ID: 1184029035

View in Genome Browser
Species Human (GRCh38)
Location 22:41880253-41880275
Sequence GTCTAAAAGCTACTGCTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184029031_1184029035 22 Left 1184029031 22:41880208-41880230 CCTAAAGGATCATGCAGTTCATC No data
Right 1184029035 22:41880253-41880275 GTCTAAAAGCTACTGCTGGCCGG 0: 1
1: 0
2: 0
3: 12
4: 170
1184029030_1184029035 30 Left 1184029030 22:41880200-41880222 CCTGAAAGCCTAAAGGATCATGC 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1184029035 22:41880253-41880275 GTCTAAAAGCTACTGCTGGCCGG 0: 1
1: 0
2: 0
3: 12
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184029035 Original CRISPR GTCTAAAAGCTACTGCTGGC CGG Intronic
901811742 1:11771345-11771367 ATTTAAAAGCTATTGCTGGGGGG - Intronic
902530126 1:17085569-17085591 GTCCAAAAGTTTCTGCTGCCGGG - Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910451103 1:87346331-87346353 GTATAACAGCTAGTGCTGGAAGG + Exonic
911101087 1:94096298-94096320 TTCTAAAAGCTACCGCTCGGGGG + Intronic
911195396 1:94989574-94989596 GTAGCAAAGGTACTGCTGGCAGG + Intronic
911328716 1:96500475-96500497 ATATAAAACCTAGTGCTGGCAGG - Intergenic
912789273 1:112635733-112635755 TTTTAAAAGCTAGTGATGGCTGG + Intronic
913012836 1:114701487-114701509 GTTTAAAAACTACTAGTGGCTGG + Intergenic
913119443 1:115726274-115726296 GTCAAAAAACTACAGCTGGTGGG + Intronic
913612920 1:120525790-120525812 GTCTCTAAGATTCTGCTGGCAGG + Intergenic
914737233 1:150429370-150429392 GTTAAAAAGCCACTACTGGCTGG - Intronic
916730485 1:167562366-167562388 GTTTAATAGACACTGCTGGCCGG - Intergenic
917609367 1:176670855-176670877 CTCCAAAAGGTAATGCTGGCTGG + Intronic
917840369 1:178972744-178972766 GTCAAAAAGCTACAGGGGGCTGG + Intergenic
918328974 1:183438040-183438062 GTCAAAAATCAACTGATGGCTGG - Intergenic
924509283 1:244715349-244715371 GACTAAAAGTTTCTGCTGGTAGG - Intergenic
1064066323 10:12185205-12185227 GTCTAAAAACTCCTGGGGGCTGG + Intronic
1067792355 10:49297980-49298002 GTCTGAATGCTCCTGCTGGTTGG + Intergenic
1067930748 10:50559034-50559056 GTCTCAAAGCTGCTGCAGACTGG + Intronic
1068600001 10:58946767-58946789 TTCTGAAACCTACTGCAGGCAGG + Intergenic
1068991157 10:63152431-63152453 CTCTAAAAGGTACATCTGGCTGG - Intronic
1069455793 10:68552805-68552827 TTTTAAAACCTATTGCTGGCTGG + Intergenic
1072224414 10:93355295-93355317 GTTTAAAATTCACTGCTGGCTGG + Intronic
1073443400 10:103565947-103565969 ATTTAAAAGCTACAACTGGCTGG - Intronic
1077403748 11:2372621-2372643 GTCAAAAATCAACTGATGGCCGG + Intergenic
1077524970 11:3058607-3058629 TTCTAAATTCTACTGGTGGCTGG + Intergenic
1080023477 11:27588951-27588973 GTCAAAAAACAAATGCTGGCAGG - Intergenic
1082293313 11:50408278-50408300 GTCTAAAAGTTCCTGATGACAGG - Intergenic
1083901722 11:65646626-65646648 GTCTTGCAGGTACTGCTGGCGGG - Exonic
1085531421 11:77194376-77194398 GTCTACAAAGTACTGCTGGGAGG - Exonic
1086591170 11:88515813-88515835 GTCTAGAAGCTGCTGCAGTCAGG + Intronic
1090826124 11:130387700-130387722 GTCTAAAAGCTTCTCAAGGCTGG - Intergenic
1094004649 12:25736745-25736767 GTCCAAAACCTATTGCTGGAAGG + Intergenic
1094320230 12:29174714-29174736 TTCTAAAAGCCACTCCTGGCCGG - Intronic
1094369322 12:29719455-29719477 GTATAAAACCTTATGCTGGCTGG + Intronic
1094636881 12:32235025-32235047 GTCTATAATCTACTGTAGGCTGG - Intronic
1102992896 12:117327579-117327601 GTCTTCAAGATTCTGCTGGCTGG - Intronic
1103813212 12:123632648-123632670 TTGAAAAAGCTACTGGTGGCCGG + Intronic
1104997417 12:132667234-132667256 GTCAGCAAGCTACAGCTGGCTGG - Intronic
1106004481 13:25756083-25756105 GGCTGAGAGCTAGTGCTGGCTGG - Intronic
1110185860 13:72674134-72674156 GTCTAAGAGATAATGGTGGCAGG - Intergenic
1111908689 13:94285621-94285643 GTCTGAAAGCTACTGTGGCCTGG - Intronic
1115548237 14:34482148-34482170 GTCTAAGAGGTACAGCTGGCTGG + Intergenic
1116728209 14:48589348-48589370 GTCTAAAAGTCCCTGATGGCCGG + Intergenic
1117180658 14:53187955-53187977 GTCTAAAAACTACTGATGTGTGG - Intergenic
1117805877 14:59490216-59490238 GTTTAAAAGATCCTGGTGGCTGG - Intronic
1120051372 14:79870677-79870699 TTATAAAAGCTATTGCCGGCCGG - Intergenic
1120878523 14:89396536-89396558 ATCAAGAAGCCACTGCTGGCTGG + Intronic
1121433156 14:93901500-93901522 GGTTAAAAACTTCTGCTGGCAGG + Intergenic
1126543834 15:49851351-49851373 GTCAAAAAACAAATGCTGGCAGG + Intergenic
1127567723 15:60209345-60209367 GTTTAAAAACCACTGCTGGCCGG + Intergenic
1128139682 15:65290065-65290087 CTTGAAAAGCTCCTGCTGGCCGG - Intronic
1135861168 16:26057456-26057478 CTCTAAAAGCTGGTGCAGGCTGG + Intronic
1136237435 16:28923654-28923676 TTCTAACAGCTGCTGGTGGCTGG - Intronic
1139335255 16:66226749-66226771 GTCTAAAATATCCTGCTGCCTGG + Intergenic
1141073236 16:80977773-80977795 GTCAAAAGGCTACTTCAGGCCGG + Intronic
1141588792 16:85053317-85053339 GTCTAAAAGATGCCTCTGGCTGG - Intronic
1142373888 16:89697113-89697135 GTGGAAAGGCTCCTGCTGGCCGG + Exonic
1142707147 17:1702644-1702666 ATCAAAAAGCAACTCCTGGCTGG - Intergenic
1145105889 17:20116382-20116404 GTAAGAAAGCTACTGATGGCCGG - Intronic
1145886017 17:28383075-28383097 ATCAAAAAGAGACTGCTGGCTGG + Intronic
1148138767 17:45313117-45313139 GTCTAAAAGCTTCAGCTCTCGGG - Intronic
1148240106 17:45994697-45994719 TTCTAAAAACTGGTGCTGGCTGG + Intronic
1149366171 17:55947065-55947087 CTTTAATAGATACTGCTGGCCGG + Intergenic
1153917916 18:9762102-9762124 TTATAAAAGGTACTGGTGGCCGG - Intronic
1155461158 18:26085399-26085421 GTCTAATATCTACTGCTCACAGG + Intronic
1155480886 18:26286304-26286326 CTCCAAAAGTTACTGCTGGAAGG - Exonic
1156859356 18:41818141-41818163 GACTACAAGCTACTCCTGGTGGG + Intergenic
1158053309 18:53250153-53250175 GTCTTAAAGCTACTTCTTGAGGG - Intronic
1160375419 18:78407715-78407737 GTCTAAAAGGAGCTGTTGGCAGG + Intergenic
1162478362 19:10914208-10914230 CTCCAAAAGCCACAGCTGGCTGG - Intronic
1162580499 19:11527014-11527036 GTTTAAAAGCTCCCTCTGGCTGG - Intronic
1163438859 19:17311449-17311471 CTTTAAAAGCTCCTTCTGGCCGG - Intronic
1163808992 19:19418685-19418707 TTCTAACAGCTGCTGCTTGCTGG + Intronic
1165880906 19:39042573-39042595 GACTAAAAGCAACGGCTGGATGG + Intergenic
1165888822 19:39098716-39098738 GACTAGAAGCTACCACTGGCCGG + Intronic
1166146052 19:40836376-40836398 GTTTAAAAGATACTTCTGGCTGG - Intronic
1166150155 19:40867310-40867332 GTTTAAAAGATACTTCTGGCTGG - Intronic
1166888893 19:45977851-45977873 GTTGAAATGATACTGCTGGCTGG + Intergenic
1167595007 19:50422884-50422906 GGCTAAAAGCGGCTGCTGCCGGG - Exonic
926111375 2:10186449-10186471 GTTTGAAAACCACTGCTGGCCGG - Intronic
927802046 2:26110038-26110060 TTCTAAAAGTTAATGTTGGCCGG + Intronic
931633637 2:64322879-64322901 GTTTAAAAGCTTCTCCAGGCAGG + Intergenic
932394568 2:71432495-71432517 GTCTAAAATATACCTCTGGCTGG - Intronic
933991063 2:87634245-87634267 GTCTAAAACCTAGAGCTGCCTGG + Intergenic
936226956 2:110663730-110663752 GTTTAAAAGCAGATGCTGGCCGG + Intronic
936302776 2:111316578-111316600 GTCTAAAACCTAGAGCTGCCTGG - Intergenic
939338469 2:140862220-140862242 GCCTAAAGGCTAATACTGGCCGG + Intronic
939885120 2:147673009-147673031 GTCTAAAAGCTCTTGCTTGCTGG - Intergenic
940305168 2:152217578-152217600 TTCTAAAATCCACTTCTGGCAGG - Intergenic
942220278 2:173762493-173762515 TTTTAAAAGCTACTGATGCCTGG - Intergenic
942369706 2:175270468-175270490 TTCTAAATGCTACTGCTGAAAGG + Intergenic
944714731 2:202367293-202367315 GTCTCAAAAGTACTGTTGGCCGG - Intergenic
945618124 2:212098982-212099004 ATTAAAAGGCTACTGCTGGCTGG + Intronic
947203348 2:227637034-227637056 ATCTAAAAGCAATTGCAGGCTGG + Intergenic
1170225142 20:13983815-13983837 TTTTAAAAGCTAGTGCTGGCGGG - Intronic
1170939288 20:20835175-20835197 TTTTAAAAGCTTCTGATGGCTGG - Intergenic
1172454112 20:35052786-35052808 GTTTAAAAAGTACTGTTGGCCGG - Intronic
1177931297 21:27287301-27287323 TACTAAAAGCAACTGCTGGTTGG - Intergenic
1182632075 22:31694364-31694386 GTTTAAAAGTTGCTGCTGGCCGG - Intronic
1184029035 22:41880253-41880275 GTCTAAAAGCTACTGCTGGCCGG + Intronic
1184753945 22:46505880-46505902 GTCAAAAAGAAACTACTGGCTGG + Intronic
950870850 3:16227451-16227473 GTCAAAACGCCACTGCTGGCGGG - Exonic
955053667 3:55437302-55437324 GTCTCAAAGCTATTGCAGGAGGG + Intergenic
957300240 3:78382317-78382339 GTTTAAAAGCTACTGATTGAAGG + Intergenic
961184403 3:124902059-124902081 GTATAAAAGTTACTGATGCCTGG - Intergenic
961402536 3:126657274-126657296 CTGCAAAAGCTACTGCTGTCAGG - Intergenic
962418276 3:135203629-135203651 GTCTGAAAGCTAAACCTGGCTGG - Intronic
962474504 3:135743451-135743473 TACTTAAAGATACTGCTGGCTGG + Intergenic
962734156 3:138309386-138309408 GTATAAAACCCACTGTTGGCTGG + Intronic
963147826 3:142012841-142012863 TTTTAAAAGCTACTGTTGCCAGG + Intronic
964105550 3:153035568-153035590 GGTTAAAAGCAAATGCTGGCTGG - Intergenic
966406912 3:179607548-179607570 TTTTAAAGGCTACTGCTGCCAGG - Intronic
967902273 3:194466856-194466878 GTCTAAAAGCTTCAGATGGGTGG - Intronic
968092146 3:195905493-195905515 GTCAAAAATCAATTGCTGGCTGG - Intronic
969411102 4:7028724-7028746 GTATAAAAGTTACTGATGCCTGG - Intronic
970789483 4:19839753-19839775 GTATAAAAGATACTCTTGGCCGG - Intergenic
971317885 4:25582502-25582524 GACTCAAAGCTGCTGCTGGTTGG + Intergenic
971795116 4:31217225-31217247 GTCTTGAAGCTGGTGCTGGCTGG + Intergenic
972786107 4:42328035-42328057 GTCTCATAGCTAGTGCTGGTTGG - Intergenic
973729338 4:53808646-53808668 CTCTAGAAGCTTCTGCTGGAGGG + Intronic
980948571 4:139348155-139348177 GTTTAAAAGTCACTGGTGGCCGG + Intronic
986570017 5:9154884-9154906 TTTTAAAAGATACTGCTGCCTGG - Intronic
988009731 5:25466794-25466816 GTCAGAAGGCTACTGTTGGCTGG + Intergenic
988511480 5:31868147-31868169 TTCTAAAAGCAGCTGTTGGCCGG + Intronic
991368252 5:65891466-65891488 ATCTAAAATCCACTCCTGGCTGG - Intergenic
992772032 5:80058030-80058052 GTCAAAAAGATAGGGCTGGCAGG + Intronic
996146539 5:119983810-119983832 GACTATAAGCTGCTGCTTGCTGG + Intergenic
996349499 5:122522890-122522912 ATTTAAAAGCCATTGCTGGCCGG - Intergenic
1000304004 5:159979570-159979592 GTCTAAAAGATGTGGCTGGCTGG + Intergenic
1000546280 5:162606988-162607010 GTTTAAAAACTACTACTGTCAGG - Intergenic
1003116429 6:3286743-3286765 CTCTAAAATCTACTGCTGGAAGG - Intronic
1003954681 6:11150597-11150619 TTTAAAAAGCAACTGCTGGCCGG - Intergenic
1008061298 6:46999799-46999821 GTCAAAAAGTTACTGGTGGGGGG - Exonic
1008670140 6:53759980-53760002 CTCTAAAAACTACTGATGCCTGG + Intergenic
1017149426 6:151264853-151264875 GTCTAAAAGTTTATGTTGGCCGG + Intronic
1020442404 7:8232298-8232320 GTCAAAGAGCTGCTGCTTGCTGG - Intronic
1020998810 7:15301140-15301162 ATTTAAAAGCAAATGCTGGCCGG + Intronic
1021283953 7:18756117-18756139 GTTTAAAAGTTACTGATGCCTGG - Intronic
1021788240 7:24174047-24174069 GTTTAAAATATACTGTTGGCCGG + Intergenic
1022199247 7:28100063-28100085 GTCTAAAATCTAATGTTGGAAGG + Intronic
1026081506 7:67225660-67225682 CTCTAAAAGCAACTGCTGCTGGG - Intronic
1026695571 7:72588348-72588370 CTCTAAAAGCAACTGCTGCTGGG + Intronic
1027256725 7:76435449-76435471 GTTTAAAAGCTACTTGAGGCTGG - Intronic
1027282126 7:76616558-76616580 GTTTAAAAGCTACTTGAGGCTGG + Intronic
1030760056 7:113339086-113339108 TTCTAAAAGTTAATGCAGGCCGG - Intergenic
1031439795 7:121779712-121779734 GTTTAAAAGATAATCCTGGCAGG - Intergenic
1034669869 7:152849775-152849797 ATCTAACATCTGCTGCTGGCAGG + Intronic
1035200434 7:157260822-157260844 GTCTAGAACCTACGTCTGGCAGG - Intronic
1037127633 8:15370025-15370047 CATTAAAATCTACTGCTGGCTGG - Intergenic
1038998873 8:32957368-32957390 GTATAAATGCTACTGCTGGTGGG - Intergenic
1040801921 8:51351518-51351540 GTCTAAGATCAAGTGCTGGCAGG - Intronic
1042944569 8:74142312-74142334 GCCTTAATGCTACTGCTTGCTGG + Intergenic
1043575160 8:81647965-81647987 ATCCAAAAGCAACTGTTGGCTGG - Intergenic
1044058319 8:87600191-87600213 GTTTATAAGCCACTACTGGCTGG + Intronic
1044472704 8:92588691-92588713 GACAAAAATCTACTGCTAGCAGG - Intergenic
1045457742 8:102398484-102398506 GTTAAAAAGCTTCTGCAGGCTGG + Intronic
1045558591 8:103238948-103238970 GTTTAAAAACTATTGCTGCCTGG + Intergenic
1047286173 8:123488995-123489017 GGATAAAACCTAATGCTGGCTGG - Intergenic
1047355040 8:124112306-124112328 GTCTAAATGATACTGCTGGGGGG - Intronic
1047420441 8:124703585-124703607 GTTTAAAACCTCCTGTTGGCTGG - Intronic
1051165641 9:14259602-14259624 GTTTAAAAGGTATTGGTGGCCGG + Intronic
1051476980 9:17518727-17518749 GTCTCAAAGCTTCTACTGGAAGG - Intergenic
1052801101 9:32969209-32969231 AGCTAAAAGCTTCTGCTTGCAGG + Intergenic
1052839129 9:33276603-33276625 GTCCAAAAGCAACAGCTGCCTGG + Intronic
1052988005 9:34502074-34502096 TTCTCCAAGCTGCTGCTGGCTGG + Intronic
1053296784 9:36921107-36921129 GTATAAAAGCTATGTCTGGCTGG - Intronic
1054931247 9:70637678-70637700 ATCTAACAACTACTACTGGCTGG + Intronic
1055664807 9:78542742-78542764 CTCCAACTGCTACTGCTGGCAGG - Intergenic
1056770785 9:89476609-89476631 GTCTAAAATATACAGCAGGCTGG - Intronic
1059440646 9:114304937-114304959 GTCTCCAAGCTCTTGCTGGCTGG + Intronic
1059629676 9:116107426-116107448 ATCAATAAGCTACTCCTGGCAGG + Intergenic
1060433418 9:123570548-123570570 GTAGAAAAGCTAATGCAGGCTGG - Intronic
1060532910 9:124358824-124358846 GTCTGCCAGGTACTGCTGGCTGG - Intronic
1061984218 9:134120117-134120139 CTATAAAAGATACTGTTGGCCGG + Intergenic
1188220809 X:27539143-27539165 GTACAAAAGTCACTGCTGGCGGG - Intergenic
1193650209 X:84122628-84122650 GTCCAAAAGCTTCCTCTGGCCGG - Intronic
1195156438 X:102127584-102127606 GTCAAAACGCTACTGGTAGCAGG - Exonic
1196661644 X:118276836-118276858 TTCTAAAAGCAATTTCTGGCTGG - Intergenic
1196882252 X:120208955-120208977 TCATAAAAGCTGCTGCTGGCCGG + Intergenic
1199999634 X:153052225-153052247 GGGTAAATGCTAATGCTGGCAGG - Intergenic
1201570305 Y:15406601-15406623 GTCTGAAAGCTACAACTGGGTGG + Intergenic