ID: 1184028705

View in Genome Browser
Species Human (GRCh38)
Location 22:41878012-41878034
Sequence GAGCGTCTTTGTGAAGCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184028702_1184028705 18 Left 1184028702 22:41877971-41877993 CCTACTCTTCTCTTATGGCTGGT 0: 1
1: 0
2: 1
3: 15
4: 177
Right 1184028705 22:41878012-41878034 GAGCGTCTTTGTGAAGCTGCTGG 0: 1
1: 0
2: 0
3: 14
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184028705 Original CRISPR GAGCGTCTTTGTGAAGCTGC TGG Exonic
902942959 1:19813766-19813788 GATGGTGTTTCTGAAGCTGCAGG - Intergenic
903128101 1:21261331-21261353 GAAAGTCTTTGTGAAGGAGCTGG - Intronic
903968778 1:27105878-27105900 CACCGTCTTTGTGCAGGTGCTGG - Exonic
904744803 1:32703836-32703858 GAGTGTCTTTGTGGGGCTGGCGG + Intergenic
908714318 1:67053881-67053903 GACCGTGTTTCTGAAGCTGCTGG - Exonic
910738985 1:90494684-90494706 GAGGGTCTTGCTGCAGCTGCTGG + Intergenic
916323963 1:163536436-163536458 GAGGAACTTTGTGAAGCAGCAGG + Intergenic
917668456 1:177248622-177248644 GTGCTTCTGTGTGCAGCTGCTGG + Intronic
920047354 1:203141930-203141952 GAGTGTCTCTGTAAAGCAGCAGG - Intronic
920202188 1:204266399-204266421 GAGAGTCTTTGGGAAGCAGTGGG - Intronic
920399791 1:205669682-205669704 GAGCGTCTTTGTGAGTGTGCAGG - Intronic
921937759 1:220810546-220810568 GAGCTGCTTTGTGAAAGTGCAGG - Intronic
922678198 1:227566208-227566230 GAGCCTCTCAGTGAAGCAGCTGG + Intronic
924173670 1:241367351-241367373 GAGTGTCTTGATGAAGCTGAAGG + Intergenic
1064159114 10:12928806-12928828 GAGCGTCTTTGGAGAGATGCTGG - Intronic
1064528228 10:16280747-16280769 CAGCCTATTTGAGAAGCTGCAGG + Intergenic
1071093710 10:81949242-81949264 GAGCGTCTTTGTTTACCTGAGGG - Intronic
1071127886 10:82356711-82356733 GAGGGTCTGTGTGAATCTGAAGG + Intronic
1071259755 10:83909165-83909187 GAGCCCCATTGTGAAGCTGTCGG + Intergenic
1072414770 10:95238089-95238111 TGGTGTGTTTGTGAAGCTGCGGG - Exonic
1072755594 10:98018839-98018861 GGGTGTCTTTGTGGAGCTGGTGG - Intronic
1073449035 10:103598710-103598732 GAGCTGCTTTGTGATGCTGAAGG - Exonic
1082976711 11:59079939-59079961 GAGTGTCTGTGGGAGGCTGCTGG - Intergenic
1083284871 11:61651895-61651917 GAGGGTCTTCTTGAACCTGCAGG - Intergenic
1083884450 11:65565143-65565165 GAATGTCTTTGGGAAGCTTCTGG + Intergenic
1087136264 11:94723544-94723566 CAGAGTATTTGTGAAGCTGCTGG - Intronic
1091277493 11:134362425-134362447 GAGCCTCTTTCCTAAGCTGCTGG - Intronic
1093399517 12:18727592-18727614 GAGAATGTTAGTGAAGCTGCGGG + Intronic
1095796718 12:46226994-46227016 GCACGTCATTGTGAAACTGCAGG + Intronic
1102990427 12:117311737-117311759 GTCCGTCTTTATGAAGCAGCAGG - Intronic
1108674021 13:52721034-52721056 CAGCGGCTTTGAGGAGCTGCTGG + Intronic
1108870324 13:54976651-54976673 GAGCGTCTTTGGTAGGCTGCTGG + Intergenic
1115448971 14:33524351-33524373 GAGGGACTTTTTGAAGGTGCTGG - Intronic
1123220726 14:106852887-106852909 GAGCATGTTTGGGAAGATGCTGG - Intergenic
1202946175 14_KI270726v1_random:29014-29036 CACTGTCTTTGTGAAGCTTCAGG - Intergenic
1124125834 15:26937533-26937555 GTGCCTCTGTGTGCAGCTGCAGG - Intronic
1125769515 15:42155859-42155881 GAGCGTCTGAGGGGAGCTGCAGG - Intronic
1128785970 15:70397681-70397703 GGGCTTCTATGTGAGGCTGCTGG - Intergenic
1129238636 15:74239043-74239065 GAAAGTCCTTGTGAAACTGCTGG + Intronic
1129457905 15:75685434-75685456 GGGCGTCCTTGTGGAGCTGGAGG - Exonic
1129606469 15:77027684-77027706 GAGGGTCACTGTGAAGCAGCAGG + Intronic
1131097298 15:89664170-89664192 GTGCATATTTCTGAAGCTGCAGG + Intergenic
1138098229 16:54230526-54230548 GAGCTTCTTTGACAAGCTCCTGG - Intergenic
1140214589 16:72997145-72997167 GAACCTGTTTGTGAAGCTGCAGG - Intronic
1141915634 16:87094614-87094636 CAGAGTGGTTGTGAAGCTGCAGG + Intronic
1148110745 17:45143736-45143758 AAGCGTCCCTGTGAAGCTGCAGG - Exonic
1148865146 17:50624406-50624428 GTGCATCTTTGGGAAGCTGCAGG - Exonic
1153351569 18:4086181-4086203 GAAGGACTTTGGGAAGCTGCTGG + Intronic
1155041662 18:22070065-22070087 ACGCCACTTTGTGAAGCTGCTGG - Intergenic
1161089517 19:2352990-2353012 CAGAGTCTTTGGGAGGCTGCGGG - Exonic
1162731337 19:12720917-12720939 GTGAGTCTTTGAGCAGCTGCAGG + Exonic
1167233269 19:48298215-48298237 GAGCCTCATTGAGAAGCGGCTGG - Exonic
1167531274 19:50018728-50018750 GAGCATTTTTGTGAAGCTAGAGG + Intronic
925066635 2:932941-932963 AAGCGTCTTAATGAAGCCGCCGG + Intergenic
925558246 2:5156292-5156314 AAGCATCTTTGTGAAGGTACTGG + Intergenic
934025993 2:88001973-88001995 GAGGGTCATTGTGAAGTGGCAGG - Intergenic
937050008 2:118880915-118880937 GACTGACTTTGTGAACCTGCAGG + Intergenic
937966040 2:127511665-127511687 GAGTGTCTTTTTTATGCTGCAGG - Intronic
939017534 2:136919880-136919902 GACCGGCTCTGTGAGGCTGCAGG + Intronic
943771759 2:191725167-191725189 CATCTTCTTTGTGAAGCTGGTGG + Intergenic
945270241 2:207930955-207930977 GAGCCTATTTGTTCAGCTGCCGG - Exonic
945549640 2:211204875-211204897 GAGAGTTCTTGTGAAGCTGTGGG - Intergenic
949045917 2:241872592-241872614 GAGGGTGTTGGTGAAGATGCTGG - Exonic
1176255039 20:64147246-64147268 GACCTTCTTTGAGAAGCTGGGGG - Intergenic
1184028705 22:41878012-41878034 GAGCGTCTTTGTGAAGCTGCTGG + Exonic
1184071490 22:42150184-42150206 GGGCCACTTTGTGAAGCTGGAGG - Intergenic
1184376852 22:44119076-44119098 GAGGATCATTGTGAAGCAGCTGG + Exonic
949483668 3:4517409-4517431 GAGGTTCTTGGAGAAGCTGCTGG - Intronic
950853993 3:16088466-16088488 GAAGGTCTCTGTGAAGATGCAGG + Intergenic
950892789 3:16419542-16419564 GAGCATCTCTGGGAAGGTGCAGG - Intronic
953481937 3:43259329-43259351 GAGCTTCTTTGGGAAGGGGCTGG - Intergenic
955791985 3:62597598-62597620 GAGCATCTTTGGGTAGCAGCAGG - Intronic
958801162 3:98757592-98757614 GAGAGTCTTTGTGATGCTCCTGG + Intronic
959018987 3:101167994-101168016 GAGTGTTTTTCTAAAGCTGCTGG - Intergenic
963015691 3:140821885-140821907 GGGCTTCTTTGTGCAGCTTCAGG + Intergenic
963787902 3:149553755-149553777 GAGTGTCTGGGTGCAGCTGCGGG + Intronic
966160797 3:176966187-176966209 GTGTGTCTGTGTGAATCTGCAGG + Intergenic
966880748 3:184349089-184349111 GAGTGATTATGTGAAGCTGCAGG - Intronic
976130787 4:81881949-81881971 GGGCGTCTTTGTGAAGTTAAGGG - Intronic
976987772 4:91324805-91324827 GAGCATCTTTGGGGAACTGCTGG + Intronic
980887520 4:138779452-138779474 GAGAGCCTTTGGGAAGCCGCTGG - Intergenic
981684933 4:147443216-147443238 GAGCTTCTTGGTGAAGCTAGGGG - Intergenic
984960571 4:185093593-185093615 GAGCGTCTTTGTTTACCTGGGGG + Intergenic
994522296 5:100855266-100855288 AAGTGTCTTTGTGAACCTGAGGG + Intronic
994862591 5:105217425-105217447 TAGCGTCTTTCAGATGCTGCAGG + Intergenic
996899147 5:128523726-128523748 GAGGGTTTTGGTGGAGCTGCTGG - Intronic
997294561 5:132761588-132761610 CTGCGACTTCGTGAAGCTGCGGG - Exonic
997372028 5:133368115-133368137 GAGCATCTTTGTTTAGCTGGGGG + Intronic
999823256 5:155249544-155249566 GCTTGTCTTTGTGAACCTGCTGG + Intergenic
1000334461 5:160231800-160231822 GAGTGTGTTTGTGAAGCTCCTGG - Intronic
1001031932 5:168269458-168269480 GAGGGGCTTTGTGGAGCAGCTGG - Intergenic
1001638607 5:173230073-173230095 GAGCGCCTTGGGAAAGCTGCAGG + Intergenic
1004317868 6:14606440-14606462 GAGCTCCTTCGTGCAGCTGCTGG + Intergenic
1005336674 6:24803597-24803619 GGGCTTCTTTGTGATGATGCTGG + Intronic
1005437155 6:25826476-25826498 GAGCTTCTTTGTGGAGGTGTTGG + Exonic
1006378190 6:33683376-33683398 GAACATCATTGAGAAGCTGCAGG + Exonic
1008070634 6:47095582-47095604 GAGCCTCTCTGTGGAGCTGCTGG - Intergenic
1010792138 6:80076895-80076917 GAGGGTCTTTCTTAAGCTGCTGG - Intergenic
1014371445 6:120613745-120613767 AAGTGTCTTTGTTAAGCTGAGGG - Intergenic
1016437647 6:144053868-144053890 CAGCCTCTTTAAGAAGCTGCAGG + Intronic
1017959765 6:159211202-159211224 GACCATCTTTGTGAAGTTGGTGG + Intronic
1018260581 6:161966748-161966770 GAGGTTTTTTGTGAAGCTGCAGG - Intronic
1019845632 7:3497489-3497511 GAGTGAGTTTGTGAAGCAGCAGG + Intronic
1022795396 7:33727704-33727726 GAGCATGTTTGTGTGGCTGCAGG - Exonic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1026470763 7:70693111-70693133 GAGGGACCTTGTCAAGCTGCAGG + Intronic
1029207386 7:98878102-98878124 GAGGGTCTTTGGGAAGGTGACGG - Intronic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1030678899 7:112413503-112413525 GAGCTGTTTTGTGAGGCTGCAGG + Intergenic
1037841905 8:22250814-22250836 GAGGGTCTGTGTGAAGGGGCCGG + Exonic
1040810667 8:51449037-51449059 GAGTGGCTCTGTGAAGCTGACGG - Exonic
1044740650 8:95323002-95323024 GGGTGTCTTTGGGCAGCTGCTGG + Intergenic
1045697329 8:104824396-104824418 TAGTGTCTCTGTGAATCTGCAGG + Intronic
1046690207 8:117275281-117275303 CAGAGACTTTGTGAAGCTTCTGG + Intergenic
1048953526 8:139515247-139515269 GAGCCTTTTGGTGAAGCTGTGGG - Intergenic
1051171799 9:14325331-14325353 AAGTGTATTTGTGAAGCTTCTGG - Intronic
1058911972 9:109529218-109529240 GAACCACTTTGAGAAGCTGCTGG - Intergenic
1061138933 9:128752761-128752783 GAGCCTCTTTGTGCAGAAGCTGG - Exonic
1061284328 9:129613568-129613590 GAGCGTCATTGTGAACCAGAAGG - Exonic
1061902423 9:133679825-133679847 GAGGGTCTTTGGGCAGCGGCAGG + Intronic
1062609987 9:137369297-137369319 GAGCCCTTGTGTGAAGCTGCGGG - Intronic
1062644874 9:137542731-137542753 CATCGTCTTTGTGCAGCTGCAGG - Exonic
1203782963 EBV:111125-111147 GACCCTCTATGTAAAGCTGCCGG - Intergenic
1185721999 X:2389631-2389653 GAGCATCCTTGTGCAGCTGTTGG - Intronic
1186987493 X:15032686-15032708 TTGCATCTGTGTGAAGCTGCTGG - Intergenic
1196812149 X:119637157-119637179 CTGCGACTTTGTGAAGCTGCGGG - Exonic