ID: 1184029211

View in Genome Browser
Species Human (GRCh38)
Location 22:41881625-41881647
Sequence CAGTGGTCCTAGAGGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 198}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184029198_1184029211 22 Left 1184029198 22:41881580-41881602 CCCAAGGAGGAGCCCCACCTGGG No data
Right 1184029211 22:41881625-41881647 CAGTGGTCCTAGAGGGAGCCAGG 0: 1
1: 0
2: 2
3: 13
4: 198
1184029200_1184029211 21 Left 1184029200 22:41881581-41881603 CCAAGGAGGAGCCCCACCTGGGG 0: 1
1: 1
2: 5
3: 37
4: 354
Right 1184029211 22:41881625-41881647 CAGTGGTCCTAGAGGGAGCCAGG 0: 1
1: 0
2: 2
3: 13
4: 198
1184029203_1184029211 10 Left 1184029203 22:41881592-41881614 CCCCACCTGGGGTGGCTCTTGAG 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1184029211 22:41881625-41881647 CAGTGGTCCTAGAGGGAGCCAGG 0: 1
1: 0
2: 2
3: 13
4: 198
1184029204_1184029211 9 Left 1184029204 22:41881593-41881615 CCCACCTGGGGTGGCTCTTGAGA 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1184029211 22:41881625-41881647 CAGTGGTCCTAGAGGGAGCCAGG 0: 1
1: 0
2: 2
3: 13
4: 198
1184029206_1184029211 5 Left 1184029206 22:41881597-41881619 CCTGGGGTGGCTCTTGAGAATAA No data
Right 1184029211 22:41881625-41881647 CAGTGGTCCTAGAGGGAGCCAGG 0: 1
1: 0
2: 2
3: 13
4: 198
1184029205_1184029211 8 Left 1184029205 22:41881594-41881616 CCACCTGGGGTGGCTCTTGAGAA 0: 1
1: 0
2: 2
3: 15
4: 143
Right 1184029211 22:41881625-41881647 CAGTGGTCCTAGAGGGAGCCAGG 0: 1
1: 0
2: 2
3: 13
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184029211 Original CRISPR CAGTGGTCCTAGAGGGAGCC AGG Intronic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901972299 1:12917877-12917899 CAGGGACCCTAGAGGGAGGCGGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
901989066 1:13097765-13097787 CAGCGATCCCAGAGGGAGGCGGG + Intergenic
901992747 1:13129002-13129024 CAGCGATCCCAGAGGGAGGCGGG - Intergenic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902012880 1:13283885-13283907 CAGGGACCCTAGAGGGAGGCGGG + Exonic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
903384472 1:22917363-22917385 CAGGGGCCCTGGAGTGAGCCAGG - Intergenic
904961444 1:34336423-34336445 AAGGGGTCCGAAAGGGAGCCGGG - Intergenic
905262555 1:36729919-36729941 CTGTGGTTCTCCAGGGAGCCAGG - Intergenic
905357257 1:37393527-37393549 CAGTGGTCCCGGAGGAAGCAGGG - Intergenic
910981415 1:92962282-92962304 CAGTGTTCCTGGACGGGGCCAGG - Intergenic
912770304 1:112457304-112457326 CAGTGGTCAAAGAGGCTGCCTGG - Exonic
913523812 1:119671113-119671135 CACAGGTCCTAGAGGGAGGAGGG + Intronic
914881096 1:151547744-151547766 CAGGTGTCCTAGAGTGAGACTGG + Intronic
915248661 1:154573029-154573051 CAGCTGTCCTAGAGGAAACCTGG - Intronic
915557250 1:156667582-156667604 CAGAGGTGCTAGATGGAGACAGG + Intergenic
920112787 1:203598870-203598892 CAGAGGCCCTTGTGGGAGCCTGG - Intergenic
920176823 1:204107332-204107354 CAAGGGTCCTGGAGGGAGTCAGG - Intronic
920677141 1:208046060-208046082 CCGTGGTCAGAGAGGGTGCCAGG + Exonic
920741447 1:208584903-208584925 GGGTGGTCCTAGAGGGTGCAGGG - Intergenic
921454221 1:215348228-215348250 CAATGATACTAGAGGGAGCTGGG - Intergenic
922672191 1:227518968-227518990 CAGTGGGGCTAGAGGGAGCCTGG + Intergenic
923501010 1:234564370-234564392 CTGTGGTCATAGAGACAGCCTGG - Intergenic
923511419 1:234656968-234656990 CAGTAGACTTAGAGGTAGCCCGG + Intergenic
923929797 1:238682428-238682450 CTGTGGTCCAAGAGGGTGGCTGG - Intergenic
924822137 1:247503588-247503610 CGGTGGGGTTAGAGGGAGCCTGG + Intergenic
1063439372 10:6060023-6060045 GAGTGGTCTTGGAGGGAGCAGGG - Intronic
1066277956 10:33887323-33887345 CAATGGGCCAAGAGAGAGCCAGG - Intergenic
1067077433 10:43196261-43196283 GGGTGGTCCTAGAGGGGGACAGG + Exonic
1067349363 10:45462138-45462160 CACTCGTCCTGGAAGGAGCCAGG + Intronic
1067695878 10:48535379-48535401 CTGAGGTCCTAGAAGGAGCCTGG - Intronic
1067805362 10:49388368-49388390 CACTGGCCCCAGAGAGAGCCTGG + Intronic
1068324406 10:55465446-55465468 CATTGGTCCTAGTTGCAGCCAGG - Intronic
1071165360 10:82799937-82799959 CAGTGGACCTCCATGGAGCCAGG - Intronic
1073447843 10:103591817-103591839 CAGTGTTCCTAGTGTGGGCCAGG + Exonic
1074183186 10:111080306-111080328 CAGTGGCCCTGGAGGGAGAGAGG - Exonic
1075781906 10:125022607-125022629 CAGGGGTCCTGGGGGCAGCCCGG + Intronic
1075840074 10:125494004-125494026 CCATGCTCCTGGAGGGAGCCAGG + Intergenic
1076065981 10:127448172-127448194 CAGTGCTGCTGGAGGAAGCCAGG - Intronic
1076658088 10:132037458-132037480 CCGTTGTCATGGAGGGAGCCAGG + Intergenic
1076720181 10:132389034-132389056 CAGGCTTCCTTGAGGGAGCCAGG - Intergenic
1079446503 11:20561575-20561597 CAGGGTTGCTAGAGGGAGACTGG + Intergenic
1083764641 11:64836050-64836072 CAGTGTGCCTGGAGGGAGCATGG - Intronic
1083837480 11:65281053-65281075 CAGTGATTCTCGAGGGAGACCGG + Exonic
1084024368 11:66438641-66438663 CACTGGGCCTAGTGGGGGCCCGG + Exonic
1084108496 11:66997233-66997255 CAGTGGTGCCAGAGGTGGCCTGG + Intergenic
1084965077 11:72740218-72740240 CAGTGGACCTGGTGGGAGGCAGG + Intronic
1085048895 11:73369409-73369431 CAGTGGGCCTGGATGGAGCTTGG + Intergenic
1087486662 11:98765277-98765299 CAGTGGGCATTGAGAGAGCCAGG + Intergenic
1089287703 11:117418276-117418298 CAGTGGCCCTACAGGGGGACGGG - Intergenic
1089622021 11:119727826-119727848 CAGAGTTCCGAGGGGGAGCCCGG + Intronic
1089641557 11:119851106-119851128 GAGTGCTCCTAGAGAGACCCAGG - Intergenic
1090376431 11:126292854-126292876 CAGGGGTCCTGAAGGAAGCCCGG - Exonic
1093034215 12:14317877-14317899 CAGTGGCTCTGGAGGGAGCATGG - Intergenic
1093466126 12:19451494-19451516 GAGTGTTCCAAGAGCGAGCCAGG + Intronic
1098691168 12:73489558-73489580 CATTGTTCCTACAGGAAGCCTGG + Intergenic
1101089326 12:101268664-101268686 CAGTGGTACTAGAGTGAGTGGGG - Intergenic
1101424427 12:104576324-104576346 CAGTGGGCCTAGCGGAAGCCAGG + Intronic
1101640036 12:106581234-106581256 CAGTGGTTATAAAAGGAGCCGGG - Intronic
1104074443 12:125376955-125376977 CAGTGGTCCCAGAGCGTGCTTGG - Intronic
1104989417 12:132616890-132616912 CAGTGCTCCTAGGGGGTGGCTGG + Intergenic
1108809798 13:54208214-54208236 TAGTAGTCATAGAGGAAGCCTGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1113565962 13:111320073-111320095 CAGAGGTCCTGGGGGGAGGCTGG - Intronic
1119265951 14:73263432-73263454 CAGTGATGCTTGGGGGAGCCGGG + Intronic
1119721028 14:76890583-76890605 CAGTGATCCAAGAGGGAACATGG + Intergenic
1122345140 14:101053906-101053928 CAGTGGGCCCTGCGGGAGCCTGG + Intergenic
1122907237 14:104807503-104807525 CAATGGCCCCAGAGGGAGGCAGG - Intergenic
1123704300 15:22939963-22939985 CAGTGGTCCCTGAGGTGGCCTGG - Intronic
1127563369 15:60162724-60162746 CGGTGGTCTGGGAGGGAGCCCGG - Intergenic
1130058920 15:80555586-80555608 CAGTGGTGATAGAATGAGCCTGG + Intronic
1133998193 16:10763131-10763153 CAGGGGTGGTAGAGGGAGGCCGG + Intronic
1134441735 16:14302756-14302778 GAGGGGTCCGAGGGGGAGCCGGG - Intergenic
1138394142 16:56691315-56691337 CAGTGGTCCTTCAGAGAGACAGG + Intronic
1141991388 16:87612566-87612588 CAGTGGTCTTGGATGGACCCCGG - Intronic
1142237136 16:88927654-88927676 CAGCTGTCACAGAGGGAGCCGGG + Intronic
1143257282 17:5569909-5569931 CAGTGGTCCAAGAGTGTGGCTGG - Intronic
1144936162 17:18900837-18900859 CAGTGGTATCAGAGGCAGCCTGG - Intronic
1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG + Intronic
1151512754 17:74571216-74571238 CTGGGGTGCTATAGGGAGCCCGG + Intergenic
1151529409 17:74695065-74695087 CTGGGGTCCAAGAAGGAGCCTGG + Exonic
1152321770 17:79611752-79611774 CAGTGGTCCTCCAGGAAGTCAGG - Intergenic
1153950038 18:10050778-10050800 CAGTGGTCCTAGAGATAACATGG + Intergenic
1154172835 18:12063492-12063514 CACTGGTCCTGGAGGGATCCTGG - Intergenic
1154174568 18:12076824-12076846 CTCTGGGCCTGGAGGGAGCCAGG + Intergenic
1157534585 18:48448983-48449005 CAGTGGTGGTGTAGGGAGCCTGG - Intergenic
1159025526 18:63179402-63179424 CAGGGGCCCTAGAGGGACTCAGG - Intronic
1160419490 18:78734415-78734437 CAGTGCTGCGAGATGGAGCCCGG - Intergenic
1160914739 19:1491121-1491143 CATTGGTCCTAGCGGGGGGCCGG + Exonic
1165493837 19:36140773-36140795 CCGTGGGGCTTGAGGGAGCCTGG - Intronic
1166432108 19:42736814-42736836 CATTGGCTCTAGAGGAAGCCTGG + Intronic
1167016803 19:46846327-46846349 CAGGGGTGCTGGAGGGACCCGGG - Intronic
1168132168 19:54328538-54328560 CAGCTGTCCTAGAGAGAGGCAGG + Intergenic
926207030 2:10841061-10841083 CCGGGGTCTTAGAGGGAGCAGGG + Intergenic
926221763 2:10941022-10941044 GGGTGGTCCTAGAGGCAGCAGGG - Intergenic
927149242 2:20186257-20186279 CAGGGTCCCTGGAGGGAGCCGGG + Intergenic
927855192 2:26523370-26523392 CAGTGGTTCTAGAGGCTGCCAGG - Intronic
928283932 2:29972553-29972575 CAGTTGTCCTAGTGGGTGGCTGG - Intergenic
928404091 2:31001112-31001134 CTGTGGTCCTGGAGATAGCCTGG - Intronic
928605134 2:32938544-32938566 CAGTGGCCCTAGGGGGAGTGAGG - Intergenic
929289021 2:40168213-40168235 CAGTTGGCCTAAAGGGAGTCAGG + Intronic
931184417 2:59936210-59936232 CAGTGGTCTAAGCAGGAGCCAGG - Intergenic
935572441 2:104676128-104676150 CTGTGGTCCAAGAGGGATCGGGG + Intergenic
938798464 2:134738450-134738472 CAGTGGTCCAAGTGGTACCCAGG - Intergenic
940211827 2:151262822-151262844 CAGAGGTCCAAGAGGGCTCCTGG - Intergenic
942346312 2:175005729-175005751 CAGTGAGCCTGGAGGGCGCCAGG - Intergenic
942551605 2:177125768-177125790 CAGTGATCATGAAGGGAGCCTGG + Intergenic
946339390 2:219058283-219058305 CGGTGGTGCTCGAGGGATCCAGG - Intronic
947751380 2:232534509-232534531 CAGTGCTGCTATAGGGTGCCAGG - Intronic
948285918 2:236785152-236785174 CAGTGATCCAAGAGAGAGCAAGG - Intergenic
1169253884 20:4083051-4083073 CAGTGGTCTCAGAGGAAGCCTGG - Intergenic
1171101261 20:22385493-22385515 CAGAGCCCCTGGAGGGAGCCTGG + Intergenic
1172898371 20:38316404-38316426 CAGTTGTCCTTGAGGCAGCTGGG + Intronic
1173191528 20:40880450-40880472 CAGGGGCACTAGAGGGAGACTGG + Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175626126 20:60489546-60489568 CAGCGTTCCTGGAGGGAGCACGG + Intergenic
1175737812 20:61399523-61399545 GGGTGGTCATAGAGGGAGCTGGG - Intronic
1175962500 20:62644196-62644218 CTGTGCTGCTGGAGGGAGCCAGG + Intronic
1178901952 21:36605600-36605622 CAGTGGCCCCAGCTGGAGCCAGG + Intergenic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1180008546 21:45034694-45034716 CAGGGGTCCTGGCGGGTGCCTGG + Intergenic
1182413590 22:30206848-30206870 CAGTGGCCCTGGTGGAAGCCTGG - Intergenic
1182473810 22:30564880-30564902 CAGTGATCGCAGAGGCAGCCTGG - Exonic
1184029211 22:41881625-41881647 CAGTGGTCCTAGAGGGAGCCAGG + Intronic
1184915071 22:47563591-47563613 CCATGGTCCCAGGGGGAGCCGGG + Intergenic
1185058250 22:48592257-48592279 CAGTGGCCCTGGAGTGAGGCTGG + Intronic
1185252531 22:49812408-49812430 AAGAAGTCCTAGAGAGAGCCAGG + Intronic
949388872 3:3536915-3536937 CAGTGGCACTAGATGAAGCCAGG + Intergenic
949601234 3:5600166-5600188 CAGTGGTCTCACAGGCAGCCTGG + Intergenic
950149633 3:10676605-10676627 CAGTGTTCCTACTGGGTGCCAGG - Intronic
953173044 3:40524924-40524946 CCGGGGGCCTAGAGGGACCCTGG + Exonic
954217943 3:49134722-49134744 AAGTGGCCCTAGAGTGATCCAGG - Intergenic
954539594 3:51384901-51384923 CAGGGGTTTTCGAGGGAGCCTGG + Intergenic
955486399 3:59438887-59438909 GAGTGGTCCAAGAGGGATCTCGG - Intergenic
955536871 3:59932963-59932985 AAGTGGTCAAGGAGGGAGCCGGG - Intronic
956001614 3:64735607-64735629 CAGTGATGCCAGAGGGATCCAGG + Intergenic
961778874 3:129309800-129309822 CAGTGGTCCTACATGGGGCCTGG - Intergenic
963362303 3:144289934-144289956 CAGTGGTCCAAGGGGGAGAATGG + Intergenic
964784233 3:160376701-160376723 CAGTGATCCAAAAGAGAGCCAGG - Intronic
968377049 4:52389-52411 CAGTGCCCCTAGAGAGAGCAGGG - Intergenic
968402036 4:306291-306313 CAGTGCCCCTAGAGAGAGCAGGG + Intergenic
968421608 4:489544-489566 CAGTGCCCCTAGAGAGAGCAGGG - Intronic
968731183 4:2270095-2270117 CAGTGGTCCTCTAGGCAGGCAGG - Exonic
968958771 4:3732210-3732232 CACTGGTGCTCGGGGGAGCCTGG + Intergenic
968958980 4:3733309-3733331 CAGTGGAGCTTGAGGGAGCAGGG + Intergenic
969322286 4:6419748-6419770 CAGAGCTTCCAGAGGGAGCCAGG - Intronic
969596327 4:8151336-8151358 CACTGGTCCTTGTGGGTGCCAGG - Intronic
972931191 4:44072731-44072753 CTGTGGAGCTGGAGGGAGCCAGG - Intergenic
975369848 4:73572276-73572298 AAGTGGTCCAAGAGAGAGCAAGG + Intronic
976482044 4:85556831-85556853 TAGAGCTCCTAGAGGGAGGCAGG - Intronic
980738106 4:136917427-136917449 CTGTGGAGCCAGAGGGAGCCAGG + Intergenic
981061139 4:140427084-140427106 CAATGGTTGTAGAGGGGGCCCGG - Intronic
981107966 4:140902968-140902990 CAGTGGTGCTAGAAGGAGAAAGG + Intronic
986370664 5:7077323-7077345 GAGTGAGCCTGGAGGGAGCCTGG - Intergenic
989264928 5:39462558-39462580 CAGTGGATTTAGAGGGAGCCCGG - Intergenic
989816003 5:45738234-45738256 AGGTGATCCTAGAGGTAGCCAGG + Intergenic
992259062 5:74952021-74952043 CAGTGGTCAGAGGGGCAGCCAGG - Intergenic
997023232 5:130027036-130027058 CAGTGTTCCTAGAGGCTGCAAGG - Intronic
997567270 5:134898047-134898069 CAGTGGTGCTGAAGGGAGGCTGG - Intronic
997751247 5:136347908-136347930 CGGTGGTCCTGGAAGCAGCCAGG + Intronic
998426970 5:142037012-142037034 CACTGGGCCTAGTGGGGGCCCGG + Intergenic
999643299 5:153693474-153693496 CTGTGGTCTCAGAGGCAGCCTGG + Intronic
1001129567 5:169052779-169052801 CAGTGGTCTGAGAGGTAGCTTGG - Intronic
1001367507 5:171158697-171158719 AAGTGGGCCAAGAGGGAGCAAGG - Intronic
1001513024 5:172336979-172337001 CAGCGGTCCCATAGGGAGGCAGG - Exonic
1001786183 5:174415729-174415751 CAGAGGTCCCAGCGGGAGACAGG - Intergenic
1002459052 5:179363773-179363795 TAGTGGGCCTAGATGGGGCCAGG + Intergenic
1002519854 5:179786373-179786395 CAGTGGTCCCACTGGGAGCTGGG - Intronic
1003095187 6:3137146-3137168 CACAGGTCCTAGTGGGAGGCAGG + Intronic
1004692542 6:18004772-18004794 CAGTGAGGCTGGAGGGAGCCAGG - Intergenic
1006100427 6:31683012-31683034 CCGTGGGCCTTGAGGGAACCGGG + Intronic
1007818960 6:44545850-44545872 CAGTGGTAATAGAGGGAATCTGG - Intergenic
1009534250 6:64860625-64860647 CTGTGGCCCTTCAGGGAGCCCGG - Intronic
1010631707 6:78206685-78206707 CAGTGTTCATAGAGGGTTCCTGG - Intergenic
1011880764 6:92022829-92022851 CAGTGGGCCTTTAGGGAGCAGGG + Intergenic
1016829354 6:148418054-148418076 CAGTGGTCCTAGTGGGCACTTGG + Intronic
1020230957 7:6318091-6318113 CAGTGGCTCTAGAGGGAGAGGGG + Intergenic
1024711666 7:52021869-52021891 CAGGAGGCCTAGAGGGAGCAAGG - Intergenic
1024832427 7:53476845-53476867 CAGTGCTCCTTCAGAGAGCCAGG + Intergenic
1026850680 7:73721425-73721447 CATGAGTCCTAGAGGAAGCCAGG - Intergenic
1027960446 7:84939712-84939734 CAGTGGTCCCAGAGGGGGTGAGG + Intergenic
1028513641 7:91652188-91652210 CAGTGGTCCATCAGGGAGGCAGG - Intergenic
1029930939 7:104370385-104370407 CGGTGGTGCTAGAGGGAGCCTGG - Intronic
1034439006 7:151077120-151077142 TAGTGGCGCTAGAGGCAGCCTGG + Exonic
1035240124 7:157523890-157523912 CAGGGGTCAGAGAGTGAGCCTGG + Intergenic
1037463826 8:19139563-19139585 CAGTGGGCCTAGAGTGGGGCGGG - Intergenic
1039292443 8:36111080-36111102 CAGTGGGCCCAGTGGGCGCCTGG - Intergenic
1040602435 8:48897741-48897763 CAGTGATTCTGGAGGGAGGCAGG - Intergenic
1041097275 8:54362119-54362141 CAGTGGTGCTAGCAGGAGCTTGG + Intergenic
1041779123 8:61558210-61558232 CACTCATCCTAGAGTGAGCCAGG - Intronic
1046086703 8:109445515-109445537 CAGTGGTCCCAGCGGGAGTGCGG - Exonic
1046195603 8:110859991-110860013 CAGTGGAGCCAGGGGGAGCCAGG + Intergenic
1046855506 8:119026987-119027009 CTGTGGTCCTAAAGGGAGTCTGG + Intronic
1047766700 8:127996048-127996070 CAGAGGTCCTTGAGGGAGGGAGG - Intergenic
1048310422 8:133318342-133318364 TGGTGGTCCTGGAGGGAGTCGGG - Intergenic
1049622192 8:143603547-143603569 CAGAGGTCCCAGGGGGAGACAGG + Intergenic
1052652512 9:31321930-31321952 CAGTGGAGCCAGTGGGAGCCGGG - Intergenic
1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG + Intergenic
1057022972 9:91714744-91714766 GAGTGGTCCCAGAGGAAGACAGG + Intronic
1057548401 9:96034816-96034838 CTGTGCTCTTGGAGGGAGCCAGG + Intergenic
1060031919 9:120221986-120222008 CAGTGCTCCCAGAGGAAGCTAGG - Intergenic
1060042111 9:120308694-120308716 CAGGAGGCCTAGAGGGAACCAGG - Intergenic
1060246450 9:121950568-121950590 CAGGGGTCCTTCAGAGAGCCTGG + Intronic
1060995451 9:127872965-127872987 CACTGGCACTGGAGGGAGCCCGG - Intronic
1062281490 9:135753887-135753909 CAGTGGTGCTAGAGGGGCCAGGG + Intronic
1062385748 9:136310877-136310899 CAGTGGCCCTGGGGGGTGCCGGG - Intergenic
1062475542 9:136725019-136725041 CAGTGGTCCCAGAGGGGGTGAGG + Intergenic
1203572188 Un_KI270744v1:141857-141879 CAGTGCCCCTAGAGAGAGCAGGG + Intergenic
1187753198 X:22490052-22490074 CAGCGGTCATAGAAAGAGCCTGG - Intergenic
1189280311 X:39816387-39816409 CTGTGGGCCTAGAGGCAGGCAGG + Intergenic
1195677981 X:107522057-107522079 CAGGGCATCTAGAGGGAGCCAGG + Intergenic
1196883802 X:120224010-120224032 CTGTGCTCTTCGAGGGAGCCAGG - Intergenic