ID: 1184032244

View in Genome Browser
Species Human (GRCh38)
Location 22:41901957-41901979
Sequence GCATGCTGCAGAAGCACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 264}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184032244_1184032248 10 Left 1184032244 22:41901957-41901979 CCACAGGTGCTTCTGCAGCATGC 0: 1
1: 0
2: 1
3: 34
4: 264
Right 1184032248 22:41901990-41902012 AGTGCCAGGTTTTGAGGAGAGGG 0: 1
1: 0
2: 0
3: 34
4: 300
1184032244_1184032245 -4 Left 1184032244 22:41901957-41901979 CCACAGGTGCTTCTGCAGCATGC 0: 1
1: 0
2: 1
3: 34
4: 264
Right 1184032245 22:41901976-41901998 ATGCACAGCTTAGAAGTGCCAGG 0: 1
1: 0
2: 1
3: 17
4: 114
1184032244_1184032247 9 Left 1184032244 22:41901957-41901979 CCACAGGTGCTTCTGCAGCATGC 0: 1
1: 0
2: 1
3: 34
4: 264
Right 1184032247 22:41901989-41902011 AAGTGCCAGGTTTTGAGGAGAGG No data
1184032244_1184032246 4 Left 1184032244 22:41901957-41901979 CCACAGGTGCTTCTGCAGCATGC 0: 1
1: 0
2: 1
3: 34
4: 264
Right 1184032246 22:41901984-41902006 CTTAGAAGTGCCAGGTTTTGAGG 0: 1
1: 0
2: 1
3: 13
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184032244 Original CRISPR GCATGCTGCAGAAGCACCTG TGG (reversed) Intronic
900520582 1:3103586-3103608 GGGTGGTGCAGAAACACCTGTGG + Intronic
901403691 1:9031960-9031982 GGAGGCTGCAGCTGCACCTGGGG + Intergenic
903505380 1:23831036-23831058 GGAGGCTGCTGGAGCACCTGAGG - Intronic
904048383 1:27623176-27623198 GCATGGGGCAGAAGCACCAAGGG + Intronic
904174059 1:28613345-28613367 GCAATCTGCAGCAGCATCTGGGG + Exonic
905384141 1:37588348-37588370 GGATGATGCAGCAGCCCCTGTGG + Intronic
906066603 1:42985412-42985434 GCATGCTGCAGGAGCGCCTGTGG + Intergenic
906234952 1:44200712-44200734 CCAAGCTGCAGAAGGACCTGTGG - Intergenic
906503758 1:46361810-46361832 GCATTTTGCAGAAGTACATGGGG - Exonic
907867683 1:58414283-58414305 TCATCCTGCAGAAGCAGCTCAGG + Intronic
907981183 1:59482933-59482955 GCATACGTCAGAACCACCTGGGG + Intronic
909997414 1:82297767-82297789 GGATGAGGCAGAAGAACCTGGGG + Intergenic
911350650 1:96750041-96750063 GCATGCATCAGAAACACTTGGGG + Intronic
911939295 1:104020868-104020890 CCATCCTGTAGAAGGACCTGTGG - Intergenic
912172430 1:107116910-107116932 GCATGCAGGAGAAATACCTGTGG - Intergenic
913612506 1:120521996-120522018 GCATGCTTAAGAATCACCTGTGG - Intergenic
913966681 1:143382685-143382707 TCATGCTGGAGACCCACCTGTGG - Intergenic
914061058 1:144208292-144208314 TCATGCTGGAGACCCACCTGTGG - Intergenic
914118092 1:144758077-144758099 TCATGCTGGAGACCCACCTGTGG + Intergenic
914371224 1:147025966-147025988 GCATGCTTAAGAATCACCCGTGG - Intergenic
914462313 1:147896877-147896899 GCATGCATTAGAATCACCTGGGG + Intergenic
914578685 1:149000251-149000273 GCATGCTTAAGAATCACCTGTGG + Intronic
918239262 1:182607488-182607510 AAATGCTGCAGAAGCACTTAGGG + Intergenic
919482404 1:198106302-198106324 GCATGTCACAGAAGCATCTGTGG - Intergenic
921316713 1:213898440-213898462 GCAGCTTGCAGGAGCACCTGGGG + Intergenic
922861176 1:228818202-228818224 GGCAGCTGCAGCAGCACCTGGGG - Intergenic
923287857 1:232514245-232514267 GGATGCTGCAGATGCCCCAGTGG + Exonic
923732034 1:236560861-236560883 TCATGATGCAGAAACACATGCGG + Intronic
1063365663 10:5488777-5488799 ACATTCTCCAGAAGCTCCTGGGG + Intergenic
1063425187 10:5945274-5945296 GGTGGCTGCAGAGGCACCTGAGG - Intronic
1063515666 10:6692585-6692607 GCATGCTCCAGGAACACCGGAGG + Intergenic
1064004869 10:11691599-11691621 GCTTGTTACAGGAGCACCTGCGG - Intergenic
1064436587 10:15316299-15316321 GAATGCTTGAGAAGCACCAGGGG + Intronic
1067176752 10:43955419-43955441 GCAGGCATCAGAATCACCTGGGG + Intergenic
1067308098 10:45085124-45085146 ACATGCTGCAGAATCCCCTGAGG - Intergenic
1068280016 10:54855372-54855394 GGCAGCTGCAGAGGCACCTGGGG + Intronic
1069693763 10:70372032-70372054 CCACTCTGCAGCAGCACCTGTGG + Intronic
1069958099 10:72063802-72063824 ACATGCTCCATAAACACCTGGGG - Intronic
1070539162 10:77403761-77403783 GCCTCCTGCAGAAGACCCTGGGG + Intronic
1070955105 10:80458466-80458488 CCATGAAGCAGAAGAACCTGAGG - Intronic
1072337634 10:94412988-94413010 GCCTGCATCAGAATCACCTGGGG - Intronic
1072574289 10:96686036-96686058 GAGGGCAGCAGAAGCACCTGAGG + Intronic
1072936366 10:99717291-99717313 GCATGCTGTAGAAGAAACTTTGG + Intronic
1073327245 10:102650037-102650059 GCTAGCTCCAGAAGCCCCTGTGG - Intronic
1074274720 10:111990373-111990395 GCATGCAACAGAATCCCCTGGGG + Intergenic
1075115458 10:119622754-119622776 GCATGCGTCAGAATCTCCTGGGG - Intergenic
1075690779 10:124392843-124392865 GCATGCAGCAGCAGCTGCTGTGG - Intergenic
1076017217 10:127037758-127037780 GCCTGCTGCAGCAGAACTTGAGG + Exonic
1076344327 10:129770117-129770139 GGATTCTGGAGAAGCACGTGGGG - Intergenic
1076370726 10:129951454-129951476 GCATGCTGCTGCAGGGCCTGGGG + Intronic
1076700297 10:132269455-132269477 GGCTGCTGCAGGAGGACCTGGGG + Intronic
1077092624 11:786642-786664 GCATGCTGCAGCCCCACCCGTGG + Intergenic
1077253564 11:1571271-1571293 GCCTGCTGCAGAGGCAGCCGCGG - Intronic
1077467403 11:2739961-2739983 CCATGCGGCAGTAGCCCCTGGGG + Intronic
1078016549 11:7619861-7619883 GGATGCTGCATAGGCACCTCCGG - Intronic
1078054159 11:7993576-7993598 GCATGCTGAGGAAGCAGCTGTGG + Intronic
1078664512 11:13313511-13313533 TCATGAAGCAGAAGCAACTGAGG - Intronic
1078905447 11:15683977-15683999 CCAGGCTGCAGAAGCACCCTGGG + Intergenic
1079359986 11:19762391-19762413 ACATGCTGGAGAAGAACTTGGGG - Intronic
1079546655 11:21641546-21641568 GCATGCTGCAGTAGCAGACGTGG + Intergenic
1079668292 11:23134978-23135000 GTTTGATGCAGAAGCACCTGTGG - Intergenic
1081268209 11:41053304-41053326 GCATGCTGGAGAGGCCCATGTGG + Intronic
1081981382 11:47269405-47269427 GCATGCTACACATGCACGTGAGG - Intronic
1081997411 11:47374502-47374524 CCATTCTGCAGATGCACCTGTGG - Intronic
1084703657 11:70803509-70803531 GAATGCTGCAAAATCACCTGAGG + Intronic
1084770720 11:71341402-71341424 GCAGGCAGCACGAGCACCTGGGG - Intergenic
1084892954 11:72245324-72245346 GCATACTGCAGATGGAGCTGAGG - Intronic
1089213364 11:116821014-116821036 GCTTCCTGGAGAAGGACCTGAGG - Exonic
1093370009 12:18354933-18354955 GCAGGCTGCAATGGCACCTGTGG - Intronic
1096069859 12:48768864-48768886 GCAGACTGCAGAGACACCTGTGG + Intronic
1097299137 12:57998769-57998791 GGTGGCTGCAGCAGCACCTGGGG + Intergenic
1100434706 12:94560977-94560999 GTCTGCTGCGGAAGCATCTGCGG + Intergenic
1103603299 12:122068030-122068052 GCTTGCTGCAGAGGCATCGGGGG + Intergenic
1103968139 12:124653054-124653076 GCTGGCAGCAGGAGCACCTGTGG + Intergenic
1104753853 12:131256685-131256707 TCAAGCTGCATAAGCGCCTGGGG + Intergenic
1105069482 12:133226100-133226122 TCAGGCTGCAGGAGCACGTGTGG + Intronic
1105413299 13:20189549-20189571 GCACGCTGCAGACGATCCTGGGG - Exonic
1106217426 13:27715680-27715702 GCATGATGCAGTAGTACCTATGG + Intergenic
1106782693 13:33075451-33075473 GGCTGCTGCAGAATCAGCTGAGG - Intergenic
1107358743 13:39596514-39596536 GTATGCATCAGAATCACCTGTGG - Intronic
1107402852 13:40086207-40086229 GCATGCCTCAGAATCACCTGGGG - Intergenic
1107442344 13:40439604-40439626 GCTTGCTGCTGCAGCTCCTGAGG + Intergenic
1109230874 13:59756154-59756176 GCATGCACCAGAATTACCTGTGG - Intronic
1109280028 13:60345202-60345224 GCATGCATCAGAAGCACTTGGGG - Intergenic
1109907614 13:68865511-68865533 CACTGCTGCAGAAACACCTGTGG + Intergenic
1113094497 13:106649580-106649602 ACATGCATCAGAATCACCTGAGG - Intergenic
1113408306 13:110062204-110062226 GCAGGCCTCAGAACCACCTGAGG + Intergenic
1113920766 13:113908090-113908112 GCATGGTGCAGACGTCCCTGTGG + Intergenic
1113960908 13:114125674-114125696 GTCTACTGCAGCAGCACCTGTGG - Intronic
1114446809 14:22794869-22794891 CCATGCTTCAGAGTCACCTGGGG - Intronic
1117644693 14:57839327-57839349 GCCTGCATCAGAATCACCTGTGG + Intronic
1118456058 14:65946538-65946560 GAATGCTGGGGATGCACCTGAGG - Intergenic
1118686765 14:68299170-68299192 GCATACATCAGAATCACCTGGGG + Intronic
1118893858 14:69930080-69930102 CCAAGCAGCAGAAGCACATGTGG - Intronic
1119634789 14:76265051-76265073 GACTGCAGCAGAGGCACCTGGGG - Intergenic
1120979131 14:90275575-90275597 GCAAACTGGAGAAGCAGCTGGGG - Exonic
1121413418 14:93763007-93763029 GCATGCAGCAGAACAAGCTGGGG - Intronic
1122450136 14:101799190-101799212 GGATGCAGCAGAGCCACCTGAGG - Intronic
1122476334 14:102012334-102012356 GCGAGCTGCAGAAGCGCCAGTGG + Exonic
1124360875 15:29035820-29035842 CCATGCAGCAGAGCCACCTGCGG - Intronic
1128294467 15:66505979-66506001 GCATGCATCAGAATCACCGGGGG + Intronic
1128754076 15:70169671-70169693 GCATGCATTAGAATCACCTGTGG - Intergenic
1128799834 15:70490374-70490396 GGATGCAGCAGAAGCCCATGTGG - Intergenic
1129154131 15:73707201-73707223 GCCTCCTGCAGAAGCTGCTGAGG + Intronic
1129784917 15:78303843-78303865 GGCGGCTGCAGCAGCACCTGGGG - Intergenic
1130580859 15:85135627-85135649 GCATTCTTTAGAAGCCCCTGTGG - Intronic
1130648509 15:85748845-85748867 GCTTCCTGCAGAAGCCCCTCCGG - Intronic
1130738292 15:86572249-86572271 GGAGGCTGCAGCTGCACCTGTGG + Intronic
1130743712 15:86628125-86628147 GCATGCATCAAAATCACCTGTGG + Intronic
1131249329 15:90820250-90820272 GGATGCTGCAGCAGCCCCGGAGG - Intergenic
1132602392 16:779506-779528 GCTGGCTGCTGAGGCACCTGAGG + Intronic
1132665802 16:1080838-1080860 TCCTGCTGCAGGAGGACCTGAGG + Intergenic
1135001829 16:18782900-18782922 GCATGCTGCCGCAGAAGCTGTGG + Exonic
1135619877 16:23946694-23946716 GCGTGCAGAAGAATCACCTGTGG + Intronic
1137396954 16:48122974-48122996 GCATGTGGCAGAAACAGCTGGGG + Intronic
1137581566 16:49636671-49636693 TCCTGCTGGAGAAGCACCTGCGG - Exonic
1138098664 16:54233798-54233820 TCATGCTCCAGAATCACCTCTGG - Intergenic
1138213750 16:55184885-55184907 GCACCCTGCTGGAGCACCTGGGG - Intergenic
1138836867 16:60448050-60448072 CGAGGCTGCTGAAGCACCTGCGG + Intergenic
1139382632 16:66543276-66543298 GCCTGCTTCAGATGCACCAGAGG + Intronic
1140310790 16:73846617-73846639 GCTTACTGCAGAGGCATCTGAGG - Intergenic
1141108022 16:81249631-81249653 CCATGCTGGTGAATCACCTGAGG - Intronic
1142283748 16:89162544-89162566 GCACGGTGCAGCCGCACCTGGGG - Intergenic
1142884197 17:2902777-2902799 GGATGCTGGATAAGCTCCTGGGG - Intronic
1143385310 17:6526014-6526036 GTGTGCTGCAGAAGCAGCTCTGG + Intronic
1143420041 17:6781606-6781628 GTGTGCTGCAGAAGAACTTGAGG + Intronic
1144543257 17:16167143-16167165 GCATGCATCAGAATCACCTGAGG - Intronic
1145301197 17:21639180-21639202 GCATGCATCAGAATCACCAGAGG + Intergenic
1145349106 17:22064122-22064144 GCATGCACCAGAATCACCAGAGG - Intergenic
1146761416 17:35482454-35482476 GGTGGCTGCAGCAGCACCTGGGG - Intronic
1147154065 17:38534375-38534397 GTGTGCAGCAGAGGCACCTGGGG - Intronic
1148386405 17:47237940-47237962 GGTGGCTGCAGCAGCACCTGGGG + Intergenic
1148878422 17:50707141-50707163 GCGTTCTCCAGAAGCACCTACGG + Intronic
1148957283 17:51364346-51364368 ACCTGGGGCAGAAGCACCTGGGG + Intergenic
1152134962 17:78498405-78498427 GCATGCGTCAGGATCACCTGAGG + Intronic
1157811181 18:50697127-50697149 GCATGCATCAGAACCCCCTGGGG - Intronic
1158931352 18:62326999-62327021 GCACCCTGCAGAAGCCCCTATGG - Intronic
1159902947 18:74065040-74065062 TCGAGCTGCAGAAGCCCCTGGGG - Intergenic
1160985716 19:1837647-1837669 GCCTGCAGCAGCGGCACCTGGGG + Intronic
1161686833 19:5707066-5707088 GCAAGCTGCAGCAGCGCCTGGGG - Exonic
1162013279 19:7830581-7830603 GGATCCTGCAGGAGCTCCTGGGG - Intronic
1163062754 19:14772267-14772289 GGATGCTGCAGAAACAGCTCTGG + Intronic
1163609650 19:18294312-18294334 GCATGCTCCAGAAGCAGCAGGGG + Intergenic
1164886637 19:31783911-31783933 CGATGCTGCAGGAACACCTGTGG + Intergenic
1167014458 19:46831544-46831566 GCAAGCTGCAGAACCACATACGG + Intergenic
1168045454 19:53791002-53791024 GTTTGCTTCAGAAGCAGCTGTGG + Intergenic
1202700465 1_KI270712v1_random:160180-160202 TCATGCTGGAGACCCACCTGTGG - Intergenic
925180873 2:1816301-1816323 GAATGAAGCAGAAGCACTTGGGG + Intronic
925348094 2:3184283-3184305 CCATGCTGCAGAGGCGCCTGCGG + Intergenic
925475917 2:4214871-4214893 GCATGCAACAGAATCGCCTGGGG + Intergenic
927071374 2:19533076-19533098 TCATACTGCAGAAGAACATGTGG + Intergenic
927211343 2:20640868-20640890 CCAGGCTGCAGAGGCAGCTGTGG + Intronic
930221731 2:48753097-48753119 GTATGCATCAGAATCACCTGAGG + Intronic
931168332 2:59775567-59775589 GTCTGAGGCAGAAGCACCTGGGG + Intergenic
932497983 2:72156513-72156535 CCACACTGGAGAAGCACCTGAGG - Intergenic
934171393 2:89543653-89543675 TCATGCTGGAGACCCACCTGTGG - Intergenic
934281702 2:91617971-91617993 TCATGCTGGAGACCCACCTGTGG - Intergenic
935644824 2:105325586-105325608 GCATGCTGCTGCAGTTCCTGAGG + Intronic
937091904 2:119212144-119212166 CCATGCTACACGAGCACCTGAGG + Intergenic
937280206 2:120712564-120712586 GCAGGCTGCGGAGGCCCCTGAGG - Intergenic
937924489 2:127157497-127157519 CCATGCATTAGAAGCACCTGGGG + Intergenic
938398432 2:130967561-130967583 GCATGCTGCAGAAGCCTGCGGGG - Intronic
938670537 2:133582305-133582327 GCATCCATCAGAATCACCTGGGG - Intergenic
943696556 2:190941945-190941967 ACCTACAGCAGAAGCACCTGGGG - Intronic
944341875 2:198610979-198611001 GCATTCATCAGAATCACCTGGGG - Intergenic
944643086 2:201747773-201747795 GCATACATCAGAATCACCTGTGG - Intronic
945813674 2:214577559-214577581 GCAAGCTCTAGCAGCACCTGTGG + Exonic
945987913 2:216370128-216370150 GCATGCGGCAGCGGCACTTGAGG + Exonic
1169924600 20:10769603-10769625 GCATGCATCAGTATCACCTGGGG - Intergenic
1170093424 20:12617642-12617664 GCATGCTGCTCAGGGACCTGAGG + Intergenic
1170608264 20:17890228-17890250 CCATGCTGCAGAAGAGCATGTGG - Intergenic
1171559071 20:26105651-26105673 GCATGCATCAGAATCACCTGAGG - Intergenic
1172478870 20:35259285-35259307 ACCTGCAGCAGAACCACCTGTGG - Intronic
1173148999 20:40550010-40550032 GCATGCATCAGAATGACCTGTGG + Intergenic
1175492744 20:59390127-59390149 GGATGCTGCAGAAGCCCGTGTGG + Intergenic
1179022553 21:37653419-37653441 CCAGGCTGCAGAAGCAGATGGGG + Intronic
1179311905 21:40203509-40203531 GCATATTGCAGAAGCAGCTCAGG + Intronic
1179320525 21:40286890-40286912 TCATGCTTCAGATCCACCTGTGG - Intronic
1184032244 22:41901957-41901979 GCATGCTGCAGAAGCACCTGTGG - Intronic
1184533234 22:45070276-45070298 GAATGAGGCAGAAGCAGCTGGGG + Intergenic
1184613500 22:45622045-45622067 GGTGGCTGCAGAAGCACCTGGGG - Intergenic
1185035896 22:48476736-48476758 GCAGGATGGAGAAGGACCTGGGG + Intergenic
949297540 3:2543369-2543391 GCATGCTGGAGAGGCAGTTGTGG + Intronic
950744332 3:15074667-15074689 GCACTCTGCAGGAGAACCTGCGG - Exonic
951820562 3:26806026-26806048 ACATGCAGAAGAAGCACCTAAGG + Intergenic
952926797 3:38326366-38326388 GCCTGCAGGAGCAGCACCTGTGG + Intergenic
955204605 3:56884507-56884529 GCGTGCAGCAGAATCACCTGAGG + Intronic
955933194 3:64078144-64078166 GTATGCATCAGAATCACCTGGGG - Intergenic
956559996 3:70564889-70564911 CACTGCTGCAGAAGCAACTGTGG - Intergenic
959577668 3:107951839-107951861 CCATGCCGAAGAAGCACCTGGGG + Intergenic
959648668 3:108730501-108730523 ACATGTTGCAGAAGCAGCTGAGG - Intergenic
960639191 3:119810459-119810481 GAATGATGCAGGAGCAACTGAGG - Intronic
961116999 3:124339066-124339088 GAATGCTTAAGAATCACCTGGGG - Intronic
961237112 3:125376100-125376122 GCAGTATGCAGAAGCACCTCAGG - Intergenic
961319136 3:126060917-126060939 GCCTGTTGCAGAAGCTCCTCAGG - Intronic
962140347 3:132783849-132783871 ACATGCATCAGAATCACCTGGGG + Intergenic
962600115 3:136985108-136985130 GCTTGCTGCAGGGGCAGCTGAGG + Intronic
962679583 3:137784379-137784401 CCATGCTTCAGAAGCACCCGTGG - Intergenic
962824676 3:139089184-139089206 GGTGGCTGCAGCAGCACCTGGGG + Intronic
963879651 3:150514708-150514730 GCATCCTGCAGAAACAACTGGGG + Intergenic
964333645 3:155631814-155631836 GAATAATGCAGAAGCACCTGTGG + Intronic
964380695 3:156096438-156096460 TCCTGCTGCACAATCACCTGTGG - Intronic
965786578 3:172341199-172341221 GCATGCTGCATCAGTACCGGCGG + Exonic
966863094 3:184241484-184241506 GCCTCCTGCAGCCGCACCTGAGG - Exonic
968446189 4:653507-653529 GGCTGCTCCAGAACCACCTGCGG - Intronic
968524315 4:1048236-1048258 GCCTGCTGTAGGAGCTCCTGTGG + Intergenic
969028364 4:4192235-4192257 TCATGCTGGAGACCCACCTGTGG + Intronic
969225332 4:5793636-5793658 GCGTGCTGCAGACACACCTGCGG + Exonic
969523711 4:7693501-7693523 GCAGGCTCCATAATCACCTGGGG - Intronic
970373790 4:15435830-15435852 GAATGCTGCAGATATACCTGGGG - Exonic
971787185 4:31119784-31119806 ACATGCTCCAGAAGAACCTGAGG + Intronic
974025463 4:56729572-56729594 CCATGCTGGAGAAGCCCCTATGG - Intergenic
975353836 4:73376189-73376211 GCATTATGCAGAGGCCCCTGTGG - Intergenic
977553419 4:98465687-98465709 GCACGCTGCATAAGTTCCTGAGG - Intergenic
979553360 4:122016533-122016555 ACAGGCTGCTGAAGCACCTGGGG - Intergenic
980972109 4:139576539-139576561 GCGTGCTTCAGAATCACCTGGGG + Intronic
984879647 4:184399282-184399304 GCATGCTGGAGATAGACCTGGGG - Intronic
985070011 4:186158523-186158545 GCCTGCTGCTGATGCAGCTGTGG + Intronic
986192117 5:5507374-5507396 GCATGCGGTAGGAGCTCCTGGGG - Intergenic
986759415 5:10866438-10866460 GCATCTTACAGAAGCATCTGTGG - Intergenic
987793814 5:22603494-22603516 GCCTGGTGCTGAAGCACCAGGGG + Intronic
987954045 5:24714924-24714946 GCAGACTCCAGAAGCAACTGTGG - Intergenic
988772982 5:34450430-34450452 GCATGCATCAGAATCCCCTGTGG + Intergenic
989348332 5:40454263-40454285 GAATCCTGCAGAAGCAACTGAGG - Intergenic
990106637 5:52271833-52271855 ACATGTTTCAGAATCACCTGAGG - Intergenic
990460272 5:56025041-56025063 ACATGCATCAGAATCACCTGAGG - Intergenic
992176425 5:74153843-74153865 GGATGCTTCAAAATCACCTGTGG + Intergenic
992690420 5:79236206-79236228 GCTTTCTGCAGCAGCACCAGGGG + Exonic
993020727 5:82587146-82587168 GCCTCATGCAGAAGCAGCTGTGG + Intergenic
993803413 5:92374460-92374482 GCAGGCTGCAGGAGCCCCAGTGG - Intergenic
995931557 5:117452598-117452620 GCAGGCATCAGAAGCACCTGGGG - Intergenic
996473759 5:123891052-123891074 GCATGCTCCAGAATGACCAGTGG + Intergenic
997754797 5:136386410-136386432 AGCTGCTGCAGTAGCACCTGCGG + Intronic
998629281 5:143880534-143880556 TCATTCTGAAGGAGCACCTGTGG - Intergenic
999344179 5:150800665-150800687 GTATGCAACAGAATCACCTGAGG + Intergenic
999404382 5:151293985-151294007 CCCTGCTGCAGAAACACCTTTGG + Intronic
1000135693 5:158348146-158348168 GCAGGCTGCAGAAGCTCCCCTGG + Intergenic
1001104872 5:168844289-168844311 GAATGCTGCAGGAGCACTGGGGG + Intronic
1001543038 5:172552441-172552463 GCAGGCAGCAGAATCACCAGGGG - Intergenic
1001691729 5:173638422-173638444 GCAGGCTGCAGAAGCAATTTGGG - Intergenic
1003112760 6:3263201-3263223 GCATGCTGCTCCAGCCCCTGTGG - Intronic
1003144209 6:3495981-3496003 GCATCCATCAGAATCACCTGGGG - Intergenic
1003184934 6:3822353-3822375 GTATGCAGAAGAACCACCTGGGG + Intergenic
1003250964 6:4428924-4428946 CCATGTGTCAGAAGCACCTGGGG - Intergenic
1004014239 6:11717899-11717921 CCATGCTTTAGAAGTACCTGTGG + Intronic
1006394660 6:33779332-33779354 GCATCCAGCAGAAGCCCCTCGGG - Intronic
1006897286 6:37479293-37479315 GCATCCTGCAGGAGTACTTGAGG - Intronic
1007922009 6:45618729-45618751 GCACTCAGCAGAAGCACCTGAGG + Intronic
1009827330 6:68883386-68883408 GCAGGCTGCAGCACCAGCTGCGG + Intronic
1013317399 6:108955882-108955904 GACTGCTGCAGAATCAGCTGTGG + Intronic
1013428574 6:110036192-110036214 GCATGCATCAGAATCACCAGAGG - Intergenic
1013822917 6:114176877-114176899 TCTGGCTGCAGAATCACCTGGGG - Intronic
1015682302 6:135821947-135821969 GCATGCATAAGAAGCACCTAAGG - Intergenic
1016073144 6:139764695-139764717 GGAGGCTGCAGAAGCACAAGTGG + Intergenic
1016789791 6:148056102-148056124 GCATGCTACAGTCACACCTGTGG + Intergenic
1017387211 6:153900459-153900481 CCCTGCTGCAGAAACACCAGAGG + Intergenic
1018024888 6:159797308-159797330 GCATCATGTAGAAGCACTTGTGG + Exonic
1019190953 6:170250329-170250351 AGAAGCTGCAGCAGCACCTGCGG + Intergenic
1019451279 7:1099928-1099950 CCGTGCGGCAGATGCACCTGAGG + Intronic
1019667114 7:2257467-2257489 GCGTGTTGCACAAGCACCAGCGG - Exonic
1023421755 7:39987800-39987822 GAAAGCTGCAGAAGCAACTAAGG + Exonic
1023837819 7:44078795-44078817 CCATGCTCCAGCAGCTCCTGGGG + Exonic
1025278610 7:57607913-57607935 GCATGCATCAGAATCACCCGAGG + Intergenic
1031557278 7:123193151-123193173 ACCTGCTCCAGAATCACCTGGGG + Intronic
1032411019 7:131693302-131693324 CCATGCTGCAGAAGATCCTGTGG + Intergenic
1034542784 7:151769722-151769744 GGATGCTGCAGCCGCATCTGGGG + Intronic
1035783028 8:2243888-2243910 GCCACGTGCAGAAGCACCTGTGG - Intergenic
1035809099 8:2475698-2475720 GCCACGTGCAGAAGCACCTGTGG + Intergenic
1039086733 8:33787708-33787730 ACCTACTGCAGAATCACCTGGGG - Intergenic
1041361969 8:57064338-57064360 GCATGCTCCACACGCACCTTGGG - Intergenic
1041856194 8:62458173-62458195 GCCTGTTTCAGAAGCAGCTGGGG - Intronic
1042510132 8:69602633-69602655 GTATGATGCAGCAGCACATGTGG - Intronic
1042528166 8:69787393-69787415 CCATGGTGCATAAGCACATGAGG - Intronic
1042932659 8:74029216-74029238 GCATCATGCAGAGCCACCTGGGG + Intergenic
1043011345 8:74885261-74885283 GCATGGTGCAGCAGCAGCAGAGG + Intergenic
1044863445 8:96545944-96545966 GGATGCTGCATAATCCCCTGAGG + Intronic
1047460355 8:125057980-125058002 GCATGCATCAGAATCACCTGCGG - Intronic
1050243013 9:3658367-3658389 GCATGCTGCCTTAGGACCTGGGG - Intergenic
1050249176 9:3725750-3725772 GCATGAATCAGAAGCTCCTGAGG - Intergenic
1051658426 9:19404524-19404546 GCATGAGTCAGAATCACCTGAGG + Intergenic
1056808924 9:89749237-89749259 GCATGGGGCAGCAGGACCTGGGG + Intergenic
1061004709 9:127921943-127921965 GCAAGCGGCTGGAGCACCTGTGG - Exonic
1203625528 Un_KI270750v1:15757-15779 GCATGGTGCAAAAGCAATTGCGG - Intergenic
1185713541 X:2323329-2323351 GGATGCTACAGAAACACGTGAGG + Intronic
1186446473 X:9634386-9634408 GTATGCTGTAGAAGCACTTATGG + Intronic
1186566758 X:10671563-10671585 GTATGCTGCACTAGGACCTGGGG - Intronic
1188934241 X:36153784-36153806 GTCTGCTGAAGCAGCACCTGGGG + Intergenic
1189867516 X:45346519-45346541 ACCTGCATCAGAAGCACCTGGGG + Intergenic
1190051903 X:47156787-47156809 TCATGCTGCTGCAGCAGCTGTGG + Intronic
1190235688 X:48613670-48613692 GCAGGGTGCAGAAACTCCTGGGG - Intergenic
1190482257 X:50889400-50889422 CCATGCTGCAGCTGCACCTCTGG - Intergenic
1195174169 X:102298565-102298587 GCATGCTACGGCAGCAACTGTGG - Intergenic
1195184696 X:102388527-102388549 GCATGCTACGGCAGCAACTGTGG + Intronic
1195722147 X:107877567-107877589 GCAGGCTGCAATGGCACCTGTGG - Intronic
1197963840 X:132034801-132034823 GCATGCATGGGAAGCACCTGGGG + Intergenic
1199684633 X:150255193-150255215 GCATGCACGAGAAGCACCTGGGG + Intergenic
1200215198 X:154365225-154365247 GCGTGAAGCAGAAGGACCTGGGG - Exonic
1202231661 Y:22664881-22664903 GCCTGCCGCAGAAGGGCCTGGGG - Intergenic
1202311497 Y:23531284-23531306 GCCTGCCGCAGAAGGGCCTGGGG + Intergenic
1202559305 Y:26139310-26139332 GCCTGCCGCAGAAGGGCCTGGGG - Intergenic