ID: 1184031842

View in Genome Browser
Species Human (GRCh38)
Location 22:41899829-41899851
Sequence CCTGAAAAGCAGAGGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184031842 Original CRISPR CCTGAAAAGCAGAGGGACCC AGG (reversed) Intronic
900753363 1:4415439-4415461 CCTGAAAATGACAGGGACCCAGG - Intergenic
900892997 1:5463120-5463142 CCTGCTAAGCAGATGGACTCTGG + Intergenic
902724290 1:18324720-18324742 GCAGAAAAGCAGGGGGACACAGG - Intronic
902787537 1:18742750-18742772 CCTGGTAAGCAGAGGGGCACAGG + Intronic
903168206 1:21535872-21535894 CCTGTTTAGCAGAGGGACCTAGG + Intronic
903601616 1:24546244-24546266 GCTGAAAAGGACAGGGACCCTGG + Intergenic
903686994 1:25139178-25139200 GCTGAAAATCGGAGGGGCCCAGG - Intergenic
904286933 1:29458973-29458995 AGTGATCAGCAGAGGGACCCTGG + Intergenic
905593514 1:39185870-39185892 CCTGAAGTGCTGAAGGACCCAGG + Intronic
905695185 1:39968555-39968577 CCTGCAAAGCTATGGGACCCAGG - Exonic
906228131 1:44138825-44138847 CTTGAAAAGCATAGGAATCCTGG + Intergenic
906483721 1:46218860-46218882 CCTGAAAAGACTAGGGAACCAGG + Intronic
906754261 1:48293568-48293590 CCTCAAAAGCAGAAGTACCTTGG + Intergenic
906775956 1:48529816-48529838 CTTGACATGCAGAGGGCCCCTGG - Intergenic
910648194 1:89535987-89536009 CCAGAAACCCAGAGGGCCCCAGG - Intronic
912300574 1:108511961-108511983 GCTGAACAACAGAGGGAGCCAGG + Intergenic
912340041 1:108905541-108905563 CCAGAAAAGCAGAGTAATCCTGG - Intronic
912497032 1:110098384-110098406 CCTGAGAGTCAGAGGGACCAGGG - Intergenic
912524766 1:110273446-110273468 TCTGGAAAGAACAGGGACCCTGG + Intronic
913117006 1:115706487-115706509 CCTGGGAACCAGAGAGACCCTGG + Intronic
913272073 1:117104148-117104170 CCTGAGAAGCAGTGGCTCCCAGG + Exonic
915104939 1:153527988-153528010 CCTGGAAACCAAAGGGCCCCTGG + Intergenic
915323109 1:155066870-155066892 CCTGCCAGGCAGAGGGCCCCCGG + Exonic
915489302 1:156242531-156242553 CCTGCAAAGGAAAGGGAGCCTGG - Exonic
916517443 1:165532788-165532810 CTTGAAAAGCTTAGGGACCCTGG - Intergenic
919843175 1:201623668-201623690 CCGGAAGAGGACAGGGACCCTGG + Intronic
920226603 1:204443597-204443619 CCTGCAAGGCAGAGGGAGTCAGG + Exonic
921071596 1:211663437-211663459 ACTGAAAAGCAGACAGATCCTGG - Exonic
924380246 1:243456333-243456355 CCTGAAAAGCCCAGTGACCCTGG - Intronic
924709732 1:246522360-246522382 CCTGAAACCCAGAGGGAGCCAGG + Intergenic
1063329545 10:5143392-5143414 CCTGAGAAGCTGAGGGCCACTGG - Intergenic
1067046497 10:42988282-42988304 CATGAAAAGCAGGGTGACCAAGG - Intergenic
1067083537 10:43226601-43226623 CCTGGAACCCACAGGGACCCAGG + Intronic
1069014954 10:63419479-63419501 CCTGAAAAGGTGAGAAACCCAGG + Intronic
1069559833 10:69421716-69421738 TCTGTAAACCAGAGGGCCCCAGG + Intergenic
1069806330 10:71127272-71127294 CCTGAAAAGGAGGGTGAACCAGG - Intergenic
1069864504 10:71493266-71493288 CCTTAGAAGCAGAGAGGCCCAGG + Intronic
1070333353 10:75433199-75433221 TCTGAAACGCAGAGAGACCTAGG - Intronic
1070526747 10:77302165-77302187 CTTGGAAATCAGAGGGACCAGGG - Intronic
1070713664 10:78701933-78701955 CTTGAAAAGCAGTGGGTGCCCGG - Intergenic
1070915967 10:80154906-80154928 CCTGAAAGGCAAAGGGATCTTGG - Exonic
1071756348 10:88545034-88545056 CCCAAAAAGCAGAGGTATCCAGG - Intronic
1072192486 10:93087468-93087490 CCTTACCAGCTGAGGGACCCTGG - Intergenic
1073541146 10:104316877-104316899 ACTGAAAAGCTGTGTGACCCTGG + Intronic
1075650978 10:124128255-124128277 CCTGAGCAGCAGTGGGACCCTGG + Intergenic
1075667604 10:124242384-124242406 CCTGAAAGGTAGAGGGCCCGGGG + Intergenic
1075979555 10:126724838-126724860 CCAGCAAAGCAGTGGGACTCAGG + Intergenic
1076756107 10:132572544-132572566 CCTGTGAAGCAGCGTGACCCAGG + Intronic
1077009943 11:375255-375277 CCCAGAAAGCTGAGGGACCCTGG - Intronic
1077077695 11:708853-708875 CCTGAAGTCCAGAGGGAGCCCGG - Intronic
1077204635 11:1336629-1336651 CCTGAGAAGCAGCGGGACGGCGG + Intergenic
1077434383 11:2531742-2531764 CTTGGAAGGCAGAGAGACCCTGG + Intronic
1077890067 11:6412106-6412128 TCTGAAAGGCTGAGGGGCCCAGG - Intronic
1078135158 11:8645750-8645772 GCTGAAAAGAAAAGGGACACTGG + Exonic
1080638432 11:34143520-34143542 CCTGAAAAGGTGAGGGCCCAGGG + Exonic
1082003486 11:47407615-47407637 CCTGAACAGCAGTGGGAGTCTGG - Intronic
1082740064 11:56900964-56900986 CCTGTGAAGCAGAGGGAGCAAGG + Intergenic
1082766217 11:57169889-57169911 GCTGCACAGCACAGGGACCCTGG + Intergenic
1084170732 11:67399714-67399736 GCTGAATAGCCCAGGGACCCTGG - Intronic
1084794813 11:71498057-71498079 CATCAAAGGCAGGGGGACCCCGG + Intronic
1090561225 11:127935016-127935038 CGTGAAAAGCAGTGGGAGACAGG + Intergenic
1090872829 11:130763116-130763138 CCTGAAAAACAGATGGACTGTGG + Intergenic
1091271171 11:134312926-134312948 CCTCAAATGCAGACGGAGCCTGG + Intronic
1095284521 12:40392437-40392459 CCAGAAAAGCAGAAGAATCCAGG - Intergenic
1096676563 12:53229575-53229597 AAGGAAAAGGAGAGGGACCCTGG - Intronic
1098041037 12:66354227-66354249 CCTTAGATGCAGAGAGACCCGGG - Intronic
1102872251 12:116423135-116423157 CCTGATGACCAGAGGCACCCCGG - Intergenic
1103012580 12:117468551-117468573 CCTGAAGAGCAGATGTCCCCGGG - Intronic
1104680661 12:130749177-130749199 CCTGACCAGCTGTGGGACCCTGG + Intergenic
1105960983 13:25339110-25339132 TCTTAAAACCAGAGGGACCCTGG - Intronic
1106121188 13:26861268-26861290 CCTGGATAGCAGATGTACCCTGG - Intergenic
1106243218 13:27926357-27926379 CCTGAAAAAAAGAGGAACCCAGG - Intergenic
1107221960 13:37993096-37993118 CCTGAAGAAGAGAAGGACCCTGG - Intergenic
1110573244 13:77028064-77028086 ACTGAAAAGCAGTGGTGCCCAGG + Intergenic
1111379611 13:87430813-87430835 CCTGCAAAACAGAAGCACCCTGG + Intergenic
1111798445 13:92953697-92953719 CCTGAAAAGGAAGGAGACCCTGG + Intergenic
1113329742 13:109316710-109316732 CCTGAGAACCAGAGGGGCCCTGG + Intergenic
1114043175 14:18698650-18698672 ACTAAAAAGCAGAGAGATCCTGG - Intergenic
1114542380 14:23471215-23471237 CCAGAAGAGCAGAGGGATTCAGG + Intronic
1114568188 14:23647585-23647607 CCTGGAAAGGAGCGGGAGCCTGG - Intergenic
1115465347 14:33708790-33708812 TCTGAAAGGCAGAGGAGCCCAGG + Intronic
1116789014 14:49319580-49319602 CTAGAAAAGCAGATGGACCTGGG - Intergenic
1119318836 14:73717676-73717698 TCTGAAAAGCAGGAGGCCCCTGG + Exonic
1120267095 14:82264978-82265000 CCAGTAAAGCAGAGGGTCACAGG - Intergenic
1120732017 14:88013991-88014013 CCAGAAGAGCGGAGGAACCCAGG + Exonic
1121112005 14:91318942-91318964 CCTGCAGAGCCAAGGGACCCAGG + Intronic
1123066537 14:105622090-105622112 CCTGAAAGGCAGATGGGCCTTGG - Intergenic
1123121083 14:105917454-105917476 CCTGTAAAGACGAGGGATCCAGG - Intergenic
1123888705 15:24753014-24753036 GTTGAAAAGGAGAGGGACACAGG + Intergenic
1124138791 15:27059114-27059136 CCTGAATGGCAGAGGGCACCAGG - Intronic
1125096126 15:35854292-35854314 CCTGAAAAACAGGGTCACCCAGG + Intergenic
1126188653 15:45855784-45855806 CCTGAAGAGCCCAGGGAACCTGG - Intergenic
1127373317 15:58360005-58360027 CCAGGACAGCAGAGGGAACCAGG - Intronic
1127633473 15:60848007-60848029 CCCGCAATGCAGAGGGACCTGGG + Intronic
1127997958 15:64165123-64165145 CCTGAGAACAACAGGGACCCAGG + Intergenic
1128185768 15:65642343-65642365 CCAGAAAAGCCATGGGACCCTGG - Intronic
1128763224 15:70233538-70233560 CCTGAACAGGACAGGGGCCCTGG + Intergenic
1128858054 15:71037511-71037533 CCTGAGATGCAGAAGAACCCAGG + Intronic
1129115779 15:73364646-73364668 CCAGAAAAGCCCAGGGAGCCTGG + Intronic
1129689731 15:77706338-77706360 GATGAAGAGCAGAGGGACACAGG - Intronic
1129708710 15:77809315-77809337 CCTCAAAGGCAGCGGGATCCGGG + Intronic
1130616512 15:85414042-85414064 CCTGAAAAGCAGAGGAAAAAAGG + Intronic
1131918867 15:97301474-97301496 CCTGCAAAGCACAGAAACCCAGG - Intergenic
1131918970 15:97302123-97302145 CCTGTAAAGCACAGAAACCCAGG - Intergenic
1132560670 16:592106-592128 CCTGAAGCGCAGATGGACTCTGG - Intronic
1134672099 16:16063432-16063454 CCAGCAAAGCATAGGGACCTTGG + Intronic
1134834335 16:17348287-17348309 CCTGAGCAGCAGAGGAATCCTGG + Intronic
1135047044 16:19164518-19164540 CTTGCAAAGCAGTGGGATCCTGG + Intronic
1135207302 16:20494116-20494138 CCTGAAAAGAAAAGGGGACCTGG - Intergenic
1135211583 16:20529516-20529538 CCTGAAAAGAAAAGGGGACCTGG + Intergenic
1135515551 16:23130112-23130134 CCGGAAAGGCAGAGGAACACAGG - Intronic
1135992255 16:27225203-27225225 CCTGAGAAGGAGAGGGAGTCTGG - Exonic
1136011398 16:27365650-27365672 CCTGCAAAGGAGAGGGAGCTGGG + Intergenic
1136023955 16:27458052-27458074 CCTGAAAAACTGAGGGTCCTGGG + Intergenic
1136576030 16:31125902-31125924 CTTGAAAAATAGAGGAACCCAGG + Intronic
1136983930 16:35082833-35082855 CTTAACAAGCAGAGAGACCCTGG - Intergenic
1137581192 16:49634541-49634563 CCTCAAAATCACAGGGTCCCAGG + Intronic
1137678044 16:50313886-50313908 CCTGAGAAGCAGGGGCAGCCTGG + Intronic
1137721739 16:50631579-50631601 GCTGAGAATCAGAGGGACCCAGG + Intronic
1139079321 16:63495834-63495856 CCGGAAAAACAGAGGTACACTGG - Intergenic
1140377421 16:74455759-74455781 TCTAAAAACCAGAGGGACTCTGG + Intronic
1140732562 16:77870007-77870029 CCTGGAAAGAATAGGGACCAAGG + Intronic
1141378553 16:83554266-83554288 CCTGAAAATCACAGGATCCCTGG + Intronic
1141407028 16:83803776-83803798 CCTGACAAGCAGAGGGTCTCAGG - Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141799308 16:86296263-86296285 CCTGATAAGCAGAGTGAGTCTGG - Intergenic
1142374826 16:89701482-89701504 CCTGGAAGGCCGAGGTACCCAGG - Intronic
1143119359 17:4597426-4597448 TCTGCAAAGCTGAAGGACCCTGG + Intronic
1143291927 17:5837968-5837990 GCTGAGAAGCAGAGAGACCCAGG + Intronic
1144655194 17:17030782-17030804 CCTTAGGAGCAGAGGGGCCCTGG - Intergenic
1147456786 17:40542866-40542888 CCTGCCAAGCACAGGGTCCCGGG - Intergenic
1147535924 17:41323406-41323428 CCTGCAACTCAGAGGGAGCCAGG - Intergenic
1148535444 17:48434706-48434728 CCTGGTAAGCTGGGGGACCCTGG - Intergenic
1149610107 17:57953769-57953791 CTTGAATAGAAGAGAGACCCTGG - Intronic
1149884493 17:60327455-60327477 CCACAAAGGCAGCGGGACCCAGG + Intronic
1150208075 17:63424217-63424239 CCTGGAAAACTGAGAGACCCTGG - Exonic
1150506467 17:65703602-65703624 GCTGAGAGGCAGAGGGACCTGGG - Intronic
1151916164 17:77119679-77119701 ACTGATAAGGAGAGGGCCCCAGG + Intronic
1152265531 17:79292158-79292180 CCTGAAAACCACAGGAAGCCAGG + Intronic
1152354287 17:79799218-79799240 CGGGACAGGCAGAGGGACCCGGG - Intronic
1152460039 17:80437760-80437782 CCTTAAAAGGTGAAGGACCCTGG + Exonic
1152706765 17:81847633-81847655 CCTGAAAAGGCTAGGGGCCCTGG - Intronic
1152778608 17:82216702-82216724 CCCTAAAAGCACAGGGATCCAGG + Intergenic
1155532708 18:26783406-26783428 TCTGAATAGCACAGGGACCCTGG - Intergenic
1156360937 18:36384014-36384036 CCTGAGAAGCAGTGTGACCTTGG + Intronic
1157203490 18:45679170-45679192 CCTGCTAGGCAGAGGGAGCCAGG + Intronic
1157353714 18:46914590-46914612 TCTGAAAAGCAAAGGCACCAGGG + Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159954187 18:74507800-74507822 CCTGACAAGGAGAGGGAGGCCGG - Intronic
1160518102 18:79489425-79489447 CCTGACAGCCAGTGGGACCCTGG + Intronic
1162472884 19:10882979-10883001 GCTGCAAAGGAGGGGGACCCAGG + Intronic
1162569940 19:11465887-11465909 CCTGTAAGGCAGAGTGACCAGGG - Intronic
1162582187 19:11538287-11538309 CCGGCACAGCAGAGGGACTCGGG - Intergenic
1163087387 19:14992119-14992141 CCTGAAAAGCAGAAGGCACTGGG - Intronic
1163127624 19:15252815-15252837 CCTGGGAAGCAGAGGGCACCAGG + Intronic
1164852853 19:31499319-31499341 CCTGAAAAGCTGTGTGGCCCTGG + Intergenic
1165103858 19:33457129-33457151 GATGAAAAGCAGAGGGTGCCAGG + Intronic
1167753580 19:51395591-51395613 CCTGAAAAGCTGAGTCACCTTGG + Intergenic
1168084188 19:54033289-54033311 CATACAAAGCAGAGAGACCCCGG - Intergenic
1168152815 19:54458081-54458103 CCTGGAAGGCAGAGGCACCGAGG - Exonic
1168421514 19:56207234-56207256 CCTGAACAGTGCAGGGACCCTGG - Exonic
925776893 2:7344473-7344495 GGTGCAAAGAAGAGGGACCCGGG + Intergenic
925777569 2:7349791-7349813 GGTGAAAAGAAGAGGGACCCGGG - Intergenic
926777421 2:16436441-16436463 ACAGAAAGCCAGAGGGACCCAGG - Intergenic
927197383 2:20557963-20557985 TCTGCAAAGCAGAGGGCACCAGG + Intergenic
927829796 2:26339640-26339662 CATGAGAAACAGAGGGACCATGG - Intronic
927927380 2:27023502-27023524 CCTGAGGAGCAGTGTGACCCTGG + Intronic
930112874 2:47694190-47694212 CCTGATAAGCAGAAGGAGCCAGG + Intergenic
930940694 2:57010917-57010939 CCTGAGAACCAGAGGGGCACTGG + Intergenic
931209285 2:60177405-60177427 CCTGAGAAGCAGAGGGACTGTGG - Intergenic
932403722 2:71500029-71500051 CCTGATGAGCAGAGGGCACCTGG + Intronic
932562240 2:72883469-72883491 AGAGGAAAGCAGAGGGACCCTGG + Intergenic
932616781 2:73236844-73236866 CCTGCAAAGCATAGGGAACCTGG + Intronic
933650251 2:84844537-84844559 CCAGAAAAGCAGATACACCCGGG + Intronic
934659331 2:96134767-96134789 CCTGAATAGGACAGTGACCCAGG - Intronic
934678831 2:96267979-96268001 GCTGAAAAGCAGAGGAAGGCTGG - Intronic
935802892 2:106716327-106716349 TGTGAAGAGCAGAAGGACCCAGG - Intergenic
936252268 2:110876017-110876039 CCTTGAAAGCAGAGGCATCCAGG - Intronic
938298770 2:130195631-130195653 CCTGAAAGCCTGTGGGACCCAGG - Intronic
938457951 2:131478882-131478904 CCTGAAAGCCTGTGGGACCCAGG + Intronic
941923494 2:170874032-170874054 CCTTAAAGGCAGAAGGACTCAGG + Intergenic
943478219 2:188385391-188385413 TTCGTAAAGCAGAGGGACCCTGG + Intronic
946372551 2:219289809-219289831 GCTGAGAAGCAGGGGGAGCCGGG + Exonic
946386428 2:219387070-219387092 CATGGAAAGGAGAGGGACTCCGG + Exonic
946674714 2:222146859-222146881 CATGAAGAGCAGAGGTTCCCTGG + Intergenic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
1171216393 20:23355710-23355732 CCTGATAAGCACAGTGACACAGG + Intergenic
1172645618 20:36467477-36467499 GCTGAAAAGCAGAGGCACTGGGG + Intronic
1173079142 20:39849555-39849577 CCTGAAGAGCAGATGTCCCCAGG - Intergenic
1174251964 20:49226535-49226557 GGTGAAAAGGATAGGGACCCAGG + Exonic
1174573594 20:51521683-51521705 CCTGAAAACCACAGGGATCGTGG + Intronic
1174703590 20:52634166-52634188 CCTTATAAGAAGAGAGACCCAGG + Intergenic
1174799037 20:53547520-53547542 CTTGAAAAGCAGATGAAGCCAGG - Intergenic
1175624793 20:60481379-60481401 CAGGGAATGCAGAGGGACCCTGG - Intergenic
1175981143 20:62739309-62739331 CTGGAACAGCAGTGGGACCCAGG - Intronic
1177706015 21:24705710-24705732 CGAGAAAAGCAGATGGATCCTGG - Intergenic
1177735188 21:25080356-25080378 CCTGAAAACCACAGGGAGCCTGG - Intergenic
1183129631 22:35821694-35821716 CCTAAAAGGCAGAGGTTCCCAGG + Intronic
1183187399 22:36299921-36299943 CCTCATAAGCAAAGGGGCCCTGG - Intronic
1183939732 22:41286501-41286523 CCGGAAGAGCTGAGGGACCTGGG - Intergenic
1184016884 22:41792998-41793020 TCAGAAAAGAAGATGGACCCTGG - Intronic
1184031842 22:41899829-41899851 CCTGAAAAGCAGAGGGACCCAGG - Intronic
1185032305 22:48450488-48450510 CCTGAAAAGCCGACTGGCCCAGG - Intergenic
1185166885 22:49266872-49266894 ACTGAACAGCGGAGGGCCCCAGG + Intergenic
949862489 3:8518859-8518881 CCTGGAAACCAGAGGAAACCAGG + Intronic
951897454 3:27623742-27623764 GCTGAGAGGCAGAGGGACACTGG - Intergenic
954294447 3:49666313-49666335 CTGGAAAAGCAGTGGGGCCCTGG + Intronic
954752208 3:52819990-52820012 CCTGGAAATCAGTGGGACCTGGG + Exonic
961423744 3:126828734-126828756 CCTGAAAGGCAGGTAGACCCTGG - Intronic
961817167 3:129557030-129557052 CCTGAAGAGCTGAGGGATCGGGG - Intronic
963393999 3:144708260-144708282 TTTGAAAAGCAGGGGGACTCAGG + Intergenic
967135584 3:186510190-186510212 CCTGATAAGCTGAGGGGTCCTGG + Intergenic
969297232 4:6277356-6277378 ACAGAAAAGCAGAGGGAGGCAGG - Intronic
969330553 4:6471698-6471720 CTGGAGAAGAAGAGGGACCCGGG - Intronic
970483464 4:16501171-16501193 CCTGGAAAGCAGCCGGACCTGGG - Intergenic
971324900 4:25635715-25635737 CCGGAAAACCAGAAGGACTCAGG + Intergenic
972095960 4:35347442-35347464 CCTGAAAAGCAGCGTGCCCTGGG - Intergenic
973217070 4:47681312-47681334 CCAGAAGAGCACAGGGAGCCAGG + Intronic
976318699 4:83686916-83686938 CCTGAAAAGCAAGGGGAGCTTGG - Intergenic
976497432 4:85746604-85746626 CCTGAACAGGAGAGGCACTCAGG + Intronic
976581369 4:86740495-86740517 TCTACACAGCAGAGGGACCCTGG + Intronic
977395789 4:96468951-96468973 TCTACACAGCAGAGGGACCCTGG + Intergenic
980139858 4:128901700-128901722 CCTGAAAAGAAGGGGGACAAGGG - Intronic
981712243 4:147721036-147721058 CATGAAAACCAGAGGGTCCAAGG - Intergenic
982202622 4:152974917-152974939 CCCGGTCAGCAGAGGGACCCAGG - Exonic
982904493 4:161050402-161050424 GCTGAAGACCAGAGAGACCCTGG + Intergenic
984944209 4:184958512-184958534 CCAGAGAAGCAGAGGAACACTGG + Intergenic
985105788 4:186498798-186498820 AATGAAAAGCAGAGGCAGCCAGG + Intronic
986536589 5:8794192-8794214 CCAGAGATGCACAGGGACCCTGG - Intergenic
990528750 5:56653672-56653694 CATGAAAAGCTGAGTGAGCCTGG - Intergenic
992020636 5:72620202-72620224 CCCGAAAACCAAAGGCACCCAGG + Intergenic
992462652 5:76976203-76976225 GCTGAAAAGCAAACAGACCCAGG + Intronic
992911175 5:81397448-81397470 CCTGAACAGCAGAGGCAGCCGGG + Intergenic
992996968 5:82343767-82343789 CCTCAAATGCAAAGTGACCCAGG + Intronic
994107614 5:95963829-95963851 CCGGAAAAGCAGTGGGATACAGG - Intergenic
995369269 5:111400619-111400641 CCAGAAAAGCAGAAGGAGCAAGG - Intronic
997425698 5:133801252-133801274 CCTGAAAAGCAGTTGGTCTCTGG - Intergenic
997632563 5:135379857-135379879 CTTGAAAAGCAGAGGAAGTCAGG - Intronic
997846069 5:137287074-137287096 ACTGAAAAGCAGTGTGACCCTGG - Intronic
999251079 5:150182746-150182768 CCTGAGAAGCAGAAGGAGCCGGG - Exonic
1001141494 5:169147739-169147761 ACTGAAAAGCAGGAGGCCCCTGG - Intronic
1001942248 5:175749025-175749047 CCTAAAAAGTAGAGGGAATCTGG + Intergenic
1002094424 5:176822737-176822759 CCAGAACAGGAGAGGGACTCAGG + Intronic
1004153926 6:13150002-13150024 CCTCAAAAGCAGAGAGAGGCAGG - Intronic
1004504917 6:16239537-16239559 CCTGAAAGGCAGAGTGCCCCGGG + Intronic
1006297507 6:33176468-33176490 CCTGAGGTCCAGAGGGACCCTGG + Exonic
1006641446 6:35491708-35491730 CCTGAAAGGCTGAGGGCCCTGGG - Intronic
1006677314 6:35773765-35773787 CCCGCAATGCAGAGGTACCCTGG + Intergenic
1007521510 6:42453914-42453936 CCTGAAAAGAGGAGGGGACCCGG + Intergenic
1008549069 6:52610333-52610355 CCTGACAGGCAGAGGGAATCCGG + Intergenic
1008956764 6:57224138-57224160 CCTTAAAAAAGGAGGGACCCAGG + Intergenic
1009055212 6:58326877-58326899 CCAGAAAGGCTGAGGGATCCTGG - Intergenic
1009245438 6:61231573-61231595 GCTGAATAGCAGAGATACCCAGG + Intergenic
1009386193 6:63085863-63085885 TCTGAAAAGCATTAGGACCCAGG + Intergenic
1011122972 6:83974750-83974772 ACTGATAAGAAGAGCGACCCTGG - Intergenic
1012472997 6:99591259-99591281 CCCCAACAGAAGAGGGACCCCGG + Intergenic
1014225451 6:118841445-118841467 CCTGGAAAGCAGAGGCAAACAGG + Intronic
1014804988 6:125819450-125819472 CCTGAAAACCAGTTGGACCAGGG - Intronic
1014846861 6:126288289-126288311 CCAGAAAAGAAGAGATACCCTGG - Intergenic
1016431384 6:143989550-143989572 CCTGAGAAGCAGAGGAACCAGGG - Intronic
1018509665 6:164511569-164511591 CCAGAAAAGCAGAGAGCCACAGG + Intergenic
1018990765 6:168671689-168671711 CCACAGAAGCAGAGGGACCAGGG - Intronic
1019211471 6:170408769-170408791 TCTGAGCAGCTGAGGGACCCTGG - Intergenic
1019213288 6:170423267-170423289 TCTGAAAACCAGAGCGTCCCCGG - Intergenic
1019742056 7:2679932-2679954 CCTCGTAGGCAGAGGGACCCCGG + Intronic
1019999800 7:4749282-4749304 ACAGAAGAGAAGAGGGACCCAGG - Intronic
1020169893 7:5836847-5836869 TATGAAAAGCAGAGAGACCACGG - Intergenic
1021111135 7:16696033-16696055 CTTCAAAAGCAGAAGGAGCCGGG - Intronic
1021341373 7:19466610-19466632 CCTGAAAAGCAGAGAGATACAGG - Intergenic
1022972541 7:35530818-35530840 CCTGAAAAGCAGCAGCACTCTGG + Intergenic
1023085035 7:36561884-36561906 CCTGAGTGGCAAAGGGACCCAGG - Intronic
1024054806 7:45653194-45653216 CCTGAAGAGCTGTGTGACCCTGG + Intronic
1024222141 7:47297337-47297359 CCAGCCAAGCAGAGGGATCCCGG - Intronic
1024241276 7:47438485-47438507 CCTGAGGAGGAGAGGGCCCCTGG + Intronic
1025093050 7:56078689-56078711 TATGAAAAGCAAAGGGACCCAGG + Intronic
1029308647 7:99640868-99640890 CCTGAGAAGCAGAGCGACTTGGG + Intergenic
1030089360 7:105843681-105843703 ATTGAAAAGAAGAGGGAACCTGG - Intronic
1030204508 7:106939878-106939900 CCAGAAAAGCAGAGGAAGCTTGG + Intergenic
1031088614 7:117326288-117326310 CCTGAAAAGGAGAGCTACTCAGG - Intergenic
1032023092 7:128421056-128421078 GCTTGAAAGCAGAGGGACACAGG + Intergenic
1035484906 7:159215281-159215303 TGGGAAAAGCAGAGGGACTCAGG + Intergenic
1036396794 8:8377267-8377289 CCAGAGAAGCAGCAGGACCCTGG - Exonic
1036688214 8:10925462-10925484 CCTGGACATCAGGGGGACCCAGG + Intronic
1036699376 8:11001888-11001910 GCTGAACAGCAGAGGGACCAGGG - Intronic
1036783790 8:11671752-11671774 CCAGAAGAGCTAAGGGACCCTGG - Intergenic
1038062895 8:23931794-23931816 CCTAAAAAGAAGAGGGAACTGGG - Intergenic
1038520630 8:28229442-28229464 CCTGAAAAGCAAAGGGTCACAGG - Intergenic
1040698354 8:50030372-50030394 CCTCAAAAGCACAGCGACCAAGG - Intronic
1040828613 8:51651815-51651837 ACTGGAAGGCAGAGGCACCCTGG + Intronic
1042426640 8:68656753-68656775 CCAGGAAGGCAGAGGGATCCAGG - Intronic
1044418298 8:91961399-91961421 TCAGAAAAGCAGAGGGAACTGGG + Intronic
1044743669 8:95352230-95352252 CCTGGAAGTCAGAAGGACCCTGG - Intergenic
1047749769 8:127871507-127871529 ACAGACAAGCAGAGGGCCCCTGG - Intergenic
1049328025 8:142034186-142034208 TCCGACAAGCAGTGGGACCCCGG - Intergenic
1049343329 8:142125508-142125530 ACTTAAACTCAGAGGGACCCAGG + Intergenic
1049618404 8:143586625-143586647 CCAGGAAGGCAGAGGCACCCTGG - Intronic
1050939298 9:11439452-11439474 TCCAAAAAGCAGTGGGACCCTGG - Intergenic
1051340677 9:16106930-16106952 CCTGCAAAACCGGGGGACCCAGG + Intergenic
1051629706 9:19129940-19129962 CCTGTGAAGCAGAGGGCCCCAGG + Intronic
1051769480 9:20561036-20561058 ACTGAAAAGCAAAGGGACCAGGG + Intronic
1051897658 9:22005699-22005721 CCTGAAAAGCAAACGACCCCTGG + Exonic
1052972703 9:34386742-34386764 CCCAAAAAGCACAGGGGCCCAGG - Intronic
1056419057 9:86405969-86405991 CTAGAAAAGCAGAGTGACTCAGG + Intergenic
1059438995 9:114292172-114292194 CCTGGAAACCAGGGGGAGCCTGG + Exonic
1060659730 9:125397771-125397793 CCTGGTAAGTGGAGGGACCCCGG + Intergenic
1061586803 9:131574932-131574954 GCTGATAAGCAAAAGGACCCTGG - Intergenic
1062133150 9:134911074-134911096 CTTGGAAAGCAGAGAGAACCTGG - Intronic
1185591902 X:1282856-1282878 GATGAAATGCAGATGGACCCAGG - Intronic
1186484483 X:9923481-9923503 CCTGTAAAGCAGAGATTCCCAGG + Intronic
1187473261 X:19588178-19588200 AGTGAAGAGCAGAGGGAGCCTGG + Intronic
1188376089 X:29429600-29429622 AATGAAAAGCAAAGGGAGCCAGG + Intronic
1189163215 X:38832487-38832509 CTTTAAAATCAGAGAGACCCTGG + Intergenic
1190224369 X:48534029-48534051 CCTTATAAGAAGAGGGACACTGG - Intergenic
1191696556 X:63996475-63996497 CCTAGACAGCAGAGGGACCCTGG - Intergenic
1194379571 X:93176783-93176805 CCTGAAAAGAAAAGGGGACCTGG - Intergenic
1195527437 X:105908148-105908170 CCTAAGAAGCAGAGGGAACAAGG + Intronic
1195666629 X:107437290-107437312 CCTAAAAAGGAGAGTGTCCCAGG - Intergenic
1200073691 X:153541037-153541059 CCAGGAAAGCACAGGGACCTGGG + Intronic
1202199430 Y:22331164-22331186 CCTGGAATGTAGAAGGACCCTGG + Intronic