ID: 1184015661

View in Genome Browser
Species Human (GRCh38)
Location 22:41784076-41784098
Sequence CTCCATCAGACAGCCTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184015661_1184015672 30 Left 1184015661 22:41784076-41784098 CCAGAGAAGGCTGTCTGATGGAG No data
Right 1184015672 22:41784129-41784151 GAAAAAGAGTTCTCCAGGTTCGG 0: 1
1: 0
2: 1
3: 23
4: 248
1184015661_1184015671 25 Left 1184015661 22:41784076-41784098 CCAGAGAAGGCTGTCTGATGGAG No data
Right 1184015671 22:41784124-41784146 TGGAAGAAAAAGAGTTCTCCAGG 0: 1
1: 0
2: 3
3: 76
4: 716
1184015661_1184015667 -4 Left 1184015661 22:41784076-41784098 CCAGAGAAGGCTGTCTGATGGAG No data
Right 1184015667 22:41784095-41784117 GGAGGAGGCCAGTGAGGATGGGG 0: 1
1: 4
2: 10
3: 120
4: 1064
1184015661_1184015665 -6 Left 1184015661 22:41784076-41784098 CCAGAGAAGGCTGTCTGATGGAG No data
Right 1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG No data
1184015661_1184015666 -5 Left 1184015661 22:41784076-41784098 CCAGAGAAGGCTGTCTGATGGAG No data
Right 1184015666 22:41784094-41784116 TGGAGGAGGCCAGTGAGGATGGG No data
1184015661_1184015664 -10 Left 1184015661 22:41784076-41784098 CCAGAGAAGGCTGTCTGATGGAG No data
Right 1184015664 22:41784089-41784111 TCTGATGGAGGAGGCCAGTGAGG 0: 1
1: 0
2: 3
3: 46
4: 322
1184015661_1184015668 -3 Left 1184015661 22:41784076-41784098 CCAGAGAAGGCTGTCTGATGGAG No data
Right 1184015668 22:41784096-41784118 GAGGAGGCCAGTGAGGATGGGGG No data
1184015661_1184015670 5 Left 1184015661 22:41784076-41784098 CCAGAGAAGGCTGTCTGATGGAG No data
Right 1184015670 22:41784104-41784126 CAGTGAGGATGGGGGAGATTTGG 0: 1
1: 0
2: 1
3: 47
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184015661 Original CRISPR CTCCATCAGACAGCCTTCTC TGG (reversed) Intronic
No off target data available for this crispr