ID: 1184026023

View in Genome Browser
Species Human (GRCh38)
Location 22:41857165-41857187
Sequence AAATTAAGGCAGAGTGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 460}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184026023 Original CRISPR AAATTAAGGCAGAGTGTGGA CGG Intronic
900075319 1:811421-811443 AAATAAAGACAGAATATGGAAGG + Intergenic
900280727 1:1866484-1866506 AAATTAAGGCAGACTTGGAATGG - Intronic
900315058 1:2052268-2052290 AAAGCAAGGCAGAGGGAGGACGG - Intronic
901052219 1:6430948-6430970 TAATCAGGGCAGAGTGAGGAGGG + Intronic
901717017 1:11163773-11163795 CATTTAAAGCAGGGTGTGGAGGG + Intronic
901846164 1:11983942-11983964 TAAATCAGGCAGAGTTTGGAGGG + Intronic
902072736 1:13754603-13754625 TAATAAAAGCAGAGAGTGGACGG + Intronic
902302492 1:15511985-15512007 TAAATGAGGCAGTGTGTGGAGGG - Intronic
903528667 1:24012828-24012850 AAATAAAGGCAGAGATTGCAGGG - Intergenic
904834486 1:33326107-33326129 ATTTTCAGGCAGAATGTGGAAGG + Intronic
905232570 1:36523487-36523509 AAATTAAGGCTGAGATTGCATGG + Intergenic
905336972 1:37251447-37251469 AAATTAAGCTGGAGTTTGGAAGG + Intergenic
905507668 1:38493065-38493087 AAATAAAAGCAGAGTAAGGAAGG + Intergenic
906150896 1:43587106-43587128 AGAGTAAGGCAGGCTGTGGAAGG + Intronic
906480319 1:46195195-46195217 AAAAGAAGGCAGAGAGTGGCGGG - Intronic
906652905 1:47525766-47525788 TAGTAAAGGCAGAGTGTGGCAGG + Intergenic
907448063 1:54522190-54522212 AAACTATGGCAGATTCTGGAGGG + Intergenic
907980842 1:59479254-59479276 AAATTTGGTCAGAGTGTGGGGGG + Intronic
908200837 1:61793802-61793824 AAATTTGGGCAGATTATGGAGGG + Intronic
908909342 1:69055046-69055068 AAATAGAGGCAGGGTGAGGAGGG - Intergenic
908945906 1:69496607-69496629 CAATCAAGCCAGAGGGTGGATGG + Intergenic
909230631 1:73084762-73084784 AATTTAAAGCAGTGTGTAGAGGG - Intergenic
909987619 1:82182078-82182100 GAATTAAGGCAGAGAGCGCATGG + Intergenic
910369235 1:86498439-86498461 AAATTAATTCTGTGTGTGGAAGG + Intronic
911311346 1:96295615-96295637 AAATTAAGGCAGTGTTAAGAGGG - Intergenic
911469948 1:98305918-98305940 AATTTCAGGCAGAGTGAGGCTGG - Intergenic
911522354 1:98943969-98943991 AAGTTATGGCAGAGAGTGGGAGG - Intronic
912173301 1:107126847-107126869 AAAATAAGTCAGAGGGAGGAAGG - Intergenic
913080954 1:115386472-115386494 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
913335570 1:117706549-117706571 AAACTAAGGCACAGTGAGTAGGG - Intergenic
914893144 1:151645848-151645870 AAAAGCAGGCAGACTGTGGAGGG - Intronic
916038128 1:160938997-160939019 ATTTAAAGGCAGTGTGTGGAGGG - Intergenic
916174683 1:162027921-162027943 AAAATAATGAAGAGTTTGGAAGG - Intergenic
916314099 1:163428291-163428313 AAATAAAGGCAGTCTGTGGATGG + Intergenic
916500604 1:165383782-165383804 AAAGTAAGACAAAGTGTCGAGGG + Intergenic
916804816 1:168249230-168249252 AAATTAAAGCAGTGTGTAGAGGG - Exonic
917579337 1:176358856-176358878 CACTTAAGGCAGTGTGTAGAGGG + Intergenic
917579815 1:176364501-176364523 AAATTAAGGCATAGGGTGGTTGG - Intergenic
918624004 1:186637190-186637212 AAATTAAGGGAGAGGATGGTGGG + Intergenic
919145828 1:193633428-193633450 AACTCATGGCAGAGAGTGGAAGG - Intergenic
920035147 1:203060645-203060667 AAATTTTGGCAGAGTAGGGATGG - Intronic
920428958 1:205902474-205902496 CATTTAAGGCAGCGTGTAGAGGG + Intergenic
920868161 1:209770219-209770241 ATATTAAAGCAGAGTGAGGGCGG - Intronic
921579671 1:216881468-216881490 AAATTAAGGGGGAGTGGGGATGG + Intronic
921702537 1:218284578-218284600 AAATGAAGGCCGACTGTGGTAGG + Intergenic
921839484 1:219813149-219813171 AAACTAAGGCACAGAGTGGTAGG + Intronic
922271158 1:224036298-224036320 AAATAAAGACAGAATATGGAAGG + Intergenic
1063814241 10:9755017-9755039 ATGTTCAGGCAGAGTGTGGAGGG + Intergenic
1064478549 10:15718224-15718246 TAGTGCAGGCAGAGTGTGGATGG - Intronic
1065278949 10:24115383-24115405 AAATTAAAGCAGAGAGTTCAAGG + Intronic
1065668342 10:28086894-28086916 AAAACCAGGCAGAGTGTAGATGG + Intronic
1066034214 10:31465276-31465298 AAATTAACACAGAATGTGGGAGG + Intronic
1066163260 10:32757592-32757614 CATTTAAGGCAGTGTGTAGAGGG + Intronic
1066533226 10:36363204-36363226 AAATTAAGGCAGAGAGATTAAGG - Intergenic
1067018677 10:42776272-42776294 AAATGGAGGCAGAGGATGGAAGG - Intergenic
1068966105 10:62913440-62913462 AAATAAAGGCAGAGTGCTGGGGG - Intronic
1069370475 10:67742491-67742513 CATTCAAGGCAGTGTGTGGAGGG + Intergenic
1069448643 10:68497891-68497913 AAATAAAGGCAGAGTACGGTGGG - Intronic
1069989215 10:72304229-72304251 AAACGCAGGCAGAGTGGGGATGG - Intergenic
1070073308 10:73110817-73110839 AAATTAAGGCACAATGTGAGAGG - Intronic
1070692346 10:78536583-78536605 TAATTAAGGCAAAGTTTGCAGGG - Intergenic
1071946656 10:90653498-90653520 AAAATAAGGGAGAGTGTGTGAGG - Intergenic
1072322938 10:94268745-94268767 CAATTAATCCAGAGTGGGGAAGG - Intronic
1072532372 10:96331505-96331527 AAAGCAAGACAGAGTGGGGAGGG + Intronic
1072701790 10:97647340-97647362 ATATTAAAGAAGAGAGTGGATGG + Intronic
1073441084 10:103553096-103553118 AAAGGCAGGCAGGGTGTGGAGGG + Intronic
1074000773 10:109370223-109370245 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1074244872 10:111679521-111679543 AAATAAAGGAAGAGTTGGGAGGG - Intergenic
1074907046 10:117874006-117874028 ACACTAAGGCACAATGTGGATGG + Intergenic
1074998168 10:118775307-118775329 AAAAAAAGGCTGGGTGTGGATGG + Intergenic
1076776623 10:132701468-132701490 AAATGGAGGCAGAGGGTGTATGG - Intronic
1077316091 11:1920000-1920022 AGAAGAAGGCAGAGTGTGGGAGG + Intronic
1079002598 11:16770363-16770385 AATGGAAGGCAGAGGGTGGAGGG + Intergenic
1079478206 11:20853888-20853910 TAACTGAGGCAGAGTGGGGAAGG + Intronic
1080953314 11:37062919-37062941 ACATTAAGGCAGGGTAGGGAGGG + Intergenic
1081557153 11:44175347-44175369 AAAGAAAGGTAGATTGTGGAGGG - Intronic
1081562071 11:44226866-44226888 AAACTCAGGCAGTGTGTGCAAGG + Intronic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1082136235 11:48552507-48552529 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1082148739 11:48704890-48704912 AAATTAAGGCCTATTGTGAAAGG - Intergenic
1083910401 11:65705301-65705323 CAATCAAGGCAGAGGGTGAAGGG - Intergenic
1084298110 11:68226256-68226278 AAAATAAAGGAGAGTGTGCAGGG + Intergenic
1084601448 11:70148132-70148154 AACTGAAGGCAGCGTGTGGCAGG - Intronic
1085189965 11:74611059-74611081 AAAATAAGGCCGGGTGTGGTGGG - Intronic
1085544308 11:77302769-77302791 AAGGTAAGGCAAAGTGGGGATGG - Intergenic
1086294746 11:85352557-85352579 CATTTAAAGCAGAGTGTAGAGGG - Intronic
1086599437 11:88614591-88614613 AAATTAAATCACAGTGTGTAGGG + Intronic
1086691545 11:89792734-89792756 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1086786465 11:90975115-90975137 ACATTAAAGCAGTGTGTAGAGGG + Intergenic
1087175572 11:95092117-95092139 AAGATAAGGCAGAGTTTAGAAGG + Intronic
1087866572 11:103235198-103235220 AATTAAAGGCAGATTGTGAAAGG - Intronic
1088722544 11:112607183-112607205 AGATTCAGGCAGTGGGTGGATGG + Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1090357865 11:126152063-126152085 AAATACAGCCAGTGTGTGGAGGG - Intergenic
1090541136 11:127707323-127707345 GAATGAAAGAAGAGTGTGGAAGG - Intergenic
1090852916 11:130585931-130585953 AAATTTGGGCAGAATGTGTAAGG + Intergenic
1092148661 12:6232224-6232246 GAAGTTAGCCAGAGTGTGGAAGG + Intronic
1092299736 12:7235443-7235465 TAATAAAGTCAGAGGGTGGAAGG + Intergenic
1093249018 12:16777079-16777101 AATATAAGCCAGAGTCTGGAAGG + Intergenic
1093294545 12:17372054-17372076 AAATTAAGACAGAATGTGTCTGG + Intergenic
1093695062 12:22149542-22149564 ACATTAAAGCAGTGTGTAGAGGG + Intronic
1093725910 12:22508343-22508365 AAAATAAGGAAGAGGATGGAAGG + Intronic
1094252711 12:28383414-28383436 AAATTAAGGAAAAATTTGGAAGG + Intronic
1095684263 12:45014473-45014495 AAACTAAGGCAGAGTATGGTTGG - Intergenic
1096029628 12:48401405-48401427 AATTTAAAGCAGTGTGTAGAGGG - Intergenic
1097985153 12:65775299-65775321 CAATTATGTCAGAGTGTTGAAGG - Intergenic
1098481411 12:70965743-70965765 AAAGTAAGAAAGAGTGTGGAAGG + Intergenic
1098488459 12:71048077-71048099 AAAGTCAGACACAGTGTGGAGGG - Intronic
1099301552 12:80901226-80901248 TAAATAAGGAATAGTGTGGATGG - Intronic
1099596988 12:84679428-84679450 TAATTAAGGAAGATTGTGTATGG - Intergenic
1100653221 12:96613359-96613381 CATTTAAGGCAGTGTGTAGAGGG + Intronic
1101243182 12:102858813-102858835 CATTTAAGGCAGTGTGTAGAGGG + Intronic
1102713746 12:114952230-114952252 CAAGAAAGGCAGAGTGTAGATGG - Intergenic
1103461760 12:121110580-121110602 AAACTGAGGCAGAGAGTGGAAGG + Intergenic
1103699303 12:122840449-122840471 AAACTGAGGCAGAGTGGTGAAGG - Intronic
1104135610 12:125935087-125935109 AAATCATGGCAGAGGGTGAAGGG - Intergenic
1105962423 13:25354300-25354322 AACAGAAGGCAGACTGTGGAAGG + Intergenic
1106617523 13:31343402-31343424 ACATTAAAGCAGTGTGTAGAGGG + Intergenic
1106824065 13:33500095-33500117 TAATTAAGGTAGAGTCTTGAGGG - Intergenic
1106989081 13:35394906-35394928 CAGTTAAGGCAGTGTGTAGAAGG - Intronic
1108265170 13:48699508-48699530 AATTTAAAGCAGTGTGTAGAGGG + Intronic
1109147166 13:58793265-58793287 AAATTATTGCACAGTGTGTACGG + Intergenic
1109920491 13:69051771-69051793 AAATTATGGCAGAAGGTGAAGGG - Intergenic
1112307303 13:98286553-98286575 AAATTATGGCAGAAGGTGAAAGG - Intronic
1114708851 14:24756387-24756409 CATTTAAAGCAGTGTGTGGAAGG + Intergenic
1114998859 14:28396173-28396195 AATTAAAGGCAGAGTTTGGCAGG - Intergenic
1115624609 14:35177896-35177918 CATTTAAAGCAGTGTGTGGAGGG - Intronic
1117369125 14:55059994-55060016 AAAGCAAGGCAGAGTAGGGAAGG + Intronic
1117529206 14:56642498-56642520 CATTTAAAGCAGTGTGTGGAGGG + Intronic
1117797846 14:59412427-59412449 CAATTAAAGCAGTGTGTAGAGGG + Intergenic
1118219469 14:63841402-63841424 AAATGGAGGCAGAGAATGGAAGG - Intergenic
1120231638 14:81846894-81846916 AAATTAAATAAGAATGTGGAAGG + Intergenic
1120276802 14:82385938-82385960 CAATCATGGCAGAGTGTGAAAGG - Intergenic
1121152864 14:91653547-91653569 CAATCATGGCAGAGGGTGGAAGG + Intronic
1121431550 14:93891690-93891712 AAATGTGAGCAGAGTGTGGAAGG - Intergenic
1121791501 14:96702869-96702891 AAAATAAGCCAGAGTGGGGGCGG + Intergenic
1121940079 14:98062245-98062267 AAGATAAGGGAGAGTGTGAAGGG - Intergenic
1123023741 14:105414011-105414033 AAATAAAGGCCGGGTGTGGTGGG - Intronic
1123198088 14:106636107-106636129 CAATCAAGGCAGAGTGTGAAGGG - Intergenic
1125552620 15:40558133-40558155 AAATTAAGGCAGACGGTAAATGG - Intronic
1125774842 15:42203179-42203201 AAAATTAGGCCGAGTGTGGTTGG + Intronic
1126164373 15:45641954-45641976 AAATTCAGGCACAGTGAGGGTGG - Intronic
1127778717 15:62292042-62292064 CATTTAAAGCAGGGTGTGGAGGG - Intergenic
1128836163 15:70810732-70810754 AAATTAAGGAGTAGTGGGGAAGG + Intergenic
1129832879 15:78682059-78682081 TAAATAAAGCAGAGTGTAGATGG + Intronic
1131662495 15:94532811-94532833 AAGTTAAGGCAGGGTGGGGGTGG + Intergenic
1133720698 16:8491739-8491761 AACTCAAGGGAGAGTGTGGCTGG - Intergenic
1133855574 16:9546417-9546439 AAAGTAAAGCAGAGTATGGAAGG + Intergenic
1135487570 16:22879464-22879486 GGATAAAGGCAGAGGGTGGATGG + Intronic
1136691063 16:32029675-32029697 AAATCATGGCAGAATGTGAAAGG + Intergenic
1136791652 16:32973235-32973257 AAATCATGGCAGAATGTGAAAGG + Intergenic
1136878164 16:33880695-33880717 AAATCATGGCAGAATGTGAAAGG - Intergenic
1137356617 16:47772321-47772343 CATTTAAGGCAGAGGGTAGAGGG - Intergenic
1138357426 16:56394199-56394221 CATTTAAGGCAGTGTGTAGAGGG + Intronic
1138758105 16:59513451-59513473 AAATAAAGGCAGAGGGTAAAGGG - Intergenic
1139401269 16:66683766-66683788 ATAGTAAGGCAGAGTGGGGTGGG + Intronic
1141283119 16:82646800-82646822 CAATTAAGCCAGAGAGAGGAAGG + Intronic
1141342719 16:83217920-83217942 AAATTATGGCAGATTTTGCAAGG + Intronic
1141570981 16:84933545-84933567 GAAGTAAGGCAGGGTGGGGAAGG - Intergenic
1203093861 16_KI270728v1_random:1234696-1234718 AAATCATGGCAGAATGTGAAAGG + Intergenic
1142809623 17:2389246-2389268 AAATTGAGGGAGAGTGGGGGAGG - Intronic
1143133025 17:4692622-4692644 AAAATAAAGCAGAGTAAGGAAGG + Intronic
1143707498 17:8709109-8709131 AGATTGAGGCTGGGTGTGGAGGG - Intergenic
1145808623 17:27751797-27751819 ACATTTAGGCAGAGCATGGAAGG - Intergenic
1146382297 17:32340235-32340257 GAATTAAGGCAGAATAAGGAGGG - Intronic
1146883976 17:36458771-36458793 AAAAAAAGGTAGAGTGTAGATGG - Intergenic
1146939863 17:36836891-36836913 AAAGAAAGGCAGAGTGTGGGTGG + Intergenic
1146972525 17:37084353-37084375 AAACTGAGGCAGAGGGTTGACGG + Intergenic
1147208752 17:38858383-38858405 AAACAAAGGCAGAACGTGGAAGG - Intergenic
1149573710 17:57696273-57696295 ATGTCACGGCAGAGTGTGGAAGG + Intergenic
1150147726 17:62783365-62783387 ACATTAAAGCAGTGTGTAGAGGG + Intronic
1150233556 17:63573841-63573863 AAATTAAGGGATAGTGAGAATGG - Intronic
1150919121 17:69465008-69465030 AAATAAATGCACAGTCTGGATGG - Intronic
1152003921 17:77665312-77665334 CAATTATGGCAGAAGGTGGAAGG - Intergenic
1152770496 17:82165370-82165392 AAATGAAGGCTGAGTGTCTAGGG + Intronic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1157012614 18:43669605-43669627 AAATTAATTCAGAATGAGGAAGG + Intergenic
1159190966 18:65041521-65041543 TAATTAAGGCATTGTGTTGAGGG + Intergenic
1159337591 18:67090019-67090041 CATTTAAGGCAGTGTGTAGAGGG - Intergenic
1159364519 18:67448769-67448791 AATTTAAGGCAATGTGTAGAGGG - Intergenic
1159547793 18:69862175-69862197 AAATTATGACTGGGTGTGGAAGG - Exonic
1160273984 18:77413348-77413370 AGGTTAAGGCAGAGTTTGAATGG - Intergenic
1160301171 18:77680470-77680492 CATTTAAAGCAGAGTGTAGAGGG - Intergenic
1161115936 19:2496356-2496378 AAACAAAGGTAGAATGTGGAAGG - Intergenic
1161532967 19:4801118-4801140 ATATCAAGGCACAGGGTGGAGGG - Exonic
1162225728 19:9220688-9220710 AAACGAAGTCAGTGTGTGGAAGG - Intergenic
1162505762 19:11083839-11083861 AAAATAAGGCCGAGTGTAGTGGG - Intergenic
1164395068 19:27855653-27855675 CATTTAAGGCAGTGTGTAGAGGG + Intergenic
1164425909 19:28141746-28141768 CACTTAGGGCAGGGTGTGGAGGG + Intergenic
1166132483 19:40754457-40754479 AAGCTTAGGCAGAGTGTTGAGGG + Intronic
1166156461 19:40915658-40915680 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1167482221 19:49740049-49740071 AGATGAAGCCAGAGTGAGGAAGG - Exonic
925619512 2:5777447-5777469 AAATTATTGAAAAGTGTGGACGG - Intergenic
925782210 2:7391675-7391697 AAGTTATGGCAGAGAGTGGCTGG + Intergenic
926053848 2:9762183-9762205 AAAATAAGGCAGATTGTGCTTGG - Intergenic
926415569 2:12646334-12646356 CAATTATGGCAGAGGGTGAAAGG + Intergenic
927260884 2:21088681-21088703 AACTTAAGGCTTAGAGTGGAAGG + Intergenic
927671689 2:25073824-25073846 GAATTGAGGCAGAGCCTGGAAGG - Intronic
928187304 2:29123602-29123624 AACTAAAGGCACAGTGTTGAGGG + Intronic
928462914 2:31492077-31492099 CATTTAAAGCAGAGTGTAGAGGG + Intergenic
928487829 2:31750295-31750317 ACATTAAAGCAGTGTGTAGAGGG + Intergenic
928738799 2:34324726-34324748 AAAATAAGCCAGAGTGTAGTAGG - Intergenic
929009671 2:37428536-37428558 GATTTAAGGGAGAGGGTGGAAGG - Intergenic
929039141 2:37726127-37726149 CATTTAAAGCAGTGTGTGGAGGG + Intronic
929317944 2:40503200-40503222 AAATTAAGACAAATTATGGATGG - Intronic
929478152 2:42274541-42274563 AAATTCAGGCAGAGTGGAGAAGG - Intronic
930295212 2:49545567-49545589 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
930838194 2:55816980-55817002 ACATTAAAGCAGTGTGTAGAGGG + Intergenic
931101642 2:59008528-59008550 ACATTACGGCAGAGTTGGGATGG - Intergenic
931786278 2:65622033-65622055 ACATAAAGGCAAAGTGTGGAGGG + Intergenic
932001495 2:67889216-67889238 AAATCAAGACTGGGTGTGGATGG + Intergenic
932472543 2:71970636-71970658 AAATTAAGTCACAGCCTGGATGG - Intergenic
932570348 2:72935230-72935252 AAATGAAGGCAGAGCGGGGTGGG - Intronic
933211725 2:79578651-79578673 AATGTAAGGCAGAGAGTGCAGGG - Intronic
934567436 2:95348327-95348349 GGATTGGGGCAGAGTGTGGAGGG + Intronic
936808739 2:116370244-116370266 TAATGAGGGCAGAGTGTGAAGGG + Intergenic
937012987 2:118578135-118578157 AAATAAAGCCAAAGTGTGGGGGG + Intergenic
938670833 2:133584777-133584799 AAATTAAGGCAGGGAATGGGAGG + Intergenic
938688689 2:133766112-133766134 AAAAAAAGGCAGGGTGGGGAGGG + Intergenic
939024680 2:136997942-136997964 AAGGTAAGGCAGAGTGAGCAAGG + Intronic
939055821 2:137363226-137363248 CAATTAAAGCAGTGTGTAGAGGG + Intronic
939363503 2:141204021-141204043 CATTTAAAGCAGAGTGTAGAGGG + Intronic
939422564 2:141992673-141992695 AAATTAATGTTGATTGTGGATGG + Intronic
939630332 2:144520959-144520981 AAAGTAAGGGAGAGTGTGTAGGG + Intronic
940584131 2:155622608-155622630 ACCTTAAGGCAGAGGGTGGACGG + Intergenic
940591765 2:155738120-155738142 AAATGAAGAAAGAGTGTGGATGG + Intergenic
942203608 2:173596736-173596758 AAATTAAGGCACAGAGAGGCAGG + Intergenic
942362754 2:175189721-175189743 AATTTAAAGCAGTGTGTAGAGGG + Intergenic
942958458 2:181801701-181801723 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
943351276 2:186799229-186799251 ATATAAAGGCAGAGTGTGTCAGG + Intergenic
943912286 2:193584190-193584212 GAATTATGCCTGAGTGTGGATGG - Intergenic
944479378 2:200140030-200140052 AAAATACAGCAGAGAGTGGAAGG - Intergenic
944493793 2:200285472-200285494 AAAAAAAGGCAGATTTTGGAAGG + Intergenic
945161588 2:206897360-206897382 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
945197182 2:207247812-207247834 AATTTAAAGCAAAGTGGGGAGGG + Intergenic
946294107 2:218769811-218769833 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
947384222 2:229575191-229575213 AAAATGAGGCAGAATGAGGAAGG + Intronic
947483845 2:230528417-230528439 CATTTAAGGCAGTGTGTAGAGGG + Intronic
947941730 2:234062309-234062331 CAAACAGGGCAGAGTGTGGAGGG + Intronic
948621697 2:239239346-239239368 ACATGAAGGCAGGGTCTGGAGGG + Intronic
948805330 2:240451460-240451482 AAATTCAGGCAGGCTGTGGGAGG - Intronic
949021128 2:241742061-241742083 AGATGCAGGCAGAGGGTGGAAGG + Intronic
949082403 2:242113374-242113396 AAATAAAGACAGAATATGGAAGG - Intergenic
1169533881 20:6515611-6515633 AAATTACTTCAGATTGTGGAAGG - Intergenic
1170049861 20:12130075-12130097 CTATTAAGGCAGGGTATGGAGGG + Intergenic
1170494351 20:16910580-16910602 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1171106473 20:22438339-22438361 AGATTAAGGCAGAGTGGAGCAGG - Intergenic
1171140553 20:22737624-22737646 CATTTAAGGCAGTGTGTAGAGGG + Intergenic
1172332682 20:34086477-34086499 AAACTATGGCATAATGTGGATGG + Intronic
1174635127 20:51992851-51992873 AAATTAAGGCAGACAGAGTAAGG - Intergenic
1175071721 20:56339755-56339777 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1175608140 20:60328296-60328318 GAATTCAGCCAGAGTGTGGCAGG + Intergenic
1175716167 20:61254935-61254957 AAGGTAAGGCGGGGTGTGGAGGG + Exonic
1177767482 21:25474732-25474754 CAATTATGGCAGAGGGTGAAGGG - Intergenic
1177953415 21:27567285-27567307 AAAACAGGGCAGAGTATGGAGGG + Intergenic
1178611869 21:34089734-34089756 AAGTTGAGGCAGAGTAGGGAGGG - Intronic
1178619046 21:34158449-34158471 GAGTTAAGGCAGAGAGTGGCTGG + Intergenic
1179320222 21:40284416-40284438 AATTTAGGGCAGAGTTTAGAGGG - Intronic
1180607982 22:17075600-17075622 AAATTAGAGCAGAGTGTCCAGGG + Intergenic
1180724283 22:17933461-17933483 CATTTAAAGCAGAGTGTAGAGGG + Intronic
1182779268 22:32854723-32854745 AATTGAATGCTGAGTGTGGACGG + Intronic
1183622170 22:38980932-38980954 CAGTTAAGGCACAGTGGGGAAGG - Intronic
1183627066 22:39010908-39010930 CAGTTAAGGCACAGTGGGGAAGG - Intergenic
1184026023 22:41857165-41857187 AAATTAAGGCAGAGTGTGGACGG + Intronic
1185155269 22:49189864-49189886 AAGTTAAGGAAGACTGTGGTGGG + Intergenic
950460564 3:13119895-13119917 TGAGTGAGGCAGAGTGTGGACGG - Intergenic
950659778 3:14460056-14460078 AAACTGAGGCAGAGTGAAGAAGG - Intronic
950985835 3:17365451-17365473 AAATTAAGGAAGCTTGGGGATGG - Intronic
952550412 3:34470725-34470747 AAATTAAGGAAAAGTGTTAAGGG - Intergenic
952947643 3:38490132-38490154 ATTTTTAGGCAGAGAGTGGATGG + Exonic
953613676 3:44470078-44470100 AAAGTCAGGCAGAGTGAGGGTGG - Intronic
954764750 3:52904431-52904453 AAATTATGACAGAATTTGGAGGG - Exonic
955092033 3:55762020-55762042 AAATTATGGCAGAAGGTGAAGGG - Intronic
955445027 3:59000679-59000701 AAATGGAGGCAGAGAGTGGGTGG + Intronic
955538762 3:59952279-59952301 AACTTAATGCACAGTGTGGGTGG - Intronic
955587240 3:60493371-60493393 AAATTTAGGCAGATTCAGGAAGG - Intronic
955673565 3:61427247-61427269 GAATTAAGGGAGAGAGGGGAGGG + Intergenic
956433398 3:69209412-69209434 AAATTAAAGTATGGTGTGGAGGG + Intronic
956561796 3:70586547-70586569 AAATAAAGGAAAAGTGTGGAAGG + Intergenic
957589749 3:82180613-82180635 CAATTAAGGCTGAGTGTGGTGGG - Intergenic
959442395 3:106393770-106393792 AAATGCAAGCAGAGTGTGTAAGG + Intergenic
959816081 3:110674566-110674588 CAATTAAAGCAGTGTGTAGAGGG + Intergenic
959882401 3:111459695-111459717 AAATTAAGGAAGAGTCTGTCTGG + Intronic
959969219 3:112390016-112390038 AAATTAAAGCAAATGGTGGAAGG + Intergenic
959995094 3:112671875-112671897 AAATTAGGTCACAGTCTGGAGGG + Intergenic
960480417 3:118181066-118181088 AAAGTAAGGTAGACTCTGGAAGG - Intergenic
960516203 3:118605243-118605265 AAATAAAATCAGTGTGTGGAAGG - Intergenic
960857458 3:122117827-122117849 AATTTAAGGCACAGTGAGAAAGG + Intronic
962231525 3:133669593-133669615 AGAATAAGGAAGAGCGTGGAAGG - Intergenic
962545462 3:136429615-136429637 AAATTAAAGCAAATAGTGGAAGG + Intronic
963002708 3:140697496-140697518 ATACAAAGGCAGAGTCTGGATGG - Intronic
963416949 3:145008645-145008667 AAAATAAAGAAGAGTATGGAAGG - Intergenic
963555288 3:146779530-146779552 AAATTAAGACAGAGTTCTGAGGG - Intergenic
963641799 3:147869578-147869600 AAATTTTGGCAAAGTGTTGAAGG - Intergenic
963986118 3:151596939-151596961 AACTACTGGCAGAGTGTGGAAGG - Intergenic
965024353 3:163281155-163281177 AAATTGAGGCTGAATCTGGAGGG + Intergenic
968614899 4:1573346-1573368 AAATGAAGGAAGAGTTGGGATGG - Intergenic
968944391 4:3655710-3655732 AAATTAAAGCTGATTGAGGAGGG + Intergenic
970953308 4:21781283-21781305 AAATTATGGCAGAAGGTGAAAGG - Intronic
971182202 4:24339344-24339366 AAATCAGGCCAGAATGTGGAAGG - Intergenic
971345740 4:25810272-25810294 ACATGAAGGCAGAGAGGGGAGGG - Intronic
971899727 4:32644248-32644270 AAATTAAGACAGAAAGTGAATGG - Intergenic
971946369 4:33284304-33284326 AGATTATGGCAGGATGTGGAAGG - Intergenic
972086993 4:35230186-35230208 AACTTAAACCAGAGTGTGGCAGG - Intergenic
972580537 4:40391866-40391888 ACATCATGGCAGAGTGTGGGAGG + Intergenic
972914574 4:43859968-43859990 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
973229431 4:47824882-47824904 TAAGCAAGGCAGAGTGGGGAGGG - Intronic
973299528 4:48564533-48564555 TAAGGAAGGCAGAGTGTGGAGGG + Intronic
973804487 4:54512625-54512647 AAATACAGGCAGACTGTGGAAGG - Intergenic
974864295 4:67561770-67561792 AAAATAAGAGAGAGTGTGGGTGG + Intronic
975093849 4:70434858-70434880 CAATTAAAGCAGTGTGTAGAGGG - Intronic
975232429 4:71950547-71950569 AATTTAAAGCAGTGTGTAGATGG + Intergenic
975522572 4:75316411-75316433 CAATTAACGCAGTGTGTAGAGGG + Intergenic
976000614 4:80370094-80370116 CAATTATGGCAGAGGGTGAAAGG + Intronic
976035238 4:80810558-80810580 AGATGAAGGCAGAGACTGGAGGG + Intronic
976263349 4:83167033-83167055 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
976529156 4:86131100-86131122 AAATTATGGCAGATTGTAGGTGG + Intronic
976760331 4:88541936-88541958 CATTTAAAGCAGTGTGTGGAGGG + Intronic
977084055 4:92571873-92571895 CATTCAAGGCAGTGTGTGGAAGG + Intronic
977542712 4:98337617-98337639 AAATTAAGACACAGTGTTTATGG + Intronic
978269610 4:106873252-106873274 CAATTAAAGCAGTGTGTAGAGGG - Intergenic
978597395 4:110393162-110393184 GAATTAAGGAAGAGAATGGAAGG + Intronic
978914743 4:114110331-114110353 AAATTAAGGCAAACTTTAGAAGG - Intergenic
979315095 4:119252885-119252907 CATTTAAGGCAGTGTGTGGAAGG - Intronic
979487757 4:121287777-121287799 CAATTAAAGCAGTGTGTAGAGGG + Intergenic
980849881 4:138368067-138368089 AAACTAGGGCAGAGTGCAGAAGG + Intergenic
982062727 4:151620943-151620965 AAACAAATGCAGAGAGTGGAGGG + Intronic
983047194 4:163001866-163001888 CATTTAAAGCAGAGTGTAGAGGG - Intergenic
983694156 4:170508240-170508262 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
984063023 4:175015531-175015553 AAATTCAGGCAGAGTGTTTGGGG - Intergenic
985131172 4:186740234-186740256 GAATATAGGCAGAGAGTGGATGG - Intergenic
985327825 4:188792731-188792753 AAATGAAGGCAGATTCTAGAAGG + Intergenic
988387985 5:30591386-30591408 AAAATTAGACAGAATGTGGAGGG + Intergenic
988877135 5:35458706-35458728 AAATCACGGCAGAATGTGAAGGG - Intergenic
988896294 5:35678172-35678194 AGATTAGGGCAGACTGAGGAAGG + Intronic
989517082 5:42356160-42356182 CAATTAAGGCAGTGTGTAGAGGG + Intergenic
990482428 5:56224327-56224349 CATTTAAGGCAGTGTGTAGAGGG + Intronic
991199734 5:63978048-63978070 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
991479749 5:67064650-67064672 AAATTATGGAAGAGTTTGAAAGG - Intronic
991535342 5:67663971-67663993 CACTTAAGGCAGTGTGTAGAGGG - Intergenic
991553473 5:67869120-67869142 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
991949489 5:71933640-71933662 AATTTGAGGCTTAGTGTGGATGG + Intergenic
992258013 5:74941566-74941588 AAATTAGGGCAATGTTTGGAGGG + Intergenic
993444393 5:87993434-87993456 AATTTAAAGCAGTGTGTAGAAGG + Intergenic
994286552 5:97975606-97975628 AATATAAGGCAGAGAATGGATGG + Intergenic
994558648 5:101337790-101337812 AATTTGTGGCAGAGTGTGAATGG - Intergenic
994878010 5:105450287-105450309 CAATCATGGCAGAATGTGGAAGG - Intergenic
995127764 5:108595962-108595984 AAATTCAGACAGAGCTTGGATGG - Intergenic
996790638 5:127290224-127290246 AGGTGAAGGCAGAGGGTGGAGGG - Intergenic
997004332 5:129800850-129800872 CATTTAAAGCAGAGTGTAGAGGG - Intergenic
998256317 5:140591485-140591507 AGATTAAGGAAGAGGGTGGGAGG + Intronic
998497105 5:142600550-142600572 AAAATAAAGCAGAGTGAGGGTGG + Intronic
998528770 5:142866129-142866151 AAATTAAGGTAGACTGTGCTAGG - Intronic
998845482 5:146304960-146304982 AAACAAAGGCAAATTGTGGATGG + Intronic
999415544 5:151392553-151392575 CATTTAAGGCAGAGTGTAGAGGG - Intergenic
1000024422 5:157346491-157346513 AAACAGAGGCAGAGAGTGGAAGG + Intronic
1000886026 5:166748474-166748496 AATTAAAGACCGAGTGTGGAAGG + Intergenic
1001319317 5:170667395-170667417 AAGTTCAGGCATAGTGTGGCAGG + Intronic
1002127225 5:177055319-177055341 ATATTAGGGCCGAGTGTGGTGGG - Intronic
1003484264 6:6562376-6562398 ACATTAAGGCAGAAGGTGAAGGG + Intergenic
1004506064 6:16247731-16247753 AAACTGAGGCAGAGAGGGGAGGG + Intronic
1005448726 6:25952677-25952699 AACTCAAGACAGTGTGTGGAGGG + Intergenic
1005892726 6:30153392-30153414 AAATTACAGCACAGTGTGGTGGG - Exonic
1008589398 6:52978069-52978091 AAAATTAGGCAGAGACTGGAGGG + Exonic
1009050097 6:58264720-58264742 ATATTAAGGCAGAAAGAGGATGG - Intergenic
1009453872 6:63832056-63832078 AATTTAAAGCAGTGTGTAGAGGG + Intronic
1009875357 6:69498208-69498230 AATTCAAAGCAGTGTGTGGAGGG + Intergenic
1010206683 6:73328673-73328695 AAATTAAAGCTGCGTGTGAAGGG + Intergenic
1010463546 6:76140933-76140955 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1010731364 6:79394928-79394950 AAAGTGAGGGAGAATGTGGATGG + Intergenic
1011484978 6:87831560-87831582 AAAGTAAAACAGAGTGGGGAAGG + Intergenic
1013004168 6:106055951-106055973 AAATTAAAGCTGTGTGTGGGAGG + Intergenic
1014411534 6:121128739-121128761 AAACTAAGGCAGACTGTTCAAGG + Intronic
1014694517 6:124602524-124602546 AAATAAATGCAAATTGTGGATGG + Intronic
1014749525 6:125239402-125239424 CAATTATGGCAGAAGGTGGAAGG + Intronic
1014907388 6:127046236-127046258 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1015589974 6:134813770-134813792 AAGTAAAGGCATAGTGTGTATGG + Intergenic
1015664630 6:135615214-135615236 AAGAGAAGGCAGAGTGTGGGAGG - Intergenic
1015777650 6:136831197-136831219 AAATTATGGCAGAAGGTGAAGGG + Intronic
1015967439 6:138709064-138709086 AATTTAAAGCAGTGTGTAGAGGG - Intergenic
1016157327 6:140827378-140827400 AAATGAAGGCAGTGTGGGCATGG - Intergenic
1017035402 6:150262674-150262696 AAAAAAAGGCAGAGTGAGAATGG - Intergenic
1019892736 7:3959602-3959624 ACATGGATGCAGAGTGTGGAAGG - Intronic
1020059837 7:5143963-5143985 AAACGAAGGCAGGGTGTGGAGGG - Intergenic
1020149382 7:5669894-5669916 AAAGTAAGTGAGATTGTGGATGG + Intronic
1020168132 7:5823788-5823810 AAACGAAGGCAGGGTGTGGAGGG + Intergenic
1020712277 7:11622945-11622967 AAATAAAGGCAGAGAGTTGAAGG + Intronic
1021121219 7:16797922-16797944 AAATTAAGGGAGAATTTGGAAGG + Intronic
1021602990 7:22382874-22382896 AAAATAAGGCAGAATGATGAGGG - Intergenic
1022977769 7:35574799-35574821 AGAGAAAGGCAGAGTCTGGAAGG + Intergenic
1023533676 7:41185437-41185459 AAATTAAGACTGATTTTGGAGGG + Intergenic
1024141986 7:46470908-46470930 AAATTAAAGCAAAGTGTTGGAGG + Intergenic
1025157513 7:56621587-56621609 AAATTAAGGCAGTTTGGGAAGGG - Intergenic
1025758235 7:64366358-64366380 AAATTAAGGCAGTTTGTGAAGGG + Intergenic
1025969205 7:66306651-66306673 AAAAGCAGGCAGATTGTGGAGGG - Intronic
1027500020 7:78938554-78938576 AACTAAAGGCTGAGTGGGGAAGG + Intronic
1027510021 7:79068740-79068762 AATTTAAAGCAGTGTGTGGAGGG - Intronic
1028608542 7:92682283-92682305 CAATGAAGGCAGAGAGTGGGTGG - Intronic
1030182485 7:106724601-106724623 AATTTAAAGCAGTGTGTAGAGGG + Intergenic
1030382141 7:108824489-108824511 GAATTCAGGCAGAGTTTGGCTGG + Intergenic
1031513629 7:122677015-122677037 GAATGTACGCAGAGTGTGGAGGG - Intronic
1031590995 7:123592436-123592458 CATTTAAAGCAGTGTGTGGAGGG - Intronic
1032855825 7:135832714-135832736 CATTTAAGGCTGAGTGGGGAGGG + Intergenic
1033566835 7:142586962-142586984 AAATTAAGGAAGGGAGTGGTAGG + Intergenic
1033911336 7:146267063-146267085 AAATAAAGGGAGATTGAGGATGG + Intronic
1034685887 7:152971095-152971117 AAAGCAGGGCAGTGTGTGGATGG - Intergenic
1035248798 7:157582988-157583010 AAATAAAATCAGTGTGTGGAAGG + Intronic
1035540326 8:430100-430122 AAATAAAGACAGAATATGGAAGG - Intronic
1036510260 8:9393405-9393427 CAATTAAGACACAGTGGGGATGG + Intergenic
1036912509 8:12768911-12768933 ACAGTCAGGCAGAGTGTGGCAGG + Intergenic
1036955545 8:13184450-13184472 CATTTAAAGCAGAGTGTAGAGGG - Intronic
1038574460 8:28692858-28692880 AAAATTAGGCAGAGTGTTGATGG - Intronic
1039146077 8:34448888-34448910 CAATTAAAGCAGTGTGTAGAGGG - Intergenic
1039169901 8:34732108-34732130 AATTTATGGCAGAGTGTGGGTGG - Intergenic
1039342760 8:36669533-36669555 TATTTAAGGCAGTGTGTAGAGGG - Intergenic
1039387240 8:37146988-37147010 ACATTAAGGCTGAGTATGGAGGG + Intergenic
1040629265 8:49190808-49190830 AAAGAAAGGGAGAGTGGGGAGGG - Intergenic
1041997965 8:64086643-64086665 CATTTAAGGCAGTGTGTAGAGGG + Intergenic
1042010839 8:64242949-64242971 CATTTAAGGCAGTGTGTAGAGGG + Intergenic
1042054393 8:64748563-64748585 AAGCTAAGGGAGAGTGTGGGAGG - Intronic
1042397404 8:68307989-68308011 GAAGTAGGGCAGAGTGGGGAGGG + Intronic
1042657058 8:71111208-71111230 CAATTATGGCAGAATGTGAAAGG + Intergenic
1043558913 8:81467786-81467808 AGTTTAAGGGAGAGGGTGGAAGG + Intergenic
1043688431 8:83117870-83117892 AAAATAAAGCAGTGTGTAGAGGG - Intergenic
1044011152 8:86995526-86995548 AAATTCAGGTAGAGTTTTGAAGG + Intronic
1044080133 8:87873182-87873204 AAATCAAGGCAGCGGGTGGAAGG - Exonic
1044808796 8:96036265-96036287 CATTTAAGGCAGTGTGTAGAGGG - Intergenic
1044868794 8:96598333-96598355 AAAATAAGGCTGGGTGTGGTGGG + Intronic
1044956342 8:97485261-97485283 CATTTAAGGCAGTGTGTAGAGGG - Intergenic
1045181745 8:99791766-99791788 AAACAAAGGCAGATTTTGGAGGG + Intronic
1045642334 8:104264754-104264776 CAATTAAAGCAGTGTTTGGAAGG - Intergenic
1045673380 8:104582034-104582056 AAATTAAGTCAGATTATGAAAGG + Intronic
1046041443 8:108910948-108910970 GAAATAAGGGAAAGTGTGGAAGG - Intergenic
1046162807 8:110389340-110389362 CATTTAAGGCAGTGTGTAGAGGG - Intergenic
1046195350 8:110856706-110856728 ACATGAGGGCAGAGGGTGGAAGG + Intergenic
1046878974 8:119287473-119287495 CAATTAAAGCAGTGTGTAGAGGG - Intergenic
1046881165 8:119309757-119309779 CAATTAAAGCAGTGTGTAGAGGG + Intergenic
1048086373 8:131185309-131185331 CAATTATGGCAGAATGTGAAGGG - Intergenic
1049875546 8:145016981-145017003 CAATTAAAGCAGTGTGTAGAGGG - Intergenic
1050131203 9:2414581-2414603 AGATTCAGGCAGACTCTGGATGG - Intergenic
1050140265 9:2510310-2510332 AAATTAAGGGAGAGATTGAAAGG - Intergenic
1050387274 9:5103907-5103929 TATTTAAGGCAGTGTGTAGAGGG + Intronic
1050402604 9:5271791-5271813 CAATTATGGCAGAGGGTGAAAGG - Intergenic
1051362358 9:16292452-16292474 AATTCAAGGCAGATTTTGGAGGG + Intergenic
1055087433 9:72328347-72328369 AAATGGAGGCAGAGATTGGAGGG + Intergenic
1055103984 9:72493457-72493479 CATTTAAGGTAGAGAGTGGATGG - Intergenic
1055338426 9:75256846-75256868 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1057715967 9:97496466-97496488 AAATAAAGGTACAGTGTGGCAGG - Intergenic
1058096707 9:100869792-100869814 CATTTAAAGCAGAGTGTAGAGGG + Intergenic
1058329801 9:103745644-103745666 AAATTAAGGCGCAGTCTGGGGGG + Intergenic
1058565720 9:106283043-106283065 AAAGGAATGCAGAGTGTGCAGGG + Intergenic
1061868765 9:133509089-133509111 AAATTAAGTCAGAGGCTGGCTGG - Intergenic
1062031243 9:134362995-134363017 TAATTTGGGGAGAGTGTGGACGG + Intronic
1186278043 X:7961533-7961555 AAATTAAGGCAGAGCACGGCAGG + Intergenic
1186423350 X:9444065-9444087 AAATGAAGGAAGAGTGGGGAGGG - Intergenic
1186950982 X:14624502-14624524 CATTTAAAGCAGTGTGTGGAGGG - Intronic
1187768457 X:22669082-22669104 AAATTAGGGCTGAGAGTGGTAGG - Intergenic
1188109421 X:26179690-26179712 AATTTAAAGCAGTGTGTAGAGGG - Intergenic
1188109766 X:26183188-26183210 AATTTAAAGCAGTGTGTAGAGGG + Intergenic
1189199779 X:39183519-39183541 AATTTAAAGCAGTGTGTAGAGGG - Intergenic
1189549243 X:42076198-42076220 ACCTTAAGGCTGAGTGTGGTGGG + Intergenic
1189770756 X:44424477-44424499 CATTTAAAGCAGAGTGTAGAGGG - Intergenic
1190033310 X:46995809-46995831 TACTTAAGGCAGAGTGTGAGAGG - Intronic
1190079802 X:47347376-47347398 AAAAGAAGGAAGAGTGGGGAGGG - Intergenic
1191788021 X:64937773-64937795 CAATTAAAGCAGTGTGTAGAGGG + Intronic
1191901350 X:66043867-66043889 AAGCTAAGCCAGATTGTGGAGGG + Intergenic
1192038902 X:67596129-67596151 AAATTATGGCAGAAGGTGAAGGG - Intronic
1192423875 X:71058519-71058541 AAATTAAGGCTGAATGTGGTTGG - Intronic
1193001819 X:76571018-76571040 CAATTAAAGCAGTGTGTAGAGGG + Intergenic
1193992016 X:88320022-88320044 TATTTAAAGCAGAGTGTAGAGGG - Intergenic
1194047037 X:89020803-89020825 AAATGAAGGTAGAGTCTGGTGGG + Intergenic
1194503938 X:94709554-94709576 CAATGAAGGCAGAGGGTGAAAGG + Intergenic
1194944314 X:100049448-100049470 CAATTATGGCAGAATGTGAAGGG - Intergenic
1195661094 X:107379171-107379193 CAACTAAGGCAGTGTGTAGAGGG - Intergenic
1195774529 X:108388867-108388889 ACATTAAAGCAGTGTGTAGAGGG - Intronic
1196001872 X:110795487-110795509 AAATGCAGGCCGAGTGGGGAGGG + Intronic
1196134649 X:112195108-112195130 AGGTTGAGGCAGAATGTGGATGG + Intergenic
1196385993 X:115151850-115151872 AAACTAAGGCAGAGTCTAGCAGG + Intronic
1196704231 X:118703011-118703033 AAAAGAAAGCAGGGTGTGGAAGG + Intergenic
1197113702 X:122806269-122806291 AAAAGTAGGCAGAATGTGGAAGG + Intergenic
1197608835 X:128615979-128616001 GCATTTGGGCAGAGTGTGGAGGG + Intergenic
1198434894 X:136607553-136607575 AAAGTAGGGCAGGGGGTGGAGGG + Intergenic
1198955258 X:142122289-142122311 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1199917892 X:152364035-152364057 TAATTAAGGCAGTATCTGGAGGG + Intronic
1200413030 Y:2880154-2880176 AAATTAAATCTGAGTTTGGATGG + Intronic
1200732306 Y:6755808-6755830 CAATTAAAGCAGTGTGTAGAGGG - Intergenic
1201262335 Y:12171960-12171982 CATTTAAGGCAGTGTGTAGAGGG + Intergenic
1201596366 Y:15674116-15674138 CAATTAAAGCAGTGTGTAGAGGG - Intergenic
1201602362 Y:15745490-15745512 AAATTAAAGCAGTGTGAAGAGGG - Intergenic
1201684543 Y:16686172-16686194 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1201984458 Y:19950475-19950497 AACTGAGGGCAGAGGGTGGAAGG - Intergenic
1202180913 Y:22139126-22139148 CAATTAAGGGAATGTGTGGATGG + Intergenic
1202210447 Y:22447274-22447296 CAATTAAGGGAATGTGTGGATGG - Intergenic
1202253714 Y:22899137-22899159 CATTTAAGGCAGTGTGTAGAGGG - Intergenic
1202406704 Y:24532886-24532908 CATTTAAGGCAGTGTGTAGAGGG - Intergenic
1202464077 Y:25137195-25137217 CATTTAAGGCAGTGTGTAGAGGG + Intergenic