ID: 1184025595

View in Genome Browser
Species Human (GRCh38)
Location 22:41853618-41853640
Sequence CAAAGCTTTCACTTTTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184025595_1184025598 11 Left 1184025595 22:41853618-41853640 CCTCCCTAAAAGTGAAAGCTTTG 0: 1
1: 0
2: 1
3: 19
4: 183
Right 1184025598 22:41853652-41853674 TAGATCTGTCCAGATTTTCCAGG 0: 1
1: 0
2: 2
3: 9
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184025595 Original CRISPR CAAAGCTTTCACTTTTAGGG AGG (reversed) Intronic
902947234 1:19850535-19850557 TCAAGTTTTCCCTTTTAGGGAGG + Intergenic
904106449 1:28088847-28088869 TACAGCCTTCACTTTTAAGGAGG + Intergenic
905360315 1:37414747-37414769 CCAAACTTTCACTTTCAGAGAGG - Intergenic
907720230 1:56965062-56965084 CAAACCTTTCACTTTATGTGAGG - Intronic
909389285 1:75100056-75100078 CAAAGCGTACTCTTTTAGGGAGG - Intergenic
912237279 1:107865789-107865811 CCAAGTTATCACTTTTAGAGAGG - Intronic
912653298 1:111461103-111461125 CAAACTTTTCATTTTTAGGAAGG - Exonic
913387403 1:118273706-118273728 CAAAGCTTTCCCTCTTATTGAGG - Intergenic
915446290 1:155976660-155976682 CATGGCTTTCCTTTTTAGGGTGG + Intronic
916624870 1:166544486-166544508 CTTAGCTTTCACTTGTAGGATGG + Intergenic
917576136 1:176323629-176323651 CAGAGCATTCAGTTTGAGGGTGG - Intergenic
921622216 1:217337957-217337979 GAAAGCTTACACTTTAAGGAGGG - Intergenic
924264253 1:242265638-242265660 CACAGATTGCACTTTTTGGGGGG + Intronic
924465878 1:244298909-244298931 AAAAGCTTGCAGTTTTAGGCTGG + Intergenic
1066069075 10:31786691-31786713 TAAACTTTTAACTTTTAGGGTGG - Intergenic
1066720551 10:38332832-38332854 CACAGATTGCACTTTTTGGGGGG - Intergenic
1070707793 10:78653979-78654001 CACAGCTTTCACTTGTCTGGAGG + Intergenic
1071729451 10:88233245-88233267 AAAAGCTTTCTCTTTTAAGATGG - Intergenic
1074171953 10:110949449-110949471 CAAAGCTTTTCTTTTTTGGGAGG - Intronic
1074560608 10:114532288-114532310 CCAAACTTTCCCTTTTTGGGAGG + Intronic
1076010873 10:126986927-126986949 CAAAGGTTAAACTTTTGGGGCGG + Intronic
1076633298 10:131865979-131866001 AAAAGCTTGCAATTTTCGGGGGG + Intergenic
1078635146 11:13042764-13042786 AAAAGTTTTCATTTTTAGGAGGG - Intergenic
1079417904 11:20257176-20257198 CTAAGCTTTAACTTGTAGAGAGG - Intergenic
1079834173 11:25310652-25310674 CAATGTTTTCACTTCTAGGTAGG + Intergenic
1080526614 11:33128222-33128244 CAGAGTTTTCACTTTTTGAGAGG - Intronic
1080751990 11:35159135-35159157 CCAAGCTTGCGCTTCTAGGGAGG - Intronic
1081241692 11:40714298-40714320 TAAGCCTTTAACTTTTAGGGTGG + Intronic
1082640532 11:55654575-55654597 AATTGCTTTCACTTTCAGGGTGG + Intergenic
1084111522 11:67017216-67017238 CAACTCTTTCACTTTTAGAGAGG - Intronic
1085947362 11:81287455-81287477 TAAAGGATTCACTTTTGGGGTGG + Intergenic
1086163511 11:83750016-83750038 GTTACCTTTCACTTTTAGGGAGG + Intronic
1087268757 11:96089613-96089635 GAAAGCATTCACATTTAGGAGGG - Intronic
1091008330 11:131974841-131974863 CAAAACTTTCAAATTTAGAGGGG + Intronic
1091573972 12:1715160-1715182 CAAAGCTTGCAATATTGGGGAGG - Intronic
1092616979 12:10224890-10224912 CAAAGCTTCCACCTTTTGGAAGG + Intergenic
1092746801 12:11680240-11680262 AAAAGCTTACACTTGTTGGGGGG + Intronic
1093611835 12:21170187-21170209 CAATATTTTGACTTTTAGGGAGG - Intronic
1095034430 12:37342274-37342296 CAACGCTTTCAATCTTATGGTGG - Intergenic
1097769182 12:63561135-63561157 CAATGCTTTCCCATTTTGGGTGG + Intronic
1099380290 12:81944667-81944689 TAAAGCTTTCATTTTCTGGGAGG + Intergenic
1099515952 12:83596967-83596989 CAAATCTTTCAGTCTTAGGAAGG - Intergenic
1099916719 12:88903946-88903968 AAAAGCTTTCACTTTCTGGCTGG - Intergenic
1102685273 12:114719651-114719673 CAAAGCTCTGACATATAGGGAGG + Intergenic
1104550505 12:129752627-129752649 CAAAGCTATGCCATTTAGGGAGG + Intronic
1106629116 13:31452149-31452171 CAAAGATTTAACTTGTAGGTTGG - Intergenic
1108789109 13:53944958-53944980 CAAGCCTTTCACGTTTAGGCAGG + Intergenic
1111907093 13:94267703-94267725 CAAAGCAGTCACCTTTAGAGTGG - Intronic
1112171029 13:96971813-96971835 CTAAGTTATCACTTTTAGAGAGG + Intergenic
1115916670 14:38322477-38322499 CATAGCTTCTACTTTTGGGGAGG + Intergenic
1117390657 14:55259209-55259231 CAAAGCTATGGCCTTTAGGGAGG + Intergenic
1118493706 14:66287090-66287112 AAAAGCTTTGAGTTTTAGAGAGG - Intergenic
1122359835 14:101152680-101152702 CAAAGCTTTTTCTTTTAAGCTGG + Intergenic
1122596095 14:102893569-102893591 CAAACCATTCACTTTCAGTGGGG - Intronic
1123905213 15:24914213-24914235 CAATGCTTCCAGTTTTAGGGTGG + Intronic
1124094670 15:26637989-26638011 CAATGCTTTCACTCTTAGCCGGG + Intronic
1127828024 15:62722947-62722969 CAAAGTTTTCACTTATTGCGTGG + Intronic
1133496358 16:6321838-6321860 CAAAGCTTTCACTTCTACGTTGG + Intronic
1135121354 16:19769129-19769151 CAAATCTTTCACTCTGAAGGAGG - Intronic
1139162622 16:64529530-64529552 CAATGCTATCCCTTTTAGAGAGG - Intergenic
1140529746 16:75654586-75654608 CAAAGCTTTTAGTTTTTGGCAGG + Intronic
1143261602 17:5603318-5603340 CCAAGCTCTCAGTTTTATGGGGG - Intronic
1146018854 17:29257446-29257468 CAAAGCTTTCACATTTACACTGG + Exonic
1146253924 17:31377833-31377855 AAAATATTTCACTTTTAGTGTGG - Intronic
1149095665 17:52837623-52837645 CACAGCTTTTACTTTTGGAGAGG - Intergenic
1149149522 17:53543649-53543671 CAAGGCTTTCGCTATTTGGGAGG - Intergenic
1150992043 17:70270839-70270861 TAAATCGTTCACTTTTTGGGAGG - Intergenic
1156040650 18:32817222-32817244 CAAAGTTTTCAATTTAATGGAGG - Intergenic
1156127494 18:33924520-33924542 CAAAAAGTTTACTTTTAGGGAGG - Intronic
1156219735 18:35039232-35039254 CAAAACTTCCCCTTTTTGGGGGG - Intronic
1156838118 18:41579736-41579758 CCAAGTTTTCACTTTTGGGGAGG + Intergenic
1157603641 18:48911793-48911815 CAAAACTTTACCTCTTAGGGTGG - Intergenic
1157977906 18:52346685-52346707 CACAGCTTTCATTTCTTGGGGGG + Intronic
1158549869 18:58426681-58426703 CAAAGTTTTCACTGTTGTGGGGG - Intergenic
1159163631 18:64675268-64675290 CAAAGCTTAGAATTTTAAGGAGG + Intergenic
1159425402 18:68278403-68278425 CAAACTTTTCATTTTTAGGAAGG - Intergenic
1159658326 18:71059766-71059788 CAAGGCATTCAGTTTTTGGGGGG + Intergenic
1159698640 18:71594018-71594040 CAAATGGTTGACTTTTAGGGAGG + Intergenic
1159975464 18:74706272-74706294 CAAAGCTTTCACTTTTGTTTTGG + Intronic
926202903 2:10814019-10814041 GAAAGATTTTACTTTTAGGTCGG - Intronic
930332260 2:50000155-50000177 TATAGCTTGCACTTTTAGTGAGG - Intronic
930966014 2:57327597-57327619 AAATCCTTCCACTTTTAGGGTGG - Intergenic
931870108 2:66447035-66447057 TTAAGCTTTCTCTTTAAGGGAGG + Intronic
934487497 2:94729706-94729728 CAATTCTTTCACTGTTGGGGTGG + Intergenic
934656404 2:96118665-96118687 CAAAGTTGTCACTTCTAGGAAGG - Intergenic
935816231 2:106848539-106848561 CAAAGCTTTGACCTGTTGGGAGG + Intronic
936175594 2:110217612-110217634 CAAAGCTATACCTTTTATGGGGG - Intergenic
937877585 2:126837091-126837113 CAAAGCTGCCATTTTCAGGGAGG - Intergenic
938111090 2:128565518-128565540 CAAAGCTTTCACCTGTTGGAAGG - Intergenic
939695161 2:145314374-145314396 CACAGCTTCCAGTTTTAGGGTGG - Intergenic
939897061 2:147805120-147805142 CAAATTTTTCATTTTTAGTGAGG + Intergenic
941021625 2:160412942-160412964 CAAAGCTTACTCTTTTATGTGGG - Intronic
941045769 2:160674128-160674150 TAAAGCATTAACTTTTTGGGTGG - Intergenic
948572346 2:238925523-238925545 CAAAGCCTTCCCTTTGAGCGCGG + Intergenic
1173713375 20:45179782-45179804 CAAAGCTTTAAGTTTTACAGTGG + Intergenic
1173733685 20:45345374-45345396 CAAACCTTTCATTTTAAGGTGGG + Intronic
1174229177 20:49030199-49030221 TAAAAATTTCACTTTTAGGCCGG - Intronic
1177954026 21:27574630-27574652 CAATGCTATCAATTTTAGGAAGG + Intergenic
1180018558 21:45104040-45104062 CAAGGGGTTCACTTTTGGGGAGG + Intronic
1184025595 22:41853618-41853640 CAAAGCTTTCACTTTTAGGGAGG - Intronic
951968883 3:28420682-28420704 ATAAGCTTTCACTTTTTGGTAGG + Intronic
954905542 3:54059427-54059449 CAAAGCTGACTCTATTAGGGAGG + Intergenic
954940627 3:54369059-54369081 TTAAGCTTTCACTATTTGGGGGG - Intronic
954997672 3:54896412-54896434 CAAAGCTTTCTTGTTTAGAGGGG + Intronic
956053857 3:65277796-65277818 CTAAGCTTTCTCTTTTGGGGAGG - Intergenic
956468011 3:69537686-69537708 CTTAGCTGTCACTTTTAGCGTGG - Intronic
957807923 3:85175277-85175299 CCTAGCTTTCACTTTTCGGGGGG - Intronic
958103348 3:89042590-89042612 GGAAGCTTCCACTTTTAGGCAGG - Intergenic
959979194 3:112496115-112496137 CAAGGATTCCACTTTTAGGCAGG - Intronic
961032043 3:123614798-123614820 CACACCTTTCACTTTTTGGGGGG + Intronic
961134608 3:124498152-124498174 CAACGCTTTGACTTTCAGAGTGG - Intronic
961351250 3:126305763-126305785 CAAATCTTTCACCTTTAAGATGG - Intergenic
962143555 3:132816770-132816792 CAAAGCTTGCACTTTTAATGAGG + Intergenic
962427097 3:135280543-135280565 CATAGCTTCCACTTTTTGGTAGG + Intergenic
963691895 3:148514597-148514619 CAAAGCTGTCTCCTGTAGGGCGG - Intergenic
965885311 3:173438165-173438187 CATAACTTTCACTTTAATGGTGG + Intronic
967431402 3:189390417-189390439 TAAAGCTTTGATTTTTCGGGGGG + Intergenic
967749656 3:193099677-193099699 CAAAGCCTTAACTTCTAGGTAGG - Intergenic
968322885 3:197787093-197787115 AAAAGAATCCACTTTTAGGGCGG - Exonic
970848716 4:20575555-20575577 CAAAGCATGCACTTTGAGGTGGG + Intronic
971151835 4:24041357-24041379 GAAAGCTATCACTGTTAGAGAGG - Intergenic
971389902 4:26175936-26175958 CACACCTTTCCCTCTTAGGGTGG - Intronic
971527528 4:27639647-27639669 AAAACCTTTCACTATTAGGAGGG - Intergenic
974714623 4:65651194-65651216 CAAAGCTTTCAGATTAAGGTTGG + Intronic
977308898 4:95359741-95359763 CCAAGCTTTCACATTTTGGGAGG - Intronic
977798456 4:101196709-101196731 CTGATCTTTCACTTTTAAGGAGG - Intronic
979512937 4:121574680-121574702 AATAGCTTTTAATTTTAGGGAGG - Intergenic
979542977 4:121907451-121907473 CAAAGCTCTCATTTGCAGGGAGG + Exonic
981904865 4:149911111-149911133 CAACTCTTCCACTTATAGGGTGG + Intergenic
981995273 4:150967416-150967438 CTAAACTTTGAATTTTAGGGAGG - Intronic
983820132 4:172182639-172182661 CAAAGCAATCATTTCTAGGGGGG + Intronic
985987376 5:3527412-3527434 CAATGCGTTCACTATTAGGATGG + Intergenic
986075728 5:4336396-4336418 CAAAGCATTCACATTAAGTGTGG - Intergenic
986354848 5:6913592-6913614 CTAAGATCTCACTGTTAGGGAGG + Intergenic
988624160 5:32853025-32853047 CAAAGCTATCCCTTTTAGTTGGG + Intergenic
994965264 5:106661905-106661927 CAGAGCTTTCATATTTTGGGGGG + Intergenic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
999691521 5:154150117-154150139 AAAACCTTTCACTATTAGGAAGG + Intronic
1000491546 5:161920601-161920623 CAAAATTTTCCCTTTTTGGGGGG - Intergenic
1000847061 5:166294865-166294887 CAAAGTATTCAGTTTTAAGGAGG - Intergenic
1000910696 5:167018545-167018567 TAAAGATTTTATTTTTAGGGTGG + Intergenic
1007018719 6:38496966-38496988 GAAAGTTTTCACCTTCAGGGTGG - Intronic
1008457514 6:51727840-51727862 CCAATCTGTCACTTTTAGGGAGG + Intronic
1011330434 6:86199147-86199169 CAAAGGATGTACTTTTAGGGAGG + Intergenic
1012268858 6:97182799-97182821 CAAAGCTAGCAATTTTAGGGAGG - Intronic
1013259126 6:108421337-108421359 CAAAGCCTTCACTGTTGGGCTGG + Intronic
1013647648 6:112161374-112161396 CAAAGGGTTTACTTTTATGGAGG + Intronic
1017185344 6:151595043-151595065 CACAGCTGTCACTGTTAGGCAGG + Intronic
1017502102 6:155035049-155035071 CGAAGCTTTCACAGTTAAGGAGG + Intronic
1018001609 6:159583577-159583599 CAAAACTTTCACCTGTAGGGTGG + Intergenic
1018045377 6:159961345-159961367 CAAAAATATCACTTTTAGGTTGG - Intergenic
1018874237 6:167805959-167805981 TAAAACTTTCACTTTTGGGTAGG - Intergenic
1018886884 6:167946735-167946757 CAAAGCCTTCACTCTTTGGTCGG - Exonic
1020389021 7:7639435-7639457 AGCAGATTTCACTTTTAGGGTGG - Intronic
1021808668 7:24381508-24381530 CAGAGATTTCCCTTTTAGGAAGG - Intergenic
1022928454 7:35082217-35082239 CAATGCTTTCCCATTTTGGGTGG + Intergenic
1024408313 7:49008183-49008205 GAAAGCTTTCACTTTAAATGGGG + Intergenic
1024592957 7:50905610-50905632 CAAAGGTTTCACTTATATGTGGG + Intergenic
1024821160 7:53331324-53331346 CAAAGCTGTCTTTTTTGGGGAGG - Intergenic
1026831540 7:73613183-73613205 CAAACCTTTGGCGTTTAGGGAGG + Intronic
1027900232 7:84104032-84104054 CAAAGCTTTTACATTTACTGGGG - Intronic
1028968310 7:96827669-96827691 CAGAGCTTGCAATTTTGGGGGGG - Intergenic
1029824564 7:103175889-103175911 CAATGCTTTCCCATTTTGGGTGG + Intergenic
1030557960 7:111050030-111050052 CAAAGGTTTCAATTTTGAGGAGG + Intronic
1031670688 7:124541061-124541083 CAATGTTTTCATTTTTAGTGAGG + Intergenic
1032088510 7:128896552-128896574 TTAAGTTTTCCCTTTTAGGGAGG - Intronic
1034014662 7:147569144-147569166 AACAGCTTTCACTATTAGAGAGG - Intronic
1040351406 8:46572385-46572407 CAAAGCTTTCACATTGTGGAAGG - Intergenic
1043070519 8:75630749-75630771 TCAAGTTTCCACTTTTAGGGAGG + Intergenic
1044052030 8:87516736-87516758 CCAATTTTTCACTTTTAGAGAGG + Intronic
1045425408 8:102061075-102061097 CTGAGTTTTCACTTTTAGGGAGG - Intronic
1045743926 8:105394585-105394607 AAAAGCTGTCTCTTTTAGGATGG + Intronic
1046227723 8:111306758-111306780 GAAAGCTCTCGGTTTTAGGGTGG - Intergenic
1046928405 8:119818054-119818076 AAAATCTTTCACATTTAGAGAGG - Intronic
1048126960 8:131646298-131646320 CATAGATTTCAATTTTAGCGTGG - Intergenic
1048818945 8:138361805-138361827 CAGAGCTGTCACTTTAAGGATGG - Intronic
1051190505 9:14506374-14506396 CAAAGCTTGAACTTTTAGAGAGG + Intergenic
1051644237 9:19251604-19251626 AAAAGCATTCACTTTTACAGGGG - Intronic
1052681842 9:31702999-31703021 CAAAGGGATCACTTTTTGGGAGG - Intergenic
1053220682 9:36310143-36310165 AAAAGTTTTAACTTTTAGGTGGG + Intergenic
1053670308 9:40354724-40354746 CAATTCTTTCACTGTTGGGGTGG - Intergenic
1053920096 9:42980987-42981009 CAATTCTTTCACTGTTGGGGTGG - Intergenic
1054381427 9:64494710-64494732 CAATTCTTTCACTGTTGGGGTGG - Intergenic
1054514305 9:66021576-66021598 CAATTCTTTCACTGTTGGGGTGG + Intergenic
1054824959 9:69564454-69564476 CATTGCTTTTACTTTTGGGGTGG + Intronic
1056914170 9:90730261-90730283 CAAAGCTTCCACATTTTGGAAGG - Intergenic
1058248217 9:102657592-102657614 CAAACCTTTAACTTTGAGAGAGG + Intergenic
1059475664 9:114545322-114545344 AAAATCTTTCACTTTTACGAAGG + Intergenic
1062301953 9:135878604-135878626 CAAAGCTTTCACTCTACAGGTGG - Intronic
1185875518 X:3698889-3698911 CCAGGTTTTCACTTTTAGAGAGG + Intronic
1188174504 X:26972855-26972877 TAAAGATTACACTTTTAGAGTGG - Intergenic
1189958616 X:46303599-46303621 CACAGCTTAAACTTTTAGGAAGG + Intergenic
1190226827 X:48552646-48552668 TAAAGATTTCACTGTTGGGGCGG - Intronic
1190815328 X:53924322-53924344 CAAGGTTTCCCCTTTTAGGGAGG - Intergenic
1191119424 X:56887952-56887974 TCAAGTTTCCACTTTTAGGGAGG - Intergenic
1194603382 X:95951272-95951294 CAAAGCATTCACTTTTAGTGGGG + Intergenic
1195056042 X:101145917-101145939 CAAATCTTTCATTTTTTGGGGGG - Intronic
1195620582 X:106950624-106950646 CAAAGCCCTCACTTATAGGGTGG - Intronic
1197252516 X:124230275-124230297 AAAAGCTTTTACTTTTTGGGGGG - Intronic
1197555323 X:127946121-127946143 CTAAACTTTCATTTTTAGAGAGG + Intergenic
1198018639 X:132636583-132636605 CAAACCCTTCACTTTAAAGGTGG + Intronic
1198683438 X:139204707-139204729 CAAACATTTCCCTTTCAGGGAGG - Intronic
1201233350 Y:11887178-11887200 CAAAGCTTTCACAGTGAGGAAGG - Intergenic
1201924426 Y:19269200-19269222 CAAAACTATCATTTTTAGAGAGG + Intergenic