTCTGG + Intronic
1176903017 21:14466588-14466610 CTCACCTGTGGATAAGTCTGAGG - Intergenic
1177700309 21:24631316-24631338 CCCATCTGTGGTTATTTCTCTGG - Intergenic
1180250069 21:46579164-46579186 CTTCTTTGTGGTTCAGTCTTAGG + Intergenic
1181055789 22:20260018-20260040 CTCATCCTTGGTGCAGTTTCAGG - Intronic
1182335816 22:29582764-29582786 CTCCTCTGTGGTGCATTCTCTGG + Intergenic
1183612681 22:38921160-38921182 CTCATTTATGGTTCAGTTTCAGG + Intergenic
1184015656 22:41784052-41784074 CTCATCTGTGGTTCAGTCTCTGG - Intronic
1184165772 22:42726758-42726780 ATCATCTCTGGACCAGTCTCTGG - Intergenic
1184757077 22:46522867-46522889 CTCATCTCTGGTGAAATCTCAGG + Intronic
950706963 3:14788803-14788825 AGCATCTGTAGGTCAGTCTCAGG + Intergenic
953856331 3:46502143-46502165 CTCAGCTTTGGTTCAGTCACTGG - Intergenic
954643670 3:52117557-52117579 CTCATCTGTGGTTAAGAGCCTGG - Intronic
955750779 3:62183997-62184019 GTCAACTCTGGTTCAGACTCAGG + Intronic
955847344 3:63179829-63179851 CTCAACTGTCGTTGAGTGTCTGG + Intergenic
957358702 3:79125985-79126007 CTCATATGAGGTACAATCTCTGG - Intronic
959341264 3:105134853-105134875 TCCATATGTGGTTCAGTCTGAGG - Intergenic
959883221 3:111470593-111470615 CTGCTTTGTGGTTCAGTCTTGGG + Intronic
961055263 3:123782410-123782432 CTCCTCTGTGCTCCAGACTCTGG - Intronic
961478180 3:127161604-127161626 CTCATGTGCTGCTCAGTCTCAGG + Intergenic
961715060 3:128852299-128852321 GTCCTCTGTGGGTCATTCTCTGG + Intergenic
963956162 3:151256367-151256389 CTCATCTGTGCTTTACTCTGTGG + Intronic
969314002 4:6370644-6370666 GTCTTCTGTGTTTCAATCTCAGG - Intronic
970203860 4:13636166-13636188 CTCATCTGTGCTTCACTCTGTGG - Intergenic
974398872 4:61374915-61374937 CTTATCTGAGGTTCAGTGTCTGG + Intronic
978551392 4:109931099-109931121 CTGATGTGTGGTACAGTCTGTGG - Intronic
979103453 4:116653340-116653362 CTCATCTTTCTTTCTGTCTCTGG - Intergenic
981693728 4:147538176-147538198 CTGATCTTTGCTTCAGTCTCAGG + Intronic
986312529 5:6563860-6563882 CTACTCTGTGGTTCTGTTTCTGG + Intergenic
988169153 5:27632493-27632515 CTCATCTGTGAACCAGGCTCTGG + Intergenic
988458773 5:31413283-31413305 CTGATTTTTGGTTCAGGCTCTGG - Intronic
992415534 5:76549284-76549306 CAGAGCTTTGGTTCAGTCTCAGG + Intronic
994191181 5:96870956-96870978 CTTTTCAGTGGTTCAGTTTCTGG + Intronic
995073385 5:107951148-107951170 CTCATTACTGGCTCAGTCTCAGG + Intronic
995578736 5:113571681-113571703 CTTCTTTCTGGTTCAGTCTCAGG + Intronic
998504293 5:142659747-142659769 CTCAGCTGTGTTCCAGGCTCTGG - Intronic
999610652 5:153365688-153365710 CTTCTCTGTGATTCAGTTTCTGG + Intergenic
1000143964 5:158434897-158434919 CTCATCTATGGATCACTTTCAGG - Intergenic
1000216853 5:159166641-159166663 CCCATATGTGGGTCAGTCTGTGG + Intronic
1001325654 5:170721909-170721931 CTCATCTGGGGTCCACTCTAGGG + Intronic
1001349550 5:170945871-170945893 CTCATCTGTGATAAAGACTCAGG + Intronic
1001503128 5:172254786-172254808 GTCCTCTGTGGTTCAATCCCAGG + Intronic
1002040253 5:176508222-176508244 CTCGTCTGTGGTTGAGTTTATGG + Exonic
1003717476 6:8664597-8664619 CTGATCTCTTGTTCAGTTTCTGG - Intergenic
1004360815 6:14969146-14969168 ATCATCTTTGGTTCAGTGACTGG + Intergenic
1007326233 6:41062201-41062223 CTCTGCTGTGGTTCAGTAGCAGG - Intronic
1012051993 6:94358543-94358565 CTCTTCTCAGGTTCAGACTCTGG - Intergenic
1015220120 6:130794792-130794814 CTCATCTCTGGTTCTTTGTCAGG - Intergenic
1015669823 6:135676010-135676032 CCCACCTGTTGTTCAGTCTTGGG + Intergenic
1016514483 6:144879154-144879176 CTCACGTGTGGTTTTGTCTCAGG + Intergenic
1017381008 6:153829651-153829673 CACATCTGTGGTTAGGTCTGTGG - Intergenic
1018682309 6:166274957-166274979 CTCATCTGTGAGTCAGGCTGAGG - Intergenic
1020806461 7:12795771-12795793 CCAAGCTGTGTTTCAGTCTCTGG - Intergenic
1022910847 7:34898575-34898597 CTCCTCTCTGCTTCACTCTCAGG + Intergenic
1030939637 7:115630174-115630196 CTCATGTGTGGTTATGCCTCTGG + Intergenic
1033001672 7:137512020-137512042 CACAGCTGTGGTTCCGTCTTGGG + Intronic
1034017678 7:147604821-147604843 CTCATGTGTGGCTCACTCTGAGG + Intronic
1034094145 7:148390906-148390928 GTCATTTGTAGTGCAGTCTCTGG + Intronic
1034324388 7:150217294-150217316 ATTATCAGTGCTTCAGTCTCTGG - Intergenic
1034768806 7:153751937-153751959 ATTATCAGTGCTTCAGTCTCTGG + Intergenic
1037305755 8:17501812-17501834 CTAATCTGGGATTCAGTATCGGG + Intronic
1039187583 8:34934399-34934421 CTCATCAGTGGGTGAGTCTAAGG + Intergenic
1041970315 8:63733829-63733851 CTGGTATGTGGTTCAGTCTCAGG - Intergenic
1044199259 8:89414313-89414335 CACATCTGTGGTCCTGTCTATGG - Intergenic
1048040266 8:130720773-130720795 CTGATCAGTGGTTCAGTCTCTGG - Intergenic
1051336583 9:16071180-16071202 CTCAGCTGTGATTAGGTCTCAGG - Intergenic
1052607185 9:30720022-30720044 TTCATCTCTGGATCAGTGTCAGG - Intergenic
1055235308 9:74115202-74115224 AACATCAGTGGTTCACTCTCAGG + Intergenic
1057442578 9:95092501-95092523 CTCATCTGTGGCTTTGTCTGGGG + Intergenic
1057517388 9:95733578-95733600 CTCATCTCTGTTGCAGTTTCTGG + Intergenic
1057938884 9:99263302-99263324 AATATTTGTGGTTCAGTCTCAGG - Intergenic
1062345148 9:136111037-136111059 CTTCTCTGTGGTCCAGGCTCAGG + Intergenic
1062466966 9:136685814-136685836 CTCACCTGTGGTTCTGGCCCTGG - Intronic
1186357669 X:8803962-8803984 ATCAGCTGTGATTCAGACTCCGG - Intergenic
1192165445 X:68824776-68824798 CCTATCTGTAGGTCAGTCTCTGG - Intergenic
1192224722 X:69220442-69220464 CTCATCTGTGGTTCAGAGGTTGG - Intergenic
1193867502 X:86753908-86753930 CTCATATTTGGTTCAGTTTAAGG - Intronic
1194330684 X:92580382-92580404 CTCATCAGGGGCTCTGTCTCAGG + Intronic
1195672300 X:107480193-107480215 CTCATCTTTGGTACAATCTTTGG - Intergenic
1195994701 X:110720116-110720138 CTTTTCTGTGGCTTAGTCTCTGG - Intronic
1197798646 X:130325465-130325487 CTTATTTGTGGGTCAGTTTCTGG + Intergenic
1200610510 Y:5323086-5323108 CTCATCTGTGGTTAAAGCACAGG + Intronic
1200639388 Y:5699452-5699474 CTCATCAGGGGCTCTGTCTCAGG + Intronic