ID: 1184017027

View in Genome Browser
Species Human (GRCh38)
Location 22:41794029-41794051
Sequence TTCTTTTAGCAGCACTGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 168}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184017023_1184017027 13 Left 1184017023 22:41793993-41794015 CCATTCCCTTGTGTGACTCATAC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1184017027 22:41794029-41794051 TTCTTTTAGCAGCACTGCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 168
1184017025_1184017027 7 Left 1184017025 22:41793999-41794021 CCTTGTGTGACTCATACTTGTTT 0: 1
1: 0
2: 1
3: 21
4: 218
Right 1184017027 22:41794029-41794051 TTCTTTTAGCAGCACTGCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 168
1184017021_1184017027 21 Left 1184017021 22:41793985-41794007 CCAGCCTTCCATTCCCTTGTGTG 0: 1
1: 0
2: 2
3: 26
4: 323
Right 1184017027 22:41794029-41794051 TTCTTTTAGCAGCACTGCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 168
1184017020_1184017027 27 Left 1184017020 22:41793979-41794001 CCTGCTCCAGCCTTCCATTCCCT 0: 1
1: 0
2: 6
3: 71
4: 634
Right 1184017027 22:41794029-41794051 TTCTTTTAGCAGCACTGCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 168
1184017019_1184017027 30 Left 1184017019 22:41793976-41793998 CCTCCTGCTCCAGCCTTCCATTC 0: 1
1: 0
2: 3
3: 84
4: 1127
Right 1184017027 22:41794029-41794051 TTCTTTTAGCAGCACTGCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 168
1184017024_1184017027 8 Left 1184017024 22:41793998-41794020 CCCTTGTGTGACTCATACTTGTT 0: 1
1: 0
2: 0
3: 9
4: 198
Right 1184017027 22:41794029-41794051 TTCTTTTAGCAGCACTGCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 168
1184017022_1184017027 17 Left 1184017022 22:41793989-41794011 CCTTCCATTCCCTTGTGTGACTC 0: 1
1: 0
2: 2
3: 16
4: 229
Right 1184017027 22:41794029-41794051 TTCTTTTAGCAGCACTGCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184017027 Original CRISPR TTCTTTTAGCAGCACTGCAA GGG Intronic
902162201 1:14540099-14540121 TTCACTTAGCAGCACTTCCAGGG - Intergenic
907831821 1:58071428-58071450 TTCTCTTAGCAGCCCAGCAGCGG - Intronic
908384157 1:63625005-63625027 TTCTTTGAGGAGAGCTGCAAAGG + Intronic
910620770 1:89251288-89251310 TTCTTATAGCAGCACATCAATGG - Intergenic
911723039 1:101211930-101211952 TAGTTTTAGCAGCAGTGCATTGG + Intergenic
913236781 1:116791931-116791953 TCCCTTTATCAGCTCTGCAAGGG - Intergenic
914955007 1:152154226-152154248 TTCTTTGAGCAGCAATTCTAGGG - Exonic
921453756 1:215341692-215341714 TTCTATTAGCAACACTGGGAAGG - Intergenic
923941257 1:238830096-238830118 TTTTGTGAGCAGCACAGCAAAGG + Intergenic
1063799814 10:9562048-9562070 TTTTTTTAGCAGCACTATTAAGG - Intergenic
1064270636 10:13862695-13862717 TTCTTTTGACAGCACTGCTGTGG + Intronic
1064287497 10:14004690-14004712 ATCCTTTACAAGCACTGCAAAGG + Intronic
1064585526 10:16836298-16836320 TTCTTCTATGAGTACTGCAATGG - Exonic
1064659683 10:17593616-17593638 CACTATTAGCAGCACTGAAATGG + Intronic
1065104469 10:22368486-22368508 TTCTTGTAGAAGCGCTACAAGGG - Exonic
1066600768 10:37104254-37104276 TCCTGTGAGCACCACTGCAAAGG + Intergenic
1066601432 10:37111980-37112002 TCCTGTGAGCACCACTGCAAAGG - Intergenic
1066998244 10:42583058-42583080 CTCTTCTTCCAGCACTGCAAGGG + Intronic
1069345064 10:67458962-67458984 TTCTTTTAGCACCATTGCTAGGG - Intronic
1070698549 10:78581664-78581686 TTCTTTTTGCATCCCTGCACAGG - Intergenic
1073964792 10:108977115-108977137 TTTTTAGAGAAGCACTGCAATGG + Intergenic
1078443041 11:11383289-11383311 TTCTTATAGAAGCAGTGGAAGGG - Intronic
1080122836 11:28697051-28697073 TTCTTTTAGTAGCACTTTACTGG + Intergenic
1081285973 11:41270619-41270641 TTCTATAAGCCCCACTGCAATGG - Intronic
1082610403 11:55289750-55289772 TAGTTTTACCAGCATTGCAAGGG + Intergenic
1086024240 11:82270751-82270773 TCCATTTTGCATCACTGCAAAGG - Intergenic
1086805639 11:91239005-91239027 TTCTTTAAGCATCATTACAAAGG - Intergenic
1087507866 11:99050098-99050120 TTCTACTAGCTGTACTGCAATGG - Intronic
1087881661 11:103423016-103423038 TTCTTTTTGCAAAAATGCAAAGG + Intronic
1089671647 11:120061396-120061418 TTCTTTTAGCAGAAATGGCAGGG - Intergenic
1090242284 11:125192652-125192674 TTCTTTCAGCAGCCCTGGAAGGG + Intronic
1090628826 11:128628422-128628444 TTCTCTTATCAGCACAGCACGGG + Intergenic
1092517396 12:9229363-9229385 ATACTTTACCAGCACTGCAAGGG + Intergenic
1092756522 12:11768595-11768617 TTCTTTTTGCAGCCCTGGTACGG - Intronic
1093430422 12:19079036-19079058 TTCTTATAGCAACTCTGTAAAGG + Intergenic
1094064804 12:26351060-26351082 TAACTTTAGCAGCACTGCTAGGG + Intronic
1096305922 12:50475504-50475526 TTTTTTTATCATCACTTCAAAGG + Exonic
1099661990 12:85575742-85575764 TGCTTTGAGCAGCCCTGCATAGG - Intergenic
1101084457 12:101221581-101221603 TCCTTTTAGCAGAACTGCCAAGG + Intergenic
1102803039 12:115753382-115753404 TTCTTTTGGCAGCCTTGAAATGG - Intergenic
1106076939 13:26468440-26468462 TTATTTTTGCAGCAATCCAAGGG - Intergenic
1106491447 13:30227318-30227340 TTCTTTAAGCAGAATGGCAATGG + Intronic
1107403740 13:40094009-40094031 TACTTTTAGCAGCTCTATAAGGG + Intergenic
1114802116 14:25788344-25788366 TATTGTTAGCAGCACTGAAAAGG - Intergenic
1115608067 14:35025281-35025303 TTCTTTTAGAAGCTATTCAATGG - Intronic
1116381400 14:44273488-44273510 CTATTTTAGCAGCATTGTAATGG - Intergenic
1116460189 14:45163748-45163770 TACTTTTAGCACCACAGAAAGGG - Intronic
1118542735 14:66847165-66847187 TTATTTTAACAGCACAGCTATGG + Intronic
1118716254 14:68562222-68562244 TTCTTTCAGTATCACTGGAAGGG - Intronic
1119084491 14:71727553-71727575 TCCTTATAGCACCACTGCTACGG - Intronic
1119186799 14:72648907-72648929 TTCTTTTAGCACAACTGGAAAGG + Intronic
1121267830 14:92615781-92615803 TTCTTCTAGAACCCCTGCAATGG - Intronic
1122629569 14:103101371-103101393 TTCTTGCAGCATCTCTGCAATGG + Intronic
1125254089 15:37743053-37743075 TTCTTTTAGCAAACCTGAAATGG + Intergenic
1125588227 15:40837279-40837301 TTCTTTTAACAGCTCTTAAAGGG - Intergenic
1125907860 15:43409908-43409930 TTCTTTTGGCAGCATTTTAAAGG - Intronic
1126385090 15:48086074-48086096 TTTTTATAGCCACACTGCAATGG + Intergenic
1128606720 15:69042036-69042058 TTCTTTTAGCAGTCCTGTGAAGG - Intronic
1129870290 15:78935920-78935942 GTATTTTGGCAGCACTGTAAGGG - Intronic
1130712576 15:86298409-86298431 TTCTTTTAGAAACACAGCAACGG - Intronic
1132330214 15:101007531-101007553 TTTGTTTAGCAGGACTTCAACGG + Intronic
1133512054 16:6469128-6469150 TTCTTTTGACAGAACTCCAATGG - Intronic
1137905704 16:52319905-52319927 TTATTTTATCAGCAGGGCAAAGG - Intergenic
1140777628 16:78264583-78264605 TTCCTCTTGCAGCACTGCAGAGG + Intronic
1147043992 17:37739611-37739633 TCATTTTAGCAGCCCTCCAAGGG + Exonic
1148983796 17:51602696-51602718 TTCTTCTAGCACCACTGGTAAGG + Intergenic
1150628358 17:66858355-66858377 TCCTTATAGCAGCTCTGCAGAGG + Intronic
1151042683 17:70882145-70882167 TTCTTTTATCCCCACTTCAAGGG + Intergenic
1152681336 17:81669897-81669919 TTCTTTCGGCAGCTGTGCAATGG + Intronic
1157933739 18:51851739-51851761 TACTTTTATAAGCACTCCAAGGG + Intergenic
1158641955 18:59211537-59211559 TTGTTTAAGCAGCACTCCAGGGG + Intergenic
1159395791 18:67854135-67854157 TTCTTTTTGCAGAAATGAAAAGG - Intergenic
1161154289 19:2724120-2724142 TCCTTTCAGCAGAACAGCAAGGG + Intronic
1162122215 19:8478080-8478102 TTGATTTAGCTGCACTGCAGGGG + Intronic
1164738576 19:30560172-30560194 TTCATTTTACAGCTCTGCAAGGG + Intronic
1164885118 19:31772042-31772064 TCCTTTGAGCATCACTGCAATGG - Intergenic
1165913331 19:39243394-39243416 TTGTTATGGCAGCAATGCAAAGG + Intergenic
1168321774 19:55514821-55514843 TCCTTTTGACAGCTCTGCAAGGG + Intronic
926948837 2:18219247-18219269 CTCTTTAAGCAGCACAGGAATGG - Intronic
928193766 2:29197652-29197674 TTCCCATAGCAGCACTCCAAAGG + Exonic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
931660195 2:64553769-64553791 TTCTTTTAAAATCACTGTAAAGG - Intronic
932982362 2:76685137-76685159 TTTTTTTAGCAGAATTGTAAAGG - Intergenic
934500311 2:94856010-94856032 TTCTTATACCAGAAATGCAAAGG + Intergenic
936023977 2:109017120-109017142 TTCTCTTAGCAGCACAGAGAGGG + Intergenic
939560170 2:143722570-143722592 TTACATTAGTAGCACTGCAAAGG - Intronic
939693957 2:145300681-145300703 TTCTTCTAGCTTCACTGGAAGGG + Intergenic
940249671 2:151661102-151661124 TTCTTTTCTCAACTCTGCAATGG + Intronic
941286159 2:163615191-163615213 TGCCTTTTGCAGCTCTGCAAAGG - Intronic
941432977 2:165434208-165434230 TAGTTTTAGCAGCACAGCATTGG + Intergenic
942146676 2:173034089-173034111 TTGTTTTAGCAGCACTAAAAGGG - Intronic
942605937 2:177691080-177691102 TTCCTGTATCAGCACTGAAATGG - Intronic
945016356 2:205521612-205521634 TTATTTTTTCAGAACTGCAAGGG - Intronic
946494216 2:220179145-220179167 TTCTTTCATCAGCACTCAAAAGG - Intergenic
1170362800 20:15565852-15565874 TTCTTTTAGTAGTGCTGTAAGGG + Intronic
1172968310 20:38855099-38855121 TTCTTTTAGAGACTCTGCAAGGG - Intronic
1173849185 20:46207238-46207260 TGCTTTTATCTGCACTGAAAGGG - Intronic
1175033113 20:55974591-55974613 TGCTTTTCCCAGCACTGCACTGG - Intergenic
1176920257 21:14679648-14679670 TTCTTATAGCAGCACAAGAAGGG - Intergenic
1178410694 21:32361484-32361506 TCCTTTCGGCAGCCCTGCAAGGG - Intronic
1178674817 21:34622152-34622174 TTGTTGAAGCAACACTGCAAAGG + Intergenic
1179550485 21:42140619-42140641 GTATTTTAGCAGCTGTGCAAGGG + Intronic
1179611393 21:42554050-42554072 TTTTTTTACCAGCACTCAAAAGG + Exonic
1181995219 22:26873451-26873473 TTCTTTTGTTAGCATTGCAAAGG + Intergenic
1182313689 22:29427618-29427640 TACTTTTAGCAGCAGGGCATTGG - Intergenic
1183656005 22:39185067-39185089 TTCCTTTAGCAGGAATGCTAAGG + Intergenic
1184017027 22:41794029-41794051 TTCTTTTAGCAGCACTGCAAGGG + Intronic
950305727 3:11914404-11914426 ATCTTGTAGTAGCACTGGAAAGG + Intergenic
951460000 3:22941142-22941164 TTCTCTTAGCATCACTGCTGTGG - Intergenic
951617138 3:24559891-24559913 TTCTTTAAGCAGCATTGAAAGGG - Intergenic
951855772 3:27195298-27195320 TTCTTAAAGCAACAATGCAAGGG - Intronic
951924276 3:27889967-27889989 TTCTTTGAGCAGCCATTCAAAGG + Intergenic
952205158 3:31173886-31173908 TTCCTTAAGAAGCACTGAAATGG + Intergenic
955359268 3:58258938-58258960 TCCTGCTACCAGCACTGCAAGGG - Intronic
958955976 3:100466433-100466455 TTCTTTTTTCAGGACTGTAATGG + Intergenic
962636529 3:137337640-137337662 TTCTTATAGCAGCATGGGAATGG + Intergenic
962715031 3:138118500-138118522 TTCTTACACCAGCCCTGCAAAGG - Intergenic
963324259 3:143843766-143843788 TTCTTTTATGAGCACTGAACAGG + Intronic
963672948 3:148274964-148274986 TTATTTTAGCAGCCCTCCAATGG + Intergenic
964782303 3:160353686-160353708 TTTTTATACAAGCACTGCAAGGG - Intronic
965017425 3:163175118-163175140 TTATTTTTGCTGCACTGCAGTGG - Intergenic
965496885 3:169409707-169409729 TGACTTTAGCAGCACTTCAAAGG + Intronic
965666253 3:171096641-171096663 TTCTTTAAGCCTCACTGGAATGG + Intronic
966624783 3:182004222-182004244 TCCTTGCAGGAGCACTGCAAGGG + Intergenic
969451179 4:7274329-7274351 TCCTTATAGCAGCACAGGAAAGG - Intronic
970266059 4:14287492-14287514 TTCTGTTAGAAGCACTGATATGG - Intergenic
971756422 4:30714386-30714408 TTATTTTAAAAGCACTGAAATGG + Intergenic
973548085 4:52002417-52002439 GTCTTTTAGCAACACTGGAGTGG - Intronic
975354112 4:73380165-73380187 TTCTTCTAACAGCACTGGAAGGG - Intergenic
975388884 4:73793012-73793034 TTCTTTTAGGAGCTCTTCTAAGG + Intergenic
976128985 4:81864204-81864226 GGCTTTTAGCACCAATGCAAAGG - Intronic
979723963 4:123938010-123938032 ATATTTGAGCAGCACTGTAAGGG + Intergenic
979902818 4:126245030-126245052 TACTTTTTGCAGCATTGTAAAGG - Intergenic
982100596 4:151963783-151963805 TTCTTTTAGAAACAGTGGAAGGG + Intergenic
984412677 4:179414722-179414744 TTCTTTAAGAAGCACTTCAGAGG + Intergenic
985191109 4:187373770-187373792 TTCCTTGAGCAGCACAGAAAAGG - Intergenic
985215523 4:187649544-187649566 TCATTTCAGCAGCACTGGAATGG - Intergenic
991497785 5:67244522-67244544 TTCTTTTATCTGCACAGGAAGGG - Intergenic
993553931 5:89312053-89312075 TTCTATTTCAAGCACTGCAAAGG - Intergenic
994994381 5:107041256-107041278 TTCTATTAGGATCTCTGCAATGG + Intergenic
999158781 5:149477763-149477785 ATGTTTTAGCAGCACTAAAATGG - Intergenic
999249866 5:150176192-150176214 TACTTGTAGGAGCGCTGCAAGGG - Intronic
1000675518 5:164117889-164117911 TTATTTCAGCAGAACTGTAATGG - Intergenic
1003179619 6:3780590-3780612 TTCTTATACCAGCACTGGACTGG + Intergenic
1003782058 6:9440309-9440331 TTATTTTGGCAGTATTGCAATGG + Intergenic
1003866572 6:10368755-10368777 TTCATTCTGCAGCACTGCCAAGG + Intergenic
1004302445 6:14470628-14470650 CACTTTTGGCAGCAATGCAAAGG - Intergenic
1004329049 6:14704759-14704781 TTCTTTATGCAACACTGCCATGG - Intergenic
1005829777 6:29661262-29661284 TTCTGGTCCCAGCACTGCAATGG - Intronic
1010258068 6:73783108-73783130 TTCAGTTAGCAGCACTGCCAGGG - Intronic
1010448475 6:75975885-75975907 TTCATTTATGAGCACTGAAATGG + Intronic
1014166283 6:118228729-118228751 CTCTTTTACCAGAACTCCAAAGG - Intronic
1016606352 6:145933165-145933187 TTCTTTTAGCACCATGACAATGG - Exonic
1018623485 6:165754050-165754072 CTCTTTGAGCAGTACTGCATTGG - Intronic
1019036833 6:169067899-169067921 TTCTTTTAGAAGCTCTGTATCGG - Intergenic
1021508537 7:21410880-21410902 TTCCTCTAGGAGCACTGCACTGG - Intergenic
1023540780 7:41263386-41263408 TTTTTTTATCAGCACATCAATGG - Intergenic
1023617090 7:42030523-42030545 TTCTTTCTGCAGCACTTCAATGG + Intronic
1023811453 7:43915456-43915478 TTCTGTTTGCAGGACTGTAATGG + Intronic
1026347505 7:69487251-69487273 TTATTGTACCAGCTCTGCAAAGG - Intergenic
1031457733 7:122004219-122004241 TGCTTTTATCAGCCCTGCTAAGG + Intronic
1033827272 7:145206954-145206976 GTCTTTTAGCAGCTTTTCAATGG - Intergenic
1033915197 7:146315325-146315347 AACTTTTACCATCACTGCAAGGG - Intronic
1034664190 7:152801952-152801974 TTGTTTTAGCAGCTCAGCGATGG + Intronic
1040124939 8:43726534-43726556 TTCTTTTTGGAGATCTGCAAAGG + Intergenic
1041514684 8:58687991-58688013 TTATTTTAGCAGTACTGCCCAGG + Intergenic
1041971589 8:63749218-63749240 TTCCTATAGCAGCACTGGATGGG - Intergenic
1045375447 8:101569022-101569044 TTCTTTGACCAGCATTTCAAGGG - Intronic
1046563311 8:115867041-115867063 TTATTTTGCCAGCACTGCAAAGG - Intergenic
1049133655 8:140873231-140873253 GTCTTTTACCTGCACTGCTAGGG - Intronic
1055748222 9:79474370-79474392 TTCCTTTTTCAGTACTGCAAGGG + Intergenic
1055758364 9:79579768-79579790 ATATTTTAGCAGCACTCAAATGG - Intronic
1056507848 9:87274388-87274410 TTCTATTATCAGCACTGCTTTGG + Intergenic
1057157061 9:92852017-92852039 TTCTTTTAGGAGCAATTCAAAGG - Intronic
1061800088 9:133108978-133109000 TTCTTTTAGCTGGACAGCCAAGG - Intronic
1187590825 X:20715279-20715301 TTCTGTTAGCAGAACTGGACGGG - Intergenic
1188349131 X:29105393-29105415 TTATTTTGGCAGCATTGCTATGG + Intronic
1189187139 X:39064228-39064250 TTCTGCTAGCAGCACAGGAATGG + Intergenic
1193463027 X:81812135-81812157 ACCTTGTAGCAGCACAGCAAAGG + Intergenic
1194086253 X:89532347-89532369 TTGATTCAGCATCACTGCAATGG - Intergenic
1196919916 X:120575066-120575088 TTCTTTAAGCTGCAGTGCTATGG + Intronic
1198480067 X:137033097-137033119 TTAGTTTATCAGCAGTGCAATGG + Intergenic
1199243200 X:145572684-145572706 TTTTTCTAGCTGCATTGCAATGG + Intergenic
1200438913 Y:3188224-3188246 TTGATTCAGCATCACTGCAATGG - Intergenic