ID: 1184015659

View in Genome Browser
Species Human (GRCh38)
Location 22:41784064-41784086
Sequence GCCTTCTCTGGCCTCATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 303}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184015659_1184015666 7 Left 1184015659 22:41784064-41784086 CCACAGATGAGGCCAGAGAAGGC 0: 1
1: 0
2: 0
3: 25
4: 303
Right 1184015666 22:41784094-41784116 TGGAGGAGGCCAGTGAGGATGGG No data
1184015659_1184015663 -7 Left 1184015659 22:41784064-41784086 CCACAGATGAGGCCAGAGAAGGC 0: 1
1: 0
2: 0
3: 25
4: 303
Right 1184015663 22:41784080-41784102 AGAAGGCTGTCTGATGGAGGAGG 0: 1
1: 0
2: 4
3: 38
4: 445
1184015659_1184015668 9 Left 1184015659 22:41784064-41784086 CCACAGATGAGGCCAGAGAAGGC 0: 1
1: 0
2: 0
3: 25
4: 303
Right 1184015668 22:41784096-41784118 GAGGAGGCCAGTGAGGATGGGGG No data
1184015659_1184015670 17 Left 1184015659 22:41784064-41784086 CCACAGATGAGGCCAGAGAAGGC 0: 1
1: 0
2: 0
3: 25
4: 303
Right 1184015670 22:41784104-41784126 CAGTGAGGATGGGGGAGATTTGG 0: 1
1: 0
2: 1
3: 47
4: 401
1184015659_1184015665 6 Left 1184015659 22:41784064-41784086 CCACAGATGAGGCCAGAGAAGGC 0: 1
1: 0
2: 0
3: 25
4: 303
Right 1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG No data
1184015659_1184015664 2 Left 1184015659 22:41784064-41784086 CCACAGATGAGGCCAGAGAAGGC 0: 1
1: 0
2: 0
3: 25
4: 303
Right 1184015664 22:41784089-41784111 TCTGATGGAGGAGGCCAGTGAGG 0: 1
1: 0
2: 3
3: 46
4: 322
1184015659_1184015662 -10 Left 1184015659 22:41784064-41784086 CCACAGATGAGGCCAGAGAAGGC 0: 1
1: 0
2: 0
3: 25
4: 303
Right 1184015662 22:41784077-41784099 CAGAGAAGGCTGTCTGATGGAGG 0: 1
1: 0
2: 2
3: 40
4: 403
1184015659_1184015667 8 Left 1184015659 22:41784064-41784086 CCACAGATGAGGCCAGAGAAGGC 0: 1
1: 0
2: 0
3: 25
4: 303
Right 1184015667 22:41784095-41784117 GGAGGAGGCCAGTGAGGATGGGG 0: 1
1: 4
2: 10
3: 120
4: 1064

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184015659 Original CRISPR GCCTTCTCTGGCCTCATCTG TGG (reversed) Intronic
900354149 1:2251912-2251934 GGCTTATCTGGCCTCGTCTCTGG + Intronic
900392764 1:2440914-2440936 TCCTCCTGGGGCCTCATCTGAGG + Intronic
900496675 1:2978925-2978947 GCTCACTCTGGCCTCCTCTGAGG + Intergenic
900525235 1:3125296-3125318 GCCTCCTCTGGCCAGCTCTGAGG - Intronic
900574041 1:3374231-3374253 CCCTTCTCTGCCCTGCTCTGGGG + Intronic
901128088 1:6943283-6943305 GCCTCCTCAGGGCTCAACTGTGG + Intronic
901921740 1:12541755-12541777 ACTTTCTCTGACCTCAGCTGCGG - Intergenic
902439839 1:16422049-16422071 GCCTCCTGTGGCCTGATGTGTGG + Intronic
902940199 1:19795638-19795660 GGCCTCTCTGTCCCCATCTGTGG - Intronic
903021634 1:20399299-20399321 CCCTTCTCTGGCCTCCTCCCAGG - Intergenic
903770990 1:25764224-25764246 ACCTTCTCTGGCCCCATCAATGG + Intronic
905250190 1:36643397-36643419 ACTTTCTCTGGGTTCATCTGAGG + Intergenic
905668652 1:39777501-39777523 GCTTCCGCTGGCCACATCTGGGG + Intronic
906515264 1:46435352-46435374 GCCCTCTCAGTCATCATCTGTGG - Intergenic
907502467 1:54891572-54891594 GGCTGCTCTGCCCTCATCAGGGG - Intergenic
907834411 1:58095439-58095461 GCCTGCTCTGTCCTCTACTGTGG - Intronic
908397516 1:63740051-63740073 GGCATCTCTGGACCCATCTGGGG - Intergenic
911352493 1:96771963-96771985 GGCTTCTGTGGCCTCAAATGTGG + Intronic
912764621 1:112396858-112396880 GCATCCTCTGGCCTCTTGTGAGG + Intronic
915308543 1:154994999-154995021 GCATTCTCTGGCCCCTCCTGGGG + Intergenic
917265774 1:173219158-173219180 ACCTTCTCTAGCCTTCTCTGTGG + Intergenic
917677799 1:177336994-177337016 GTCTTTTCTGGCCTCAGCTCTGG + Intergenic
918743988 1:188174964-188174986 TCTGTCTCCGGCCTCATCTGTGG - Intergenic
918894243 1:190319306-190319328 TCCTTCACTGGCCTCATTTTGGG + Intronic
919673895 1:200362473-200362495 GCCTTCTCTGACCCCATATTAGG + Intergenic
919885847 1:201934181-201934203 GTTTTCTCTGCCCTCATCCGGGG + Intronic
920301471 1:204991676-204991698 GCCTTCTAGGGCCACAGCTGGGG - Intronic
920455286 1:206096535-206096557 GATTTCTCAAGCCTCATCTGGGG - Intronic
921978353 1:221227576-221227598 GCCCACTCAAGCCTCATCTGGGG - Intergenic
922425082 1:225484943-225484965 GGCTTCAGTGGCCTCATCAGTGG + Intergenic
922614201 1:226951489-226951511 CCTTTCTCTGGCTTCACCTGGGG + Intronic
922783143 1:228269176-228269198 GCCTCATCTGGCCCCATGTGAGG + Intronic
923334033 1:232951288-232951310 TCCACCTCTGGCCTCAGCTGTGG - Intronic
924577881 1:245296807-245296829 TCTTTTTCTGGCCTCATCTCAGG + Intronic
1062809616 10:452819-452841 CTCTTCTCTCGCCTCACCTGTGG - Intronic
1063013026 10:2043994-2044016 GTGTTCTCTGGGCTCACCTGTGG - Intergenic
1063346540 10:5317514-5317536 CCCTTCTCTGGCCCCACTTGTGG - Intergenic
1066309960 10:34186584-34186606 GCTTACTCTGGGCTCATCAGAGG - Intronic
1067039052 10:42939155-42939177 GCCTCCTCTGGCCTCATGGACGG + Intergenic
1070724306 10:78777856-78777878 GCCTTCTCTGTCCTCATCCTGGG - Intergenic
1070779867 10:79131308-79131330 GCCCACTCTGGCCTCTTCGGTGG + Intronic
1070952960 10:80445492-80445514 GTCTTATTTGGCCACATCTGGGG + Intergenic
1071963062 10:90824881-90824903 GGCTTTTCTGGGCCCATCTGGGG + Intronic
1072657734 10:97342151-97342173 GCCTTCTCTGTTCACATCTTTGG - Intergenic
1072761374 10:98059812-98059834 CCCTTCTCTCGACTCCTCTGAGG - Intergenic
1073020899 10:100442866-100442888 GACTTCTGTGACCACATCTGAGG + Intergenic
1073609113 10:104925765-104925787 ACCTTCTCCAGCCTCCTCTGTGG - Intronic
1074812098 10:117114865-117114887 GGCTTCTCTGCTCTCATATGGGG + Intronic
1075717040 10:124561730-124561752 GCCTTCTCTGGACACAACTCAGG - Intronic
1075922339 10:126224163-126224185 GCCCTCTCTGGGCTCCCCTGAGG - Intronic
1076095664 10:127733553-127733575 CCCTTCTCTGGCTTCTTCTCGGG - Intergenic
1076120886 10:127935619-127935641 ACGTTCTCTGACCTCTTCTGCGG + Intronic
1076920116 10:133446709-133446731 GCCTTCTCCGCCCTCCGCTGTGG + Intergenic
1077551974 11:3204477-3204499 GCCATCCCTGGCCTCTGCTGTGG + Intergenic
1080894868 11:36440772-36440794 GCTTGCTGTGGCCTCACCTGGGG - Intronic
1081682599 11:45018736-45018758 GTCTGCTCTGGAGTCATCTGGGG + Intergenic
1083198019 11:61102530-61102552 GCCTTCTCTTGCCTCAGCCTGGG - Exonic
1085781188 11:79410673-79410695 GCCTTCTCTGACCTTTCCTGAGG + Intronic
1086217292 11:84399261-84399283 GCTATCTCTGGCCTCTTCAGGGG + Intronic
1086460704 11:87002781-87002803 GCCTTCTCTGTACTCTTCTCTGG - Intergenic
1089102465 11:115975065-115975087 GCCTTCTTTGGCTCCTTCTGTGG + Intergenic
1089737364 11:120559058-120559080 GCCTTCTCTGTTCTCAGCTGGGG + Intronic
1090065174 11:123497523-123497545 AGCATCTCTGGACTCATCTGGGG - Intergenic
1090379806 11:126318490-126318512 GCTTTCTCTTTCCTCCTCTGTGG - Intronic
1090438968 11:126710613-126710635 CCCTTCTCTGTCCTCAGCTGGGG + Intronic
1091397507 12:163080-163102 TCCTTCTCTCTCCTCGTCTGAGG - Intronic
1092859535 12:12708613-12708635 GCCTTCTCTGCTCTCTTTTGTGG + Intergenic
1094428153 12:30337279-30337301 GCTTTCTCTGACCTGTTCTGAGG - Intergenic
1095948139 12:47765539-47765561 GCCTCCTGGGGCCTCAGCTGAGG + Intronic
1096080138 12:48827649-48827671 GCTCTCGCTGGCCTCATCAGAGG - Exonic
1098050438 12:66447103-66447125 GTTTTCCCTGGCCTCATGTGGGG + Intronic
1098531465 12:71546525-71546547 TTCCTCTCTGGCCACATCTGGGG + Intronic
1100114037 12:91281332-91281354 TCCTTCTTTGGCCTCTTCTATGG - Intergenic
1101991784 12:109491783-109491805 GCCTGCTCTGCCCCCATCTGTGG + Intronic
1103369443 12:120407785-120407807 GCCCTATCTGGCCTCCACTGTGG - Intergenic
1103503878 12:121427213-121427235 GCCTCGGCTGGCCTCATCTTTGG + Intronic
1103624195 12:122206098-122206120 CCCTCCTCTGCCATCATCTGAGG - Intronic
1103924348 12:124415278-124415300 GCCTGCTGTGCCCTCACCTGGGG + Intronic
1104800830 12:131554421-131554443 GGCTTCTCTTGCTACATCTGGGG + Intergenic
1105012303 12:132763811-132763833 GCCTTCTTGGGCCTCTTCTAAGG - Intergenic
1105057381 12:133114780-133114802 GCCTTTTCAGGCCTTATCTCTGG - Exonic
1105278583 13:18950195-18950217 GCCCTGTCTGCCCTCATCTTGGG + Intergenic
1105840502 13:24249743-24249765 GCCTTCTCCGGGCTCCTTTGGGG - Exonic
1105881392 13:24609197-24609219 GCGTTCTGTTGGCTCATCTGGGG + Intergenic
1107828263 13:44350328-44350350 GCCTTCCCTGGGCTCCCCTGGGG + Intergenic
1108748299 13:53418772-53418794 ACCTTCTCTCTCCTCTTCTGTGG - Intergenic
1110440128 13:75518439-75518461 GTCTGCTCTGGCCCCATTTGAGG + Intergenic
1110764407 13:79266457-79266479 GCTCACTCTGGCCCCATCTGAGG + Intergenic
1112282752 13:98076747-98076769 GCCCACTCTGGCCTCATTTGAGG - Intergenic
1112975587 13:105313794-105313816 GCCTTTTATGGCCTCACCTTGGG + Intergenic
1113434899 13:110283717-110283739 GCCATCTGTGAGCTCATCTGGGG + Intronic
1114549895 14:23526611-23526633 GCCTCCCCTGGCCTCAGTTGAGG - Exonic
1118106003 14:62660261-62660283 GCCTTCTTGGGCCACAGCTGAGG - Intergenic
1118436617 14:65777023-65777045 GCCTACTCTCGCCTCATATCAGG - Intergenic
1118592633 14:67412546-67412568 GTCTTCTCTGCCCCCATCAGAGG - Intergenic
1118671506 14:68132966-68132988 GCCTTCTCTGGACTGATCTCGGG + Intronic
1119202718 14:72769730-72769752 GGCTTATCTTGCCTCATCTCTGG - Intronic
1119227058 14:72952414-72952436 GCCTTCTCAGTCCACATCCGTGG + Intronic
1119324336 14:73750732-73750754 TCCTTCTCTGGACTGCTCTGTGG - Intronic
1120188094 14:81415302-81415324 AACCTCTCTGGCCTCAGCTGAGG - Intronic
1121325561 14:93017690-93017712 GCCTTCTCTGGCCTCTGCTAAGG - Intronic
1122088554 14:99323149-99323171 GGATTCTGTGTCCTCATCTGCGG + Intergenic
1122104472 14:99441732-99441754 CCCTGCTGTGGCCTCATCAGGGG - Intronic
1125200310 15:37096642-37096664 GTCTTCTCTGGCCAGATCTGAGG - Intronic
1125421978 15:39512935-39512957 CCCTTCTCTGGGCTGCTCTGTGG - Intergenic
1126348234 15:47718342-47718364 GGCTGCTCCGGCCTCAACTGCGG - Intronic
1126612572 15:50544517-50544539 TCCTTCTCTAACCTCATCTGTGG + Intronic
1127788017 15:62373174-62373196 GCCTTCTGAGGGCTCAACTGTGG - Intergenic
1128886124 15:71289747-71289769 GCCTTCTCAACCCTCATCTAGGG + Intronic
1129276288 15:74447820-74447842 TCTTTCTCTGGCCCCATCTGCGG + Intronic
1130127773 15:81108404-81108426 CCCTTATCTGGCCACAACTGTGG - Intronic
1130287883 15:82570839-82570861 GCATTATCCAGCCTCATCTGAGG + Intronic
1132485659 16:189416-189438 GCCTTGCCTGGCCTGGTCTGCGG - Intronic
1132803717 16:1766265-1766287 GGCCTCTGTGGCCTCCTCTGTGG - Exonic
1132985431 16:2764422-2764444 CCCTTCAATGGCCTCATCTTGGG + Exonic
1133063538 16:3190336-3190358 GCCTCCTCTGGTCTACTCTGAGG + Intergenic
1133995212 16:10742940-10742962 GGCTTCACTGGCCACATCTGGGG + Intergenic
1135106332 16:19653184-19653206 GCCTTCTCTTGGCTCAAGTGTGG - Intronic
1135732857 16:24908884-24908906 GCCTTCTGGGGCCTGATCTCGGG + Exonic
1135884812 16:26296121-26296143 GCTTTCTCTCTCCTCCTCTGGGG + Intergenic
1136178894 16:28537653-28537675 CCATGGTCTGGCCTCATCTGGGG + Exonic
1136630984 16:31489126-31489148 GCCTTCTGGGGACTCATCGGGGG + Exonic
1137492837 16:48947411-48947433 GACTTCTCAGGCCACATCTAGGG + Intergenic
1137670179 16:50274152-50274174 AGCTTCCCTGGCCTCCTCTGTGG - Intronic
1137673608 16:50293041-50293063 GCCTTCTCTGCCGCCACCTGGGG - Intronic
1137678203 16:50314936-50314958 GGATTCTCTGGCCTCCTCTAAGG + Intronic
1137961764 16:52888163-52888185 GGCTCCTCTGGCCTTTTCTGTGG + Intergenic
1139739264 16:69021218-69021240 TACTTCTCTAGCCTCATCTAGGG + Intronic
1141493592 16:84391337-84391359 GCCATCTCTCGCATCTTCTGTGG + Intronic
1143058985 17:4184370-4184392 GCCTTCTCTTGCCTGTCCTGAGG - Intronic
1144374636 17:14627146-14627168 GGATTCTCTGGTCTCTTCTGGGG - Intergenic
1146096437 17:29934578-29934600 GCATTTCCTGGCCTTATCTGAGG + Intronic
1146369862 17:32258956-32258978 GACTTCGTTGGCCTCCTCTGGGG - Intergenic
1147574030 17:41588414-41588436 CCCTTCTCTGGCTTCTTCTTTGG - Intergenic
1148219533 17:45851785-45851807 TCCTGCCCTGGTCTCATCTGAGG - Intergenic
1149180580 17:53931801-53931823 GACATCTCTGGACTCACCTGGGG - Intergenic
1151413724 17:73947981-73948003 GCCTTCCCTGGCCTCATAAGTGG - Intergenic
1151575374 17:74950395-74950417 GCCCTCTCTGGCCTCGTCCCAGG - Intergenic
1152183307 17:78838964-78838986 TCCTTCTCTGGGCTTGTCTGGGG - Intronic
1152500010 17:80701586-80701608 GCCAGTTCTGGCCCCATCTGGGG - Intronic
1152932671 17:83118136-83118158 TCCTTTTCTGACCTCACCTGGGG - Intergenic
1152935371 17:83133633-83133655 ACCTTCTCCTGCCTCCTCTGAGG + Intergenic
1155493938 18:26424744-26424766 CCATTCTCTGGACACATCTGTGG - Intergenic
1155582412 18:27324542-27324564 GCCCTCTCTGGCCTCACCCCAGG - Intergenic
1156969606 18:43139408-43139430 GCCCTCTCTGGCCGCACTTGAGG + Intergenic
1157762194 18:50273410-50273432 GCCTTCTCTTGCTTCACCTGGGG + Exonic
1158230565 18:55249897-55249919 TTCTTTTCAGGCCTCATCTGTGG + Intronic
1158347921 18:56534462-56534484 GCTTTCTATGCCCTCACCTGAGG - Intergenic
1160313852 18:77822033-77822055 GCCCTCCCTGGCCTGGTCTGGGG - Intergenic
1160658834 19:288913-288935 GACTTCTCTGGCCTGCTCTTAGG - Intronic
1161258004 19:3320430-3320452 GCCCACTCTGCCCACATCTGAGG + Intergenic
1161456811 19:4373740-4373762 GCCCTCTGTGGCCTGGTCTGAGG - Intronic
1162148208 19:8626594-8626616 GCCTTGTGTGACCTCAGCTGGGG + Intergenic
1163311102 19:16514997-16515019 GCCGCCTCTGGCCCCATCTCGGG - Intronic
1163533581 19:17864406-17864428 GCCTTTTCCAGCCTCACCTGTGG + Intergenic
1163813477 19:19449108-19449130 TCCCTCTCTGGTGTCATCTGGGG - Intronic
1164413029 19:28021375-28021397 GGCTTCTCTGGCATCACATGGGG - Intergenic
1165732242 19:38153194-38153216 GCCGGCTCTGGCCTTATCAGCGG - Intronic
1166251753 19:41576242-41576264 GCCTGCTCTGTCCTCCTCTGTGG - Exonic
1166260984 19:41640615-41640637 GCCTGCTCTGTCCTCCACTGTGG + Intronic
1166270170 19:41708699-41708721 GTCTGCTCTGTCCTCCTCTGTGG - Exonic
1166281398 19:41796645-41796667 GCCTGCTCTTTCCTCCTCTGTGG - Exonic
1167962286 19:53115675-53115697 GCTTCCTCTCCCCTCATCTGAGG + Intronic
1168104277 19:54157009-54157031 GCTTTCTCTTGCCTCTCCTGAGG + Exonic
1168334991 19:55592514-55592536 CCCTTCCCTTGCCACATCTGCGG - Exonic
925189513 2:1871481-1871503 GGCTTCACTGGACTCATGTGGGG - Intronic
926000040 2:9323291-9323313 GCCGGCTCTGCCCTCACCTGTGG + Intronic
926144484 2:10388315-10388337 ACCTTCTCAGGCAGCATCTGAGG - Intronic
926217887 2:10916190-10916212 GCCTTCTCTGCACTCACCTGGGG + Intergenic
926684816 2:15690571-15690593 TCCTCCGCTGGCCCCATCTGAGG + Intergenic
927825993 2:26310768-26310790 CCCATCTTTGGCCTCACCTGGGG - Exonic
929630989 2:43461764-43461786 TGCTTCTCTGGCCTGATCTCTGG + Intronic
929994085 2:46814276-46814298 CCCTTCTCTGGACGCCTCTGTGG + Intergenic
931361163 2:61579063-61579085 TACTTCTCTGGCCTCATGTCTGG - Intergenic
932284205 2:70518820-70518842 TCCTGCTCTGGCCTCTGCTGGGG + Intronic
932631436 2:73346742-73346764 GCTTTCTCTGGACAAATCTGGGG + Intergenic
933781714 2:85807173-85807195 GACTTCTCTTTCCTCATCTGGGG - Intergenic
936078034 2:109414138-109414160 GCATGCCCTGGCCCCATCTGCGG - Intronic
936993355 2:118388764-118388786 GCCCTCTCTGGCTTGAACTGTGG - Intergenic
937234737 2:120423801-120423823 GCCTCCTCTAACCTCATCTTGGG + Intergenic
937886377 2:126902268-126902290 GCCACCTCTGGCCTCGTCTCAGG - Intergenic
941374171 2:164706952-164706974 GCTTTCTCTGGCCTCTCCTTTGG + Intronic
942446535 2:176082137-176082159 GCCTGCTCTGGCCTCCCCGGGGG - Intronic
942781165 2:179645657-179645679 GCCTTCTCCATCCTCATCTCAGG + Intronic
947058761 2:226137755-226137777 GCCTTCTCTGCCCACACCTGTGG - Intergenic
947543158 2:230992185-230992207 GACTTCTCTGGCCTTGGCTGAGG - Intergenic
947587427 2:231365122-231365144 CCCTAATCTGGCCTCATCTCAGG - Intronic
947606225 2:231487567-231487589 GCCTTCTGTGTGGTCATCTGGGG - Intergenic
948533170 2:238626450-238626472 GTTTTCTCTGGCATCACCTGAGG + Intergenic
948911170 2:241003370-241003392 GCATCCTCTGGCCTCAGCAGGGG - Intronic
1168887851 20:1272686-1272708 CCTTTCTCTGCCTTCATCTGTGG - Intronic
1169334785 20:4747270-4747292 GGCTTCTTTGGCATCATGTGTGG - Intergenic
1172297367 20:33822601-33822623 GCCTTCTGTGGCCTTGTCTAAGG + Intronic
1173560859 20:44004393-44004415 TCCTTCTCTGTTCTCATCTAGGG - Intronic
1174023048 20:47547277-47547299 CCCTTCTCTTACCCCATCTGTGG + Intronic
1174139628 20:48403937-48403959 GCCTTCCCTGGCCTTGCCTGTGG - Intergenic
1175518756 20:59586135-59586157 GCCTGCCCTGGCCTGCTCTGTGG + Intronic
1175899175 20:62353330-62353352 CCCTGCTGTGGCCTCACCTGAGG - Intronic
1175908449 20:62393202-62393224 GCCCTCCCTGGAGTCATCTGTGG + Intronic
1176162100 20:63653255-63653277 GCCTCGTCTGGCCTCGCCTGGGG - Intronic
1176663778 21:9664528-9664550 GCCCACTCTGGCCGCATTTGAGG - Intergenic
1178332103 21:31706832-31706854 TCTTTCTCTGGCTTCATCAGAGG - Intronic
1180190710 21:46161253-46161275 GCCTTCTCTGGCCTCGCGCGCGG + Exonic
1180710309 22:17835108-17835130 GGCCTCGCTGGCCTCATCTCGGG - Intronic
1181144506 22:20834921-20834943 GCCTGCTCAGGCCTCTTCTGGGG + Intronic
1182043595 22:27257436-27257458 GCCTTCTCTGGTCTCCTCATCGG - Intergenic
1182956889 22:34434991-34435013 CTCATCTCTGGCCTCAGCTGGGG - Intergenic
1183232545 22:36592047-36592069 GTTTTCTCTGGCCACATTTGTGG + Intronic
1183278126 22:36914082-36914104 GGCTTCTGTCTCCTCATCTGTGG + Intronic
1184015659 22:41784064-41784086 GCCTTCTCTGGCCTCATCTGTGG - Intronic
1184644686 22:45889545-45889567 TCCCTCTCAGGCCTCCTCTGGGG + Intergenic
1184886940 22:47352246-47352268 TCCCTGCCTGGCCTCATCTGTGG + Intergenic
1185392263 22:50568999-50569021 CCCTTCTCTTGCCACCTCTGTGG + Exonic
950115171 3:10446066-10446088 GCCTGCTCTGACCTGAACTGTGG + Intronic
950207603 3:11092589-11092611 GCCTTTTCTGGACCCACCTGTGG + Intergenic
950850336 3:16056292-16056314 TCCCTCTCTGGCCACATCTCTGG + Intergenic
950900869 3:16496239-16496261 GCCTTCTGTGGCATCATGTTTGG - Intronic
953111369 3:39943076-39943098 GTGTTCTCTAGACTCATCTGAGG + Intronic
953186865 3:40646134-40646156 CCCTTCTCTGGCCTCCTCCTGGG - Intergenic
954699508 3:52443920-52443942 GCCTTCCCTGGGCCCATCCGTGG + Intronic
955420847 3:58735639-58735661 ACCTCCTCTGGCCTGAGCTGTGG - Intronic
956201793 3:66713988-66714010 GCCTTCTTTGTCTTCATCAGTGG - Intergenic
956992855 3:74788678-74788700 GCCTTCTGTGGCCAAATGTGTGG + Intergenic
957039667 3:75327552-75327574 GTCCACTCTGGCCTCTTCTGTGG + Intergenic
959501048 3:107106264-107106286 GCCTTGTCTGACTTTATCTGTGG + Intergenic
960620244 3:119630267-119630289 TCCTTCTCTGGCCTCTTCACAGG - Intergenic
960875056 3:122287667-122287689 GCCTTCGCTGGCGTGCTCTGAGG + Intergenic
961141146 3:124557608-124557630 GCCAGCTCTGGCCTCCTGTGAGG + Intronic
961325458 3:126106715-126106737 GCAGTGTCTGGCCTCAGCTGGGG - Intronic
961561351 3:127732606-127732628 TCCTTCTCAGGACTCACCTGGGG - Intronic
966984005 3:185163456-185163478 GCCTTCTCTTCCTTCAGCTGTGG - Intergenic
967727176 3:192872706-192872728 GTTTTCTCTGGGCTCATCTTTGG + Intronic
968746409 4:2362781-2362803 CCTTTCTCTGCCCTCCTCTGGGG + Intronic
969702940 4:8777667-8777689 TCCTGCTCTGGCCTCCTTTGAGG - Intergenic
970304284 4:14715710-14715732 ACCTTCTCAAGCCTCATCTCAGG - Intergenic
970483758 4:16504064-16504086 ACCTTCTCTGGCCTCAGTGGAGG - Intronic
970817952 4:20179496-20179518 GCCCTCTCTGGCCGCACTTGAGG - Intergenic
970893059 4:21069535-21069557 GCCTTCACAGGCCTCTTCTCCGG - Intronic
973028282 4:45302381-45302403 GCCTTCTCTGACCCCATCCCAGG + Intergenic
978460831 4:108950148-108950170 GCCTCCTCATGCCTCCTCTGAGG - Intronic
978755917 4:112302673-112302695 GCCTTCTCAGCCCTCTGCTGCGG + Intronic
979976737 4:127206276-127206298 GCCTTCTCTGGGCTGATAAGGGG - Intergenic
980876155 4:138664402-138664424 TCATTCTCAGCCCTCATCTGAGG + Intergenic
983745370 4:171191880-171191902 GACTTCTCTGACCAAATCTGGGG - Intergenic
984312606 4:178082112-178082134 GCCTTGTCTGTCCTCAGCTGGGG + Intergenic
984530049 4:180904842-180904864 GCCTTTTTTGGCCTCACGTGCGG + Intergenic
985396005 4:189545130-189545152 GCCAACTCTGGCCCCAACTGTGG - Intergenic
985615252 5:916251-916273 GCCCTCGCTGGCCTCACCAGAGG + Intronic
986093265 5:4532184-4532206 GCCTGCTATGGCCTCCTCTTGGG - Intergenic
986293683 5:6420195-6420217 GCCTTTTCTGGCATCTTCAGAGG - Intergenic
987835561 5:23156504-23156526 ACCTTCTATTGCCTCATATGTGG + Intergenic
990273772 5:54173877-54173899 GCCCTCTCTTACCTCAACTGAGG + Intronic
990905080 5:60794930-60794952 GATTTGTCTGGCCTCATATGGGG + Intronic
994067964 5:95564659-95564681 GCATTTTCTGGCCTCATTTCAGG + Intronic
994210853 5:97085706-97085728 GCCCACTCTGGCCACATTTGAGG - Intergenic
996342556 5:122454617-122454639 CCCTTCTCTGTCCCCATCTTGGG + Intronic
996872613 5:128208422-128208444 GCCCTCTCTGCCATCATCTTAGG - Intergenic
998997078 5:147877541-147877563 GCTTTATTTGTCCTCATCTGAGG - Intronic
999089481 5:148922990-148923012 ACCTTCTCTGTTTTCATCTGAGG - Intergenic
999562395 5:152818809-152818831 GTCTTCTCCGTCCTCACCTGCGG - Intergenic
1001453349 5:171842851-171842873 GCTGTGTCTGGCCTCACCTGGGG + Intergenic
1002839372 6:892882-892904 GCCTTCTGTGCCCTCATGTTGGG + Intergenic
1003118595 6:3300488-3300510 GCCTTCTGTGTCCTCACATGAGG - Intronic
1003401289 6:5793266-5793288 GCCTTCTCCCGCCTCCTGTGGGG + Intergenic
1003877557 6:10451821-10451843 GACTTCTGTGGCCGCATGTGTGG - Intergenic
1003915855 6:10785699-10785721 GACTTTTCTGTCCTCATCAGAGG + Intronic
1006390232 6:33754135-33754157 GACTTCTATGTCCTCATCTGTGG - Intergenic
1006801278 6:36761164-36761186 CCATTCTCTGGCCTCCTTTGAGG - Intronic
1007447909 6:41921208-41921230 GCCTCCACTGACATCATCTGCGG + Exonic
1007838435 6:44696221-44696243 ACCTCCTCTGGCCTCTGCTGAGG - Intergenic
1009547040 6:65033506-65033528 GGCCTCTCTAGCTTCATCTGTGG + Intronic
1011197616 6:84798318-84798340 ACCTTCTGTGGACACATCTGTGG + Intergenic
1011974700 6:93282534-93282556 GCCTACTCTGGCCACACTTGAGG + Intronic
1012491154 6:99783760-99783782 GCTTTATCTGGCCTCCACTGAGG - Intergenic
1013108510 6:107046627-107046649 GCCTTCCCTGGTCTGCTCTGTGG + Intronic
1014061127 6:117073048-117073070 TCCTTCTCTGGGCTCCTCTTAGG + Intergenic
1017038495 6:150288513-150288535 GCTTTCTCTTGCCAGATCTGAGG + Intergenic
1018987062 6:168645808-168645830 GCCTTTGCTGGCCTGATGTGAGG - Intronic
1019221360 6:170475311-170475333 GCCTTCTGTGGCCAAATGTGTGG - Intergenic
1022093444 7:27123279-27123301 GCCTTAGCTGGCCTGCTCTGAGG - Intronic
1023819208 7:43971015-43971037 GCCTTCTCTGGGCTTCTCTGAGG - Intergenic
1025795609 7:64736871-64736893 CCCTACTCTGGCCCCAGCTGTGG + Intergenic
1028844924 7:95469297-95469319 GCCTTCAGTTTCCTCATCTGAGG - Intergenic
1029156919 7:98523828-98523850 ACCATCTCTTGCCCCATCTGTGG - Intergenic
1029652794 7:101905331-101905353 TGCCTCTCTGCCCTCATCTGTGG + Intronic
1029744259 7:102507978-102508000 GCCTTCTCTGGGCTTCTCTGAGG - Intronic
1029762250 7:102607140-102607162 GCCTTCTCTGGGCTTCTCTGAGG - Intronic
1030772281 7:113488599-113488621 GCCCACTCTGGCCTCACTTGAGG - Intergenic
1031857241 7:126937536-126937558 GTCTTTTGTGGCCACATCTGTGG - Intronic
1034421990 7:150995372-150995394 TCCCTCTCCGGCCCCATCTGAGG - Intronic
1035700095 8:1631788-1631810 GACTTCTCTGGTTTCACCTGAGG - Intronic
1036033754 8:4997245-4997267 TACTTCTCTGACCTCCTCTGCGG + Intergenic
1039839086 8:41280761-41280783 GCCTTCTGTGGTCTCCTCTAGGG - Intronic
1039889171 8:41672706-41672728 GCCTTCTCTGGTCACTGCTGAGG - Exonic
1041411832 8:57564822-57564844 GCTCCCTCTGGCCTCATCTGTGG + Intergenic
1041616108 8:59908036-59908058 GGCATCTCTGGACTCATCAGGGG + Intergenic
1045425002 8:102057107-102057129 TACTCCTCTGGCCTCATTTGTGG + Intronic
1047342710 8:123998664-123998686 GACATCTCTGGACCCATCTGGGG - Intronic
1048361052 8:133697389-133697411 GCCTTCCCTGACCCCATCTAGGG + Intergenic
1048416476 8:134232709-134232731 ACCTTCTCTCTCCTCCTCTGAGG + Intergenic
1048708667 8:137183565-137183587 GGCTGCTCTGGGCTCCTCTGTGG + Intergenic
1048964528 8:139605969-139605991 ATCTTCTCTGGCCTTCTCTGTGG - Intronic
1049285748 8:141774305-141774327 GGCTGCTGTGGTCTCATCTGAGG + Intergenic
1052968279 9:34359550-34359572 GCCTTCTCCAGCCTACTCTGTGG + Intergenic
1053171780 9:35892233-35892255 CACTTCTCTGGCCTAATCTCAGG - Intergenic
1054993858 9:71362117-71362139 GCCTTCAGGGGCCTTATCTGTGG - Intronic
1055377424 9:75664939-75664961 GCCTTGTGTGGCCTCGTCTGCGG + Intergenic
1055387337 9:75776346-75776368 GGCATCTCTGGACCCATCTGGGG + Intergenic
1056667538 9:88592961-88592983 GCCTTCTCAGCCCTGATCAGTGG + Intergenic
1057274372 9:93668528-93668550 GCCCTGTCTGCCCTCATCTTGGG - Intronic
1057502013 9:95603501-95603523 CCCTTCTCTGGCCTCCTAGGTGG - Intergenic
1057669435 9:97075949-97075971 GGCTGCTCTGGCCTCCTCTAAGG + Intergenic
1058053127 9:100426523-100426545 GCCTTCTCTGCCTTTCTCTGGGG + Intergenic
1058850410 9:109006647-109006669 GCCTTTTCTGCCCTCTTCTCTGG - Intronic
1059923108 9:119179661-119179683 GCCTTCAATGCCCTCATCGGTGG - Intronic
1061653029 9:132066379-132066401 GTCTCCTCCAGCCTCATCTGTGG - Intronic
1061775284 9:132958951-132958973 GCCCTCTCTGTCCTCACCAGAGG - Intronic
1203780327 EBV:96974-96996 GCCTTCTCCTGGGTCATCTGCGG - Intergenic
1203662321 Un_KI270753v1:57234-57256 GCCCACTCTGGCCGCATTTGAGG + Intergenic
1186293118 X:8121475-8121497 GCCCACTCTGGCCGCACCTGAGG + Intergenic
1186644402 X:11491024-11491046 GCCTATTCTTGCCTCTTCTGAGG + Intronic
1189491156 X:41472706-41472728 GCCTGCCCTGGCCTCTACTGCGG - Intronic
1190362424 X:49661978-49662000 GCCTTCTGTGGGCCCAGCTGGGG + Intergenic
1192380874 X:70614550-70614572 AGCTTCTCTGGACTCACCTGGGG + Intronic
1193877789 X:86883653-86883675 GTCATCTCTGGACTCACCTGGGG - Intergenic
1194355538 X:92879200-92879222 ATCTTCTCTGGCCTTTTCTGAGG - Intergenic
1195286378 X:103388690-103388712 GCCTTCACAGGTCTCTTCTGAGG - Intergenic
1199685085 X:150258421-150258443 GCTTGCTCTGCCCTCCTCTGGGG + Intergenic
1200663889 Y:5996194-5996216 ATCTTCTCTGGCCTTTTCTGAGG - Intergenic