ID: 1184015665

View in Genome Browser
Species Human (GRCh38)
Location 22:41784093-41784115
Sequence ATGGAGGAGGCCAGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184015661_1184015665 -6 Left 1184015661 22:41784076-41784098 CCAGAGAAGGCTGTCTGATGGAG No data
Right 1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG No data
1184015659_1184015665 6 Left 1184015659 22:41784064-41784086 CCACAGATGAGGCCAGAGAAGGC 0: 1
1: 0
2: 0
3: 25
4: 303
Right 1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG No data
1184015656_1184015665 18 Left 1184015656 22:41784052-41784074 CCAGAGACTGAACCACAGATGAG 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184015665 Original CRISPR ATGGAGGAGGCCAGTGAGGA TGG Intronic
No off target data available for this crispr