ID: 1184032341

View in Genome Browser
Species Human (GRCh38)
Location 22:41902525-41902547
Sequence CTGTCGATGGGGCTGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 732
Summary {0: 1, 1: 0, 2: 4, 3: 72, 4: 655}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184032341_1184032354 18 Left 1184032341 22:41902525-41902547 CCTTCCCCCAGCCCCATCGACAG 0: 1
1: 0
2: 4
3: 72
4: 655
Right 1184032354 22:41902566-41902588 GCTTTTCCTTGGTACCTTGTGGG 0: 1
1: 0
2: 2
3: 16
4: 141
1184032341_1184032350 -4 Left 1184032341 22:41902525-41902547 CCTTCCCCCAGCCCCATCGACAG 0: 1
1: 0
2: 4
3: 72
4: 655
Right 1184032350 22:41902544-41902566 ACAGGCTCTGCTGCCACTTCAGG 0: 1
1: 1
2: 2
3: 30
4: 239
1184032341_1184032351 7 Left 1184032341 22:41902525-41902547 CCTTCCCCCAGCCCCATCGACAG 0: 1
1: 0
2: 4
3: 72
4: 655
Right 1184032351 22:41902555-41902577 TGCCACTTCAGGCTTTTCCTTGG 0: 1
1: 1
2: 4
3: 20
4: 188
1184032341_1184032353 17 Left 1184032341 22:41902525-41902547 CCTTCCCCCAGCCCCATCGACAG 0: 1
1: 0
2: 4
3: 72
4: 655
Right 1184032353 22:41902565-41902587 GGCTTTTCCTTGGTACCTTGTGG 0: 1
1: 0
2: 2
3: 13
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184032341 Original CRISPR CTGTCGATGGGGCTGGGGGA AGG (reversed) Intronic
900295456 1:1946916-1946938 GTGCAGCTGGGGCTGGGGGAAGG + Intronic
900415592 1:2533045-2533067 CTGCGGAGGGGGCTGGAGGAGGG + Intergenic
900478539 1:2887402-2887424 CTGAGGATGGGGGTCGGGGAAGG + Intergenic
900593827 1:3471525-3471547 CATGGGATGGGGCTGGGGGAGGG + Intronic
901644505 1:10709300-10709322 GTGAGGATGGGGCTGGGGGCAGG - Intronic
902631178 1:17705557-17705579 CTAGAGCTGGGGCTGGGGGAGGG + Intergenic
902733789 1:18386769-18386791 CAGACAATGGGGCTGGAGGAAGG + Intergenic
902754945 1:18542736-18542758 CTGAGGCTGGGGCTGGGGGTGGG + Intergenic
902814542 1:18908637-18908659 CTGGCCACGGAGCTGGGGGACGG + Exonic
902837944 1:19058708-19058730 CTGTCGCTTGTGCTGGAGGACGG - Intergenic
903157851 1:21460371-21460393 CTGTCCCTGGGGTTGGGGGCTGG - Intronic
903181769 1:21608493-21608515 CTGTGGAGTGGCCTGGGGGAAGG - Intronic
903557862 1:24206404-24206426 CTGTGCCTGGGGCTGGGGAAGGG - Intergenic
903827510 1:26156536-26156558 CTCTGGTGGGGGCTGGGGGAGGG - Intergenic
904276932 1:29390949-29390971 TTGTCGATGGGGCTGGTGGCTGG + Intergenic
904379556 1:30101750-30101772 CTGTAGAAGAGGCTGGGGAAGGG - Intergenic
904620252 1:31770856-31770878 CTGTGGATGGGGTGGGGGTAGGG + Intergenic
904906568 1:33901535-33901557 GTGTGGGTGGGGCTGAGGGAGGG + Intronic
905015219 1:34773493-34773515 CTGTCGCTGGGTCGGGGGCAAGG + Intronic
905107239 1:35571508-35571530 CTGTGGCTGGGGTTGAGGGAGGG + Intergenic
905336058 1:37245349-37245371 CTGCAGGTGGGGCTGGGAGAAGG - Intergenic
905519445 1:38586802-38586824 GTGTCGATGGGGGCGGGGCAGGG + Intergenic
905732731 1:40307668-40307690 CTGCTGATGGGACTGGGGCAGGG - Intronic
906513864 1:46426718-46426740 ATGTCCGTGGGGCTGTGGGATGG + Intergenic
906703520 1:47877194-47877216 TTGGCAATGGGGCTGGGGGGTGG + Intronic
906715501 1:47965560-47965582 TTGGGGTTGGGGCTGGGGGAGGG - Intronic
907334697 1:53692616-53692638 CTGTGGGTGTAGCTGGGGGAGGG + Intronic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
908018615 1:59875966-59875988 CTGACCCTGGGGCTTGGGGATGG + Exonic
908389943 1:63675267-63675289 CTGCTGAAGGAGCTGGGGGAGGG + Intergenic
908624075 1:66020462-66020484 CTGTCCATGGGGTGGGGGGAGGG - Intronic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909677689 1:78256464-78256486 CTGTCGGTGAGGCTTGGAGATGG - Intergenic
909700856 1:78521077-78521099 GTGTCTATAGAGCTGGGGGATGG - Intronic
910864709 1:91777564-91777586 TTGGGGCTGGGGCTGGGGGAAGG - Intronic
910937716 1:92499199-92499221 CTGTCGGTGGGAGTGGGGGTAGG + Intergenic
911102334 1:94104584-94104606 CTGTCCATGCAGCTGGGGCAGGG + Intronic
912490026 1:110057669-110057691 CTGTGGAGGAGGCTGGGGCAGGG + Intronic
913069485 1:115286033-115286055 GTGTAGAAGGGGCAGGGGGAGGG + Exonic
913466357 1:119147233-119147255 CTGGGGAAGGGGCTGGCGGAGGG - Intergenic
914429159 1:147604240-147604262 CTGTGGATAGACCTGGGGGACGG - Intronic
915951032 1:160190200-160190222 ATGAAGCTGGGGCTGGGGGAGGG - Intergenic
917061800 1:171049315-171049337 CTGCCACTGGGGCTGGGGGTGGG - Intronic
918133180 1:181646645-181646667 CTGTCTCTGGGGCTGGGGGCTGG + Intronic
918950033 1:191125451-191125473 CTGAGGATGGGGTTGGGAGAAGG - Intergenic
919541053 1:198845882-198845904 CGGTCGCCGGGGCTGGGGGGAGG + Intergenic
919866847 1:201788857-201788879 CCATCACTGGGGCTGGGGGAGGG + Intronic
920347758 1:205317586-205317608 CGGTAGAGGGGGCTGGAGGATGG - Intronic
920350866 1:205337071-205337093 CTGGAGATGGGGGTGGGGGGAGG + Exonic
920371302 1:205481075-205481097 AGGAAGATGGGGCTGGGGGAGGG - Intergenic
920387779 1:205580540-205580562 CAGAGGGTGGGGCTGGGGGAGGG + Intronic
921014852 1:211179837-211179859 CTGAGGGTGGGGCTGGGGAAAGG - Intergenic
921264880 1:213414103-213414125 CTGGAGGTGGGGATGGGGGAAGG + Intergenic
921333774 1:214065926-214065948 GTGTTGATGTGGGTGGGGGAGGG - Intergenic
921468745 1:215523044-215523066 CTGGAGATGGGGTTGGGGGCAGG - Intergenic
921498890 1:215875987-215876009 CTATGGAGGGGGCGGGGGGAAGG + Intronic
921709603 1:218360507-218360529 CTGTCAGTGGGGATGGGGTAGGG + Intronic
921786479 1:219236902-219236924 CTGTCAAGGGGTGTGGGGGAGGG - Intergenic
921951232 1:220932193-220932215 GTGTCCATGGGGCTGGGGGTGGG + Intergenic
922719629 1:227893614-227893636 CAGCCCATGTGGCTGGGGGAAGG + Intergenic
922811378 1:228417074-228417096 CTGGGGTTGGGGCTGCGGGAGGG + Intergenic
922998003 1:229982266-229982288 CTGTGGATGGGTCTGGGGCTGGG - Intergenic
923047501 1:230366325-230366347 CTGCAGATGGGGCTGGGGGGTGG + Intronic
923261780 1:232274505-232274527 CAAAGGATGGGGCTGGGGGAGGG + Intergenic
924090671 1:240497586-240497608 CTGTCGATGACGCTGGGCAAAGG + Intronic
924487434 1:244499490-244499512 CTGTCGAGGGGTGGGGGGGAAGG - Intronic
924736488 1:246761564-246761586 CGGTTGCCGGGGCTGGGGGAGGG - Intronic
1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG + Intergenic
1063367509 10:5500026-5500048 CTGAGGCTGGGGCTGGTGGAAGG + Intergenic
1063680465 10:8182359-8182381 CTGGGGGTGGGGGTGGGGGAAGG + Intergenic
1064243416 10:13650618-13650640 CTGGCACTGGGGCTGGGGGAGGG + Intronic
1065000608 10:21334631-21334653 GTGTCTCTGGGGCTGGGGGCTGG - Intergenic
1065356384 10:24846049-24846071 TTGTTGATGGGGGTGGGGGTTGG - Intergenic
1066271383 10:33827540-33827562 CTGTTGGTGGGGCAGGGGGATGG + Intergenic
1066431617 10:35357184-35357206 CTGGGGCTGGGGCTGGGGCAGGG - Intronic
1067317247 10:45180334-45180356 CTGGGGCTGGGGCTGGGGAAGGG + Intergenic
1067835824 10:49640700-49640722 CTGGCAAGGGTGCTGGGGGAGGG + Intronic
1070531426 10:77340705-77340727 CTGTCGTGGGGTCGGGGGGAGGG + Intronic
1070750077 10:78958880-78958902 CTGGAGATGGGGCGGGGGGCAGG - Intergenic
1070772083 10:79088412-79088434 CTTGCCATGGTGCTGGGGGAGGG + Intronic
1070800410 10:79242023-79242045 AGGTGGGTGGGGCTGGGGGAGGG + Intronic
1070835401 10:79444587-79444609 CTTCCTATGTGGCTGGGGGAGGG + Intronic
1071526974 10:86364747-86364769 CTGTCGAGGGGAGTGGGGGAAGG + Intronic
1072364555 10:94695916-94695938 ATGGCAATGAGGCTGGGGGAGGG + Intronic
1073423080 10:103440066-103440088 CTGTTGTTGGGGATGGTGGAGGG + Intronic
1073473046 10:103735703-103735725 GTGTATCTGGGGCTGGGGGAGGG - Intronic
1074781364 10:116804540-116804562 CTGTGGCTGGGGCTGGGGGCTGG - Intergenic
1075259873 10:120953956-120953978 GTGTGGCTGGGGCTGGGAGAGGG + Intergenic
1075929407 10:126282862-126282884 CTGGGGCTGGGGGTGGGGGATGG + Intronic
1076596953 10:131629279-131629301 CTGGGGGTGGGGCTGAGGGAAGG + Intergenic
1076826377 10:132971689-132971711 CTCTCGGTGGGGCTGGGAGTGGG + Intergenic
1076987776 11:251844-251866 CTTTCGGTGGGGCTGGTGAAAGG + Exonic
1077006253 11:358799-358821 CTGTTGGTGGAGCTGGGGGGCGG + Intergenic
1077260040 11:1612536-1612558 CTGGTGATGGGGGTGGGGGCTGG - Intergenic
1077460951 11:2709233-2709255 CTGCAGCTGGGGCTGGGGGGTGG - Intronic
1077488028 11:2848005-2848027 GAGGGGATGGGGCTGGGGGATGG + Exonic
1077537439 11:3131199-3131221 CTGTCATTGGTGCTGGGAGAAGG - Intronic
1077880577 11:6346492-6346514 CTGTGGGCGGGGTTGGGGGATGG - Intergenic
1077880837 11:6348299-6348321 CAGTAGCTGGGGCTGGGGGTTGG + Intergenic
1079371169 11:19854022-19854044 CCGAGGTTGGGGCTGGGGGAAGG + Intronic
1079408902 11:20168245-20168267 CTGTTTGTGGGGCTTGGGGATGG - Intergenic
1079409527 11:20174387-20174409 CTGCCTATGGGACTGGGGAAAGG + Intergenic
1079579840 11:22050271-22050293 CTGTGGTTGGGAGTGGGGGAGGG - Intergenic
1080235372 11:30062528-30062550 CTGACAAAGGGCCTGGGGGAGGG - Intergenic
1080635626 11:34120968-34120990 ATGTGCATGGGCCTGGGGGAGGG + Intronic
1081997360 11:47374206-47374228 CTGGGGATGGAGTTGGGGGAGGG + Intronic
1083339883 11:61952107-61952129 CTGAGGCTGGGGCTGGGGGCTGG + Intronic
1083540001 11:63505989-63506011 CTGTCCAGGGAGCTGGGGGTGGG + Intergenic
1083638375 11:64132428-64132450 CTGGGGGTGGGGCGGGGGGAGGG + Intronic
1083664558 11:64267434-64267456 ATGCCGGAGGGGCTGGGGGACGG + Exonic
1083666668 11:64279020-64279042 CTGCAGCTGGGGCTGGGGGGAGG + Intronic
1083889726 11:65589774-65589796 CTGTGGGTGGGCCTGGGGCAGGG - Exonic
1083997262 11:66278549-66278571 CTGGGGCTGGGGCTGGGGGCGGG + Intronic
1084546389 11:69817141-69817163 CTGTGGTGGGGGCTGGGGGCGGG + Intronic
1084857550 11:71998699-71998721 ATGGCGCTGGGGCTGCGGGAGGG - Intronic
1085309021 11:75505331-75505353 CTGGGGGTGGGGCTGGGGGCCGG - Intronic
1085639970 11:78187529-78187551 TTCTGGAAGGGGCTGGGGGATGG - Intronic
1086154096 11:83646760-83646782 CTTAAGATGGGGGTGGGGGAGGG + Intronic
1087772646 11:102227305-102227327 CTGTCTATGGCCCTGAGGGAGGG + Intronic
1088638655 11:111849625-111849647 CTGTGGAGGGGGCGGAGGGAGGG - Intronic
1089378699 11:118012684-118012706 TTGGGGATGGGGCAGGGGGAGGG + Intergenic
1090352411 11:126115787-126115809 CCCTTCATGGGGCTGGGGGAGGG - Intergenic
1090417336 11:126549588-126549610 CTGGGGAGAGGGCTGGGGGAGGG + Intronic
1091614599 12:2039918-2039940 CTGGAGATGGGGATGGGGGTAGG + Intronic
1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG + Intronic
1091941149 12:4483703-4483725 GTGGTGATGGGGATGGGGGAGGG - Intergenic
1092290784 12:7158424-7158446 CTGGGGCTGGGGCTGGGGGTGGG + Exonic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1092936278 12:13367102-13367124 CTGTCCATTGGACTGGGGGAAGG + Intergenic
1093015491 12:14150707-14150729 CTGGAGATGGGGTTGGGGGGGGG - Intergenic
1094546853 12:31412398-31412420 CTGTCGCAGGGGCTGGGGAGGGG + Intronic
1094739238 12:33269780-33269802 TTCTCGATGGGGATGAGGGAGGG - Intergenic
1095183615 12:39175660-39175682 CTGGAGTTGGGGCAGGGGGATGG - Intergenic
1095741473 12:45611259-45611281 CTGGCGCTGGGGCTGGGGCTGGG + Intergenic
1096191758 12:49623987-49624009 CGGGCGCTGGGGCTGGGGGAAGG - Intronic
1096569124 12:52509856-52509878 CTATCAAAGGGGTTGGGGGAAGG - Intergenic
1096671290 12:53199678-53199700 GTGGGGATGGGGTTGGGGGATGG - Intronic
1096677096 12:53231903-53231925 CCGGCGAGGCGGCTGGGGGAGGG - Intronic
1096808103 12:54152571-54152593 GTGGAGATGGGGCAGGGGGAGGG + Intergenic
1096848228 12:54419319-54419341 CTGCCGAGGGGGCTGGCGGGGGG + Exonic
1097637139 12:62136980-62137002 CTGGGGATGGGGGTGGAGGATGG - Intronic
1097712684 12:62933687-62933709 GTGGCCATGGAGCTGGGGGAAGG + Intronic
1098981715 12:76963218-76963240 CTCTCTCTGGGGCTGGTGGAAGG + Intergenic
1099025469 12:77459688-77459710 CTGTGGACGAGGCTGGGGGAGGG + Intergenic
1099978358 12:89570199-89570221 CTGTCAGCGGGGCAGGGGGAGGG - Intergenic
1101036320 12:100710678-100710700 CTGTTGGTGGGGGAGGGGGAGGG + Intergenic
1101234543 12:102775478-102775500 CTCTCACTGGGGCTGTGGGAGGG - Intergenic
1101301129 12:103483803-103483825 ATGTGGTGGGGGCTGGGGGAGGG - Intronic
1101316357 12:103632576-103632598 ATGTCGAGAGGGCTGTGGGAAGG + Intronic
1102203259 12:111072804-111072826 CTGAAGTTGGGGTTGGGGGAGGG - Intronic
1102247223 12:111362996-111363018 CTGGGGCTGGGGCTGGGGCAGGG + Exonic
1102654469 12:114469909-114469931 CTGGGGATGGGGGTGGGAGAAGG - Intergenic
1102691675 12:114766230-114766252 CTGTGCATGGGTCTGGGGGGGGG - Intergenic
1102928936 12:116847995-116848017 CTGTTGCGGGGGCTGGGGGAGGG - Intronic
1104520727 12:129472426-129472448 CTGTCGTTGGGTTGGGGGGACGG + Intronic
1104622978 12:130332179-130332201 GGGTTGCTGGGGCTGGGGGAGGG - Intergenic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1104723617 12:131061055-131061077 CTGCAGTGGGGGCTGGGGGAGGG - Intronic
1104874512 12:132024683-132024705 CTGTCGAGGAAGGTGGGGGAAGG - Intronic
1104874521 12:132024721-132024743 CTGTCGAGGAAGGTGGGGGAAGG - Intronic
1105214764 13:18277719-18277741 CTGGGGGTGGGGCGGGGGGAGGG + Intergenic
1105705545 13:22965690-22965712 ATGTCCGTGGCGCTGGGGGATGG + Intergenic
1105734868 13:23257408-23257430 CTGTCCATGGGGTGGGGGAATGG - Intronic
1105858448 13:24390675-24390697 ATGTCCGTGGCGCTGGGGGAGGG + Intergenic
1106016622 13:25875079-25875101 CAGTTGCCGGGGCTGGGGGAGGG + Intronic
1108860607 13:54854118-54854140 GTGGGGATGGGGGTGGGGGAGGG - Intergenic
1109309111 13:60671767-60671789 CTTTGCATGGGGATGGGGGATGG + Intergenic
1109741856 13:66563956-66563978 CTGTCGAAAGGGCTGTGGTAAGG - Intronic
1111915463 13:94355928-94355950 CTGTTGTGGGGGCAGGGGGAGGG - Intronic
1113209640 13:107960539-107960561 CTTTGCAGGGGGCTGGGGGATGG + Intergenic
1113264186 13:108598995-108599017 CTGGGGATGGGGTGGGGGGAGGG - Intronic
1113452771 13:110423433-110423455 CTGTGGGTGGGTCGGGGGGAGGG + Intronic
1113483334 13:110637448-110637470 CTGTGGATGGGGCCTGGGGCAGG + Intronic
1113574414 13:111383865-111383887 CTGGCTGTGGGGCTGGGAGAAGG + Intergenic
1113976419 13:114231131-114231153 CTGGCGGTGGGGCTGGTGGGAGG + Intergenic
1113976451 13:114231245-114231267 CTGGCGGTGGGGCTGGTGGGAGG + Intergenic
1113976505 13:114231416-114231438 CTGGCGGTGGGGCTGGTGGGAGG + Intergenic
1114093197 14:19305959-19305981 GTGTGGATGGGGGTGGGGGGTGG - Intergenic
1114549878 14:23526554-23526576 CTGGAGATGGGGCTGGAGAAGGG + Exonic
1114600447 14:23951966-23951988 CTGTGTGTGCGGCTGGGGGAGGG - Intergenic
1116373829 14:44171870-44171892 CTGTCGGGGGGGTGGGGGGAGGG - Intergenic
1116671836 14:47851961-47851983 CTGTCGGGGGGGTTGGGGGAGGG + Intergenic
1116855044 14:49944666-49944688 CTGTGGGTGGGAGTGGGGGATGG + Intergenic
1116956897 14:50933252-50933274 CTTTCTATGGGGCTGCAGGAAGG - Intronic
1117240349 14:53825974-53825996 CTGTCTCTGGGGCAGGGAGAGGG + Intergenic
1117470689 14:56041317-56041339 CTGAGGATGGGGCTGGGGTCAGG + Intergenic
1117472992 14:56065360-56065382 CTGTCAGCGGGGCAGGGGGAAGG + Intergenic
1117888190 14:60387617-60387639 CTGTCGGTGGGGCGGGGGCCTGG + Intergenic
1118610561 14:67536300-67536322 CTGGGGATGAGGCTGGGAGAAGG - Intronic
1118693835 14:68364527-68364549 GAGTGGAAGGGGCTGGGGGAGGG - Intronic
1118805408 14:69232199-69232221 CTGTCTTTTGGGCTAGGGGAGGG + Intronic
1119756537 14:77124008-77124030 ATATCCATGGGGGTGGGGGAAGG - Intronic
1119914466 14:78384376-78384398 CTGTCATTGGGGGTTGGGGATGG - Intronic
1120684698 14:87524660-87524682 CTGTCGAGGGGGCAGGAGGAGGG + Intergenic
1121252966 14:92513538-92513560 CTGTGGCTGGGGCTGGGGCGCGG - Intergenic
1121325432 14:93016920-93016942 CTGGAGATGGGGCAGGAGGAGGG + Intronic
1121449471 14:93998252-93998274 CTGGGGCTGGGGCTGGGGCAGGG - Intergenic
1122097912 14:99384809-99384831 CTGGAGCGGGGGCTGGGGGAGGG - Intergenic
1122534356 14:102451906-102451928 CTGGGGATGGGGCCGGGGGGTGG - Intronic
1123207969 14:106731982-106732004 CTGTTGTGGGGGTTGGGGGAGGG - Intergenic
1123499752 15:20868921-20868943 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1123593225 15:21879884-21879906 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1124081496 15:26502160-26502182 ATGCCGCTGCGGCTGGGGGATGG + Intergenic
1124239754 15:28019640-28019662 CTGTGGAGGAGGCTGGGTGAAGG - Intronic
1124552274 15:30692889-30692911 CTGTTTCTGGGGCTTGGGGAAGG + Intronic
1124678965 15:31712777-31712799 CTGTTTCTGGGGCTTGGGGAAGG - Intronic
1125129689 15:36268928-36268950 GTGGTGATGGGGTTGGGGGAGGG + Intergenic
1127114367 15:55709843-55709865 CTGGCGATGGGGAGGAGGGAGGG + Intronic
1127447205 15:59076153-59076175 CTGTGGAGGGGGCTGGGGCTGGG - Exonic
1127725505 15:61745388-61745410 CTGTGGACGGGGCAAGGGGATGG - Intergenic
1127765046 15:62177414-62177436 CTGTCGGGGGGGTGGGGGGAGGG + Intergenic
1127774216 15:62253000-62253022 CTGGGGACTGGGCTGGGGGAAGG - Intergenic
1128367330 15:67013709-67013731 CTGTGGATGGTGGTGGGGAAGGG - Intergenic
1128467891 15:67928154-67928176 CTGCCGAGAGGGCTGGGGGTGGG + Intergenic
1129697578 15:77749377-77749399 CTGGAGATGGGGCTGGTGGGAGG - Intronic
1129843682 15:78758572-78758594 CTGTAGCTGGGGCTGGTGGTGGG + Intergenic
1129847375 15:78774109-78774131 CTGCCAGTGGGGCTGGGGGCAGG + Intronic
1129910590 15:79222899-79222921 CAGTCCGTGGGGCAGGGGGAAGG - Intergenic
1130327867 15:82896071-82896093 CTGTAGAGGGGGCTGGAGGTGGG + Intronic
1131082773 15:89550796-89550818 CTGTTGGTAGGGATGGGGGAAGG + Intergenic
1131157073 15:90081830-90081852 CTGACGGCGGGGCTGGGGGAGGG - Exonic
1131405871 15:92163898-92163920 CACTCTGTGGGGCTGGGGGAAGG - Exonic
1131600838 15:93847162-93847184 CTGTTTGTGGGGTTGGGGGAGGG + Intergenic
1131856402 15:96600993-96601015 CTATTGATGGTGCTGAGGGAAGG + Intergenic
1132236875 15:100228778-100228800 CTGTCCAATGGTCTGGGGGAAGG + Intronic
1202965344 15_KI270727v1_random:169808-169830 CTGTGGATGGGGGAGGGAGAGGG + Intergenic
1132470800 16:101878-101900 GTGTCAATGGGGCTGGGGTCAGG - Intronic
1132579857 16:679914-679936 CTGCGGATGGGGCTGGGGGCGGG + Intronic
1132588515 16:716341-716363 TTGTTGGTTGGGCTGGGGGAGGG - Intronic
1132686574 16:1164749-1164771 CTGTCGGTGGAGCTGGGGTCTGG + Intronic
1133232565 16:4373421-4373443 ATGGGGATGGGGCTGGGGGCTGG + Intronic
1133320888 16:4913204-4913226 CTGTCTGTGGTTCTGGGGGACGG - Intronic
1133771468 16:8869079-8869101 CGGCCAATGGGGCTGCGGGAGGG + Intergenic
1133965405 16:10527503-10527525 TTGTCCATATGGCTGGGGGATGG - Intergenic
1134072979 16:11272191-11272213 GTGGCAGTGGGGCTGGGGGATGG - Intronic
1134086662 16:11362105-11362127 CGGTCCATGGGGGTGGGGGGAGG - Intronic
1134296584 16:12951620-12951642 CTGGGGATGGCGGTGGGGGAGGG + Intronic
1134767067 16:16769150-16769172 CTGTCAGTGGGGCTAGGGGAGGG - Intergenic
1135675700 16:24413202-24413224 CTGGAGATGGGACTGGGTGAGGG - Intergenic
1136114834 16:28087971-28087993 GTGTCTGTGGGGTTGGGGGAGGG - Intergenic
1136662646 16:31777954-31777976 CTGTCGAGGGGGGTGGGAGGAGG + Intronic
1136773676 16:32860290-32860312 CTATGGATGGGGCCGGGGCAGGG - Intergenic
1136896936 16:34001229-34001251 CTATGGATGGGGCCGGGGCAGGG + Intergenic
1138605596 16:58086318-58086340 ATGGCGGTGGGGCTTGGGGACGG + Intergenic
1138879317 16:60991522-60991544 CTGTCATGGGGGTTGGGGGAAGG - Intergenic
1139692053 16:68647255-68647277 TTGACAATGGGGCGGGGGGAGGG - Intronic
1139922510 16:70468961-70468983 CTGTCCAGGTGACTGGGGGAGGG + Exonic
1140057805 16:71540808-71540830 CTGTTGCTGGGGGTTGGGGATGG - Intronic
1140126086 16:72120078-72120100 CTGTGGAGGTGGCTGTGGGAAGG + Exonic
1140279763 16:73543827-73543849 CTGGAGAAGGGGGTGGGGGAGGG + Intergenic
1140872672 16:79121494-79121516 CTGTTTACGGGGCTGTGGGATGG + Intronic
1141629081 16:85277080-85277102 CTGGGGAAGGAGCTGGGGGAGGG + Intergenic
1142203100 16:88770401-88770423 CTGTCTGTGGGGTGGGGGGACGG + Intronic
1142228358 16:88888317-88888339 CTGTGGCCTGGGCTGGGGGAGGG - Intronic
1203080095 16_KI270728v1_random:1142557-1142579 CTGGCGGCGGGGCTGGGGGTAGG + Intergenic
1142476145 17:191555-191577 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476155 17:191582-191604 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476165 17:191609-191631 CTGTCGCAGGGGCGGGGGAACGG - Intergenic
1142476174 17:191636-191658 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476192 17:191688-191710 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476202 17:191715-191737 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476212 17:191742-191764 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476263 17:191876-191898 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476300 17:191977-191999 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476310 17:192004-192026 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476330 17:192058-192080 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476370 17:192164-192186 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476380 17:192191-192213 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476437 17:192349-192371 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476457 17:192403-192425 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476467 17:192430-192452 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476477 17:192457-192479 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476487 17:192484-192506 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476514 17:192558-192580 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476524 17:192585-192607 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476553 17:192663-192685 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142476563 17:192690-192712 CTGTCGCGGGGGCGGGGGAACGG - Intergenic
1142710849 17:1723220-1723242 ATGTCACTGTGGCTGGGGGAAGG - Intronic
1143007342 17:3845815-3845837 GTGTTGAGGGGGCTGGGGGGTGG - Intronic
1143421047 17:6792551-6792573 GTGTAGATGGGGCTGAGGGCTGG - Intronic
1143622951 17:8091401-8091423 ATGTCAATGTGGCTGGGGCAGGG + Intergenic
1145969075 17:28944779-28944801 CTATTGATGGGGCCGGGCGAGGG + Intronic
1146095982 17:29930409-29930431 CTGTGGAGTGGGGTGGGGGAAGG + Intronic
1146514132 17:33475798-33475820 CAGGGGATGGGGATGGGGGAGGG - Intronic
1146911284 17:36649939-36649961 CTGACCTGGGGGCTGGGGGAGGG + Intergenic
1147249234 17:39143354-39143376 CTGGGGAGTGGGCTGGGGGAAGG - Intronic
1148206163 17:45781561-45781583 CTCTGGCTGGGGCTGAGGGAAGG + Intergenic
1148437254 17:47694207-47694229 CTGGGGCTAGGGCTGGGGGAGGG + Intronic
1148680425 17:49470428-49470450 CTGGGGATCGGGGTGGGGGAGGG + Intronic
1150317153 17:64178554-64178576 GTGGCGGTGGGGGTGGGGGAAGG + Intronic
1150486768 17:65549577-65549599 CTGTCGTTGGCGCTGGTGGCTGG + Exonic
1151032106 17:70753324-70753346 TTTTCCATGGGGTTGGGGGATGG - Intergenic
1151342493 17:73480994-73481016 CTGTGGATGGTACTTGGGGAAGG + Intronic
1151355583 17:73556045-73556067 CTGTCCATGGGGCTTGGGCTTGG + Intronic
1151371444 17:73648651-73648673 CTGTAGGTGGGGCTGGGCCAGGG + Intergenic
1151430974 17:74062894-74062916 TTGCAGATGGGGCTGGGGGTGGG + Intergenic
1151758369 17:76087431-76087453 CGGTCAAAGGGGCTGAGGGAGGG + Intronic
1152004594 17:77672165-77672187 CTCCCGCTTGGGCTGGGGGAAGG + Intergenic
1152024741 17:77801586-77801608 ATGTGGGTGGGGCTGGGGGTGGG - Intergenic
1152123348 17:78432366-78432388 CGGTCGATGGGGCAGGGTGCCGG - Intronic
1152250944 17:79212259-79212281 CTGGGGCTGGGGCTGGGGCAGGG + Intronic
1152855914 17:82664377-82664399 GTGCCGATGGTGGTGGGGGATGG + Intronic
1153058217 18:968887-968909 CAGGGGATGGGGCTAGGGGAGGG - Intergenic
1153226617 18:2905288-2905310 CTGTGGGTGGGGCGGGGGGGGGG + Intronic
1153526377 18:5998490-5998512 CTGAGGGTGGGCCTGGGGGAAGG + Intronic
1156000695 18:32380769-32380791 CTCTAGATGGCGCTGGGGTAGGG + Intronic
1156366081 18:36428539-36428561 CTGAGGGTGGGGCTGGGGGCGGG + Intronic
1156841811 18:41617867-41617889 CTGTCTGTGGAGGTGGGGGAAGG - Intergenic
1157257695 18:46153248-46153270 CTGAGGAAGGGGCTGGGGGAGGG + Intergenic
1157437383 18:47682344-47682366 ATCTGAATGGGGCTGGGGGAAGG - Intergenic
1157489929 18:48116124-48116146 CTGTCCTTGGGGGTGGGGGACGG - Intronic
1157812802 18:50709663-50709685 ATGTCATTGGGGATGGGGGAAGG + Intronic
1157816343 18:50731920-50731942 CTGTATTTGGGGGTGGGGGAAGG + Intergenic
1158468369 18:57712280-57712302 CTGGTGCTGGGGCTGGGGGAGGG - Intronic
1159143470 18:64424690-64424712 GTGGCAGTGGGGCTGGGGGAGGG + Intergenic
1159695075 18:71546797-71546819 CTGTCGTTGGGGGTGGAGTAGGG + Intergenic
1160704938 19:525223-525245 CCATCGCTGAGGCTGGGGGAGGG - Intergenic
1160923000 19:1529352-1529374 CTGTCCCTGGGGCTGGGGCCGGG + Intronic
1161686233 19:5704034-5704056 CTGCAGATGGGGCTGAGTGAAGG + Intronic
1161767938 19:6217182-6217204 TTGCCGAGGGGGCTGGGGGATGG - Intronic
1162142951 19:8595699-8595721 GGGCCGCTGGGGCTGGGGGAGGG - Intronic
1162344539 19:10111622-10111644 CTGGGGATGGGGCTGGGGCAGGG + Exonic
1162435079 19:10653509-10653531 CTGTCAATGGGGGAAGGGGAAGG + Intergenic
1162461803 19:10818044-10818066 CTTTAGAAGGGGCTAGGGGAGGG - Intronic
1162478029 19:10912615-10912637 CTCATGATGGGGCTGGGGGTGGG - Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162559947 19:11411298-11411320 CAGGCGATAGAGCTGGGGGAAGG - Intronic
1162666907 19:12221007-12221029 CTGTTGCTGGGGGTGGGAGAGGG + Intergenic
1162947991 19:14055049-14055071 GTGGGGATGGGGCTGGGGCATGG + Exonic
1163121447 19:15220648-15220670 CTCCCGATGGGGCAAGGGGAAGG - Intergenic
1163441199 19:17323554-17323576 CTGGGGCTGGGGCTAGGGGAGGG + Exonic
1163499797 19:17669510-17669532 CTGGGGCTGGGGCTGGGTGAAGG + Intronic
1163650187 19:18512986-18513008 CCCCCGATGGGCCTGGGGGAAGG + Intronic
1163823104 19:19507567-19507589 CTGGAGCTGGGGCTGGGGGCCGG - Exonic
1164051050 19:21586315-21586337 CTCTCGGGCGGGCTGGGGGAAGG - Intergenic
1164703682 19:30303985-30304007 CAGTCGATGGGGATGGGGACTGG + Intronic
1164889283 19:31809263-31809285 CTGTTGGGGGAGCTGGGGGAGGG + Intergenic
1164916209 19:32054170-32054192 CTGTCCCTGGAGCTGGGGGTGGG - Intergenic
1165394406 19:35556509-35556531 CAGTCACTGGGGCTGGGGGATGG - Intronic
1165709938 19:38003892-38003914 CTGGGGGTGGGGGTGGGGGATGG - Intronic
1165925002 19:39321096-39321118 CTGGGGGTGGGGCTGGGGAAGGG - Intergenic
1166644874 19:44524450-44524472 CTTTCAATGGGGCTTGGAGAGGG - Intronic
1166771744 19:45287578-45287600 CTGACCATGGGGCTGGAGGGGGG - Exonic
1166791932 19:45403893-45403915 CTGTCCTTGAGGCGGGGGGAGGG - Intronic
1166855331 19:45780370-45780392 CTGGATTTGGGGCTGGGGGAAGG + Exonic
1166892459 19:46001740-46001762 CTGTGGATGGGCCTGGGGGGTGG + Intronic
1167201813 19:48070737-48070759 CTGTTGAGGGGGCGGTGGGAGGG + Intronic
1167390336 19:49190534-49190556 CTGGCCATGGCTCTGGGGGAAGG + Intronic
1167412995 19:49355971-49355993 CTGCCCGTGGGGGTGGGGGAGGG + Intronic
1167490502 19:49790231-49790253 CTGCCTTTGGGGATGGGGGAAGG - Intronic
1167651415 19:50731805-50731827 CTGGCGAGGGGGATGGGAGAAGG - Intergenic
1167964297 19:53131261-53131283 CTGGCGTTGGGGCAGGGGGAGGG - Intronic
1168570470 19:57463457-57463479 CGAGGGATGGGGCTGGGGGAGGG + Intronic
1168714777 19:58520259-58520281 CTGTGGGTGGGACTGGGGAAAGG + Intronic
925156103 2:1649864-1649886 CTGTGTTTGGGGCTGGAGGAGGG - Intronic
925183340 2:1830925-1830947 ATGTCAATGGGGCTGGAGTAAGG + Intronic
925376530 2:3389657-3389679 CAGCCGAAGGGGGTGGGGGATGG + Intronic
926703502 2:15819885-15819907 CTGTGGCTGGGGCTGTGGGAGGG + Intergenic
927719134 2:25372083-25372105 CTGTAGACCGGGCTGGGGTAAGG + Intergenic
927873691 2:26640391-26640413 CTGGAGATGGGGCTGGGACACGG - Intronic
927993548 2:27465582-27465604 CTGGTGATGGGGCAAGGGGAGGG + Intronic
928133747 2:28672488-28672510 CTGTCAGTGGGGCGAGGGGAGGG + Intergenic
930748203 2:54906387-54906409 CTGTGGAGGGGCCTGGGGGAAGG + Intronic
932612592 2:73210867-73210889 CTGGCGATGGAGCTGCTGGAAGG - Exonic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932885546 2:75546083-75546105 CTGTTGAGGGGGCTGGGGCCAGG + Intronic
933557434 2:83848602-83848624 CTGTCGGTGAGTCTGGGGCAAGG - Intergenic
933695326 2:85213140-85213162 CTGTGGCTGGGGTGGGGGGAGGG + Intronic
934045515 2:88170264-88170286 CTGGGGATGGGGCGGGGGGCGGG - Intergenic
934299728 2:91769766-91769788 CTGTGGATTGGGGTGGGGCAGGG + Intergenic
934636918 2:95998166-95998188 CTGTCAATGGGGTGAGGGGAGGG - Intergenic
934796733 2:97107255-97107277 CTGTCAATGGGGTGAGGGGAGGG + Intergenic
934836686 2:97596176-97596198 CTGTCAATGGGGTGAGGGGAGGG - Intergenic
934877883 2:97942319-97942341 CTGTCAATGGGGTGGGGGGAGGG + Intronic
934891841 2:98077628-98077650 CTGTCAATGGGGTGGGGGGAGGG + Intergenic
935945619 2:108283722-108283744 CTGTGGGTGGGAATGGGGGAAGG - Intergenic
935954586 2:108363044-108363066 CTGTGGGTGGGGTTTGGGGATGG + Intergenic
935961092 2:108426191-108426213 CTGTCAGTGGGGCAGGGGGAGGG + Intergenic
936154585 2:110039831-110039853 CTGGGGATGGGGCAGGGGGAGGG + Intergenic
936190098 2:110331583-110331605 CTGGGGATGGGGCAGGGGGAGGG - Intergenic
936626670 2:114156147-114156169 CTGTCAGTGGGGCGGCGGGAGGG + Intergenic
937043677 2:118839358-118839380 CCATGGATGGGGCTGAGGGAAGG - Intergenic
937225534 2:120366656-120366678 TTGTCCTTGGGGCTGGGAGATGG + Intergenic
937305171 2:120866590-120866612 CTGCTAATGGGGGTGGGGGATGG - Intronic
937365499 2:121257967-121257989 TTGTCCATGGTGCTGGGGGTAGG - Intronic
937450835 2:122001021-122001043 ATGACGGTGGGGCTTGGGGAGGG + Intergenic
937459947 2:122076988-122077010 CTATCGCTGGAGCTGCGGGAGGG + Intergenic
937920027 2:127122372-127122394 CCGAGGATGGGGCTGGGGGTGGG - Intergenic
938598296 2:132811611-132811633 CTGTTGAGGGGGCAGGGGGCAGG - Intronic
941008719 2:160273706-160273728 TTGGGGATGGGGGTGGGGGAGGG - Exonic
941941348 2:171041669-171041691 CTGGGGTGGGGGCTGGGGGATGG - Intronic
943651762 2:190464901-190464923 CTTTTGGTGGGGGTGGGGGAGGG + Intronic
945048329 2:205801037-205801059 GTGTTGATGGGGGTGTGGGAGGG + Intergenic
945198206 2:207257013-207257035 CTGTGCATGTGGCAGGGGGAAGG + Intergenic
946190668 2:218006190-218006212 CTGGCCCTGGGGCTGGAGGAGGG + Intergenic
946196167 2:218034030-218034052 CTGTCGCAAGGGCTGGGGGCGGG - Intergenic
946382466 2:219358481-219358503 CTGGGGAGGCGGCTGGGGGAGGG - Intergenic
946689600 2:222300376-222300398 CTGTCAAAGGAGGTGGGGGAGGG - Intronic
948017894 2:234704963-234704985 CTGCAGAGGGGGCAGGGGGAAGG + Intergenic
948142017 2:235680501-235680523 CTCTCTATGGGCCTGGGGAAGGG + Intronic
948202985 2:236143100-236143122 CTGTCTGTGGGTTTGGGGGAGGG + Intergenic
948539810 2:238682531-238682553 CCACAGATGGGGCTGGGGGATGG + Intergenic
948697336 2:239738251-239738273 CTGGGGATGGGGCTGGGGCTGGG - Intergenic
948800202 2:240430022-240430044 CTGGGGAGGGGGATGGGGGAAGG - Intergenic
1168771809 20:420688-420710 ATGGGGGTGGGGCTGGGGGATGG - Intronic
1168904084 20:1390339-1390361 CTGGCCATGGGGAGGGGGGAGGG + Intronic
1169277888 20:4245776-4245798 GGGGCGATGGGCCTGGGGGATGG + Intronic
1169952483 20:11060763-11060785 CTGTTGATGGGGTCAGGGGAAGG + Intergenic
1170077169 20:12432469-12432491 ATGGAGATGGGGCTGAGGGATGG - Intergenic
1170450588 20:16479359-16479381 CGGCGGATGGGGCAGGGGGAGGG + Intronic
1171524280 20:25797188-25797210 CTGTGGCTGGGGCTGGGGCTGGG - Intronic
1171552547 20:26058695-26058717 CTGTGGCTGGGGCTGGGGCTGGG + Intergenic
1171806936 20:29688915-29688937 CTGTGGCTGGGGCTGGGGCTGGG + Intergenic
1172020173 20:31908496-31908518 CTGCCGAGGGGGCTTGAGGAAGG - Intronic
1172595616 20:36149239-36149261 CTGGCAAAGGGGCTGGGGCAGGG - Intronic
1172966934 20:38842690-38842712 CTGTGCCTGGGGGTGGGGGAGGG - Intronic
1173257303 20:41403826-41403848 CTGTCGACGGGGGTGGGGCAAGG - Exonic
1173501348 20:43556385-43556407 CTGCAGGTGGGGCTGGGGGTGGG + Intronic
1173590117 20:44218178-44218200 CTGTGGATGGGGCTGGAGGTGGG + Intergenic
1173736265 20:45363625-45363647 CTGTGGCTGGCGCTGGTGGACGG + Exonic
1173758742 20:45541230-45541252 CTGTTGAGGGGGCAGGGGGAGGG + Exonic
1173911620 20:46674926-46674948 CAGTCGATGGGGCTGGGATGAGG + Intronic
1174840800 20:53899584-53899606 CTGCCAATGGGGTGGGGGGATGG + Intergenic
1175142457 20:56871108-56871130 CTATTGCTGGGTCTGGGGGAAGG - Intergenic
1175575049 20:60054758-60054780 CTGAGGTTGGGGCCGGGGGATGG + Intergenic
1175645451 20:60667069-60667091 CAGTCGCAGGGGCTGGGGGAGGG - Intergenic
1175805239 20:61824379-61824401 ATGTCGCTGGGGTTGGGGGGAGG - Intronic
1176182638 20:63758123-63758145 CTCTGGATGGGGCGGGTGGAGGG - Intronic
1179050811 21:37887292-37887314 ATGAGGATGGGGCTGGGGGAGGG - Intronic
1179493716 21:41758246-41758268 CTGAGGATGGGGATGAGGGAAGG - Intronic
1179902936 21:44403148-44403170 CTGCCCATGGGGCTGGGGCTGGG - Intronic
1180067072 21:45417892-45417914 CTGTGGGTGGGGCCTGGGGAAGG - Intronic
1180487536 22:15816606-15816628 ATGTGGATGGGGGTGGGGGGTGG + Intergenic
1181031419 22:20150296-20150318 CTGCGGCTGGGGCTGGGGCAGGG + Intronic
1181511912 22:23393100-23393122 CTGGGGCTGGGGCTGGGGCAGGG - Intergenic
1181556266 22:23673427-23673449 CTGTGGATTGGGGTGGGGCAGGG - Intergenic
1181698083 22:24603862-24603884 CTGTGGATTGGGGTGGGGCAGGG + Intronic
1182129073 22:27837580-27837602 CTGTTGCTAGGCCTGGGGGAGGG + Intergenic
1182893521 22:33839380-33839402 TTGGAGATGGGGCTGGTGGAAGG - Intronic
1182896489 22:33863373-33863395 CTCACGATGGGGCCAGGGGATGG + Intronic
1182972766 22:34593332-34593354 CTGTTTTTGTGGCTGGGGGATGG - Intergenic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183063264 22:35348080-35348102 CTGTAGATGGTGCAGGCGGAAGG + Intergenic
1183233056 22:36595234-36595256 CTGTCCCTGGGGGTGGGAGAAGG + Intronic
1183349961 22:37329556-37329578 ATGGAGATGGGGCTGGGGCAGGG + Intergenic
1183987851 22:41579098-41579120 CTGCCAATGGGGCTGTGGGCTGG + Intronic
1184032341 22:41902525-41902547 CTGTCGATGGGGCTGGGGGAAGG - Intronic
1184406537 22:44303863-44303885 GTGGAGGTGGGGCTGGGGGATGG - Intronic
1184423027 22:44392774-44392796 CTGGGGCTGGGGCTGGGGGTTGG - Intergenic
1184598518 22:45528712-45528734 GTGTCAATTGGGCTGGGGTATGG - Intronic
1184599096 22:45532185-45532207 CTGTCCAGGGGCCTGGTGGAGGG + Intronic
1184695613 22:46137300-46137322 CTGTCCATGGGCCTGGGGCACGG - Intergenic
1184902894 22:47458509-47458531 CTGCAGATGGGGCTGGGAGGAGG - Intergenic
1184959411 22:47918150-47918172 CTGTCCATGGGGCTGCCTGAGGG - Intergenic
1184995032 22:48199239-48199261 CTGGGGAAGGGGGTGGGGGAAGG + Intergenic
1185101205 22:48841811-48841833 CTGCAGATGGAGCTGGGGGATGG + Intronic
1185151186 22:49164753-49164775 CTGTGGGTGGGGCTGTGGGTGGG - Intergenic
1185151221 22:49164839-49164861 CTGTGGGTGGGGCTGTGGGTGGG - Intergenic
1185168381 22:49276489-49276511 CTTCAGCTGGGGCTGGGGGATGG - Intergenic
1185276657 22:49952896-49952918 ATCTCGTTGGGGCTGGGGCAAGG - Intergenic
950223150 3:11212013-11212035 TTGGCAGTGGGGCTGGGGGAGGG + Intronic
950587700 3:13907202-13907224 CTGTCGTGGGGACAGGGGGAAGG + Intergenic
950652132 3:14413703-14413725 CCGGGGGTGGGGCTGGGGGAAGG + Intronic
951927219 3:27921622-27921644 CTCTGCATGGGGGTGGGGGAAGG + Intergenic
952961022 3:38589156-38589178 CAGGCAATGGGGCTGGGGGTTGG - Intronic
953166114 3:40466246-40466268 GTGTGGATTGGGTTGGGGGATGG + Intergenic
953448354 3:42986611-42986633 CTGGAGATGGGGCTGGGGCCAGG + Intronic
953677527 3:45014876-45014898 CAGTCAAAGGGGATGGGGGATGG + Intronic
953692062 3:45127969-45127991 CTGCCGTTGGGGTTGGGGAATGG - Intronic
953978304 3:47399227-47399249 CTGGTGCTGGGGGTGGGGGATGG + Intronic
953980447 3:47410656-47410678 CTGAGGATGGGGCTGGGGCTGGG - Exonic
954003798 3:47577547-47577569 TTGTCGCCGGGGGTGGGGGAGGG + Exonic
954290687 3:49648410-49648432 CTGACCATAGGGCTGGGGAAGGG + Intronic
954322707 3:49842924-49842946 CTGTCCATGGGTCTGGGTGTTGG - Intronic
954757715 3:52850684-52850706 CTGCAGATGGGGATGGGCGAAGG - Intronic
954770078 3:52959120-52959142 CTGTCAAGGGGGACGGGGGAGGG + Intronic
956231618 3:67022812-67022834 CTGTCAGTGGGGCAAGGGGAGGG + Intergenic
957036667 3:75299816-75299838 GGGTTGGTGGGGCTGGGGGAGGG - Intergenic
957094727 3:75768174-75768196 CTTTAGATGGGGTTGGTGGAAGG - Intronic
957842463 3:85689242-85689264 CTGTGGATGGAGGTGGGGGTAGG + Intronic
957914086 3:86663527-86663549 CTGTCAGTGGGGGTGGGGGAAGG + Intergenic
959980970 3:112517213-112517235 CTGTCGGTGGGGGTTGGGGGAGG - Intergenic
960739595 3:120818545-120818567 CTGTCGCGGGGGCAGGGGCAAGG - Intergenic
960779877 3:121308099-121308121 CTGTTGTTGGAGCAGGGGGAGGG + Intronic
960868968 3:122230526-122230548 CTGTTGCAGGGGGTGGGGGATGG - Intronic
961658659 3:128456992-128457014 CCCTGGAGGGGGCTGGGGGAGGG - Intergenic
961659866 3:128462980-128463002 GTGTCGAAGGGGCTGTGGTAGGG + Exonic
961818471 3:129563321-129563343 CTGTTGGAGGGGTTGGGGGACGG - Intronic
962290825 3:134134978-134135000 CTGGGCATGGAGCTGGGGGAGGG - Intronic
962622105 3:137190334-137190356 ATTTAGATGAGGCTGGGGGAGGG + Intergenic
963088024 3:141456236-141456258 CTGTGGATGGGGCTGGGGTAGGG - Intergenic
963109053 3:141670328-141670350 GTGGCAATGAGGCTGGGGGAGGG + Intergenic
963589174 3:147234989-147235011 CTGTCAGTGGGGCAAGGGGAGGG - Intergenic
963734047 3:148999846-148999868 CTGACTATGGGGGTGGTGGAGGG - Intronic
964294607 3:155219719-155219741 CTGTTGTGGGGGATGGGGGAGGG - Intergenic
965271637 3:166623421-166623443 CTGGGGGTGGGGGTGGGGGAGGG + Intergenic
966263528 3:178009185-178009207 CTGTCGGAGGGGCCGGGGAAGGG + Intergenic
966557895 3:181284502-181284524 TTGCCGGTGGGGCTGGGGGCAGG - Intergenic
967187136 3:186953978-186954000 CTGTCAGGGGGCCTGGGGGAGGG - Intronic
967493319 3:190117737-190117759 CTTTCTTGGGGGCTGGGGGAGGG + Intronic
967597870 3:191349078-191349100 CTGCTGATGGGGGTGGAGGAGGG + Intronic
968787922 4:2637753-2637775 CTGTCGATGGGGCATGGGCAGGG + Intronic
968908867 4:3466617-3466639 CTGACGCGGGGGCTGAGGGAAGG - Intronic
969088136 4:4671689-4671711 CTGTCAACTGGGCTGGGAGAGGG + Intergenic
969174104 4:5385915-5385937 CTGTGGGTGGGGCTGTGGGTGGG - Intronic
969276910 4:6141995-6142017 CAGTGGGTGGGGGTGGGGGATGG - Intronic
969316331 4:6383406-6383428 CAGTAGATGAGGCTGGGGAAGGG - Intronic
969509721 4:7610838-7610860 CTGTGGACGGGGATGGGGAAGGG + Intronic
969546205 4:7830138-7830160 CTTTCTATGGGGCGGGGCGAGGG + Intronic
969703816 4:8781550-8781572 TTGTGGATGGGGCTGGCGGAAGG - Intergenic
971234510 4:24829144-24829166 CTGAGGATGGAGCTGTGGGACGG + Intronic
972129646 4:35816163-35816185 ATGTCTCTGGGGCTGGGGGAGGG - Intergenic
972238942 4:37167831-37167853 CTGTTGGAGGGGCAGGGGGATGG + Intergenic
974077752 4:57183054-57183076 CCCTGGATGAGGCTGGGGGATGG + Intergenic
974288625 4:59902301-59902323 CTTTTGGTGGGGCTTGGGGAGGG + Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
978205951 4:106081513-106081535 CTGTTGGGGGAGCTGGGGGAGGG + Intronic
979635938 4:122954257-122954279 CTGTCTATGGGACACGGGGATGG - Intronic
979921200 4:126498712-126498734 CTGTTGGTGGGTCAGGGGGAAGG + Intergenic
980482544 4:133405555-133405577 CTCTATTTGGGGCTGGGGGAGGG - Intergenic
981424737 4:144590140-144590162 GTGTAGATTTGGCTGGGGGAAGG - Intergenic
981742768 4:148020443-148020465 CTGTCAGCGGGGCAGGGGGAGGG - Intronic
982052071 4:151511714-151511736 GTGTCAGTGAGGCTGGGGGAGGG + Intronic
982361941 4:154527700-154527722 CTGTGGCTGGGGCTTGGGGGCGG + Intergenic
984702842 4:182829117-182829139 CTCTCCATGGGGCTCTGGGATGG + Intergenic
984881073 4:184410404-184410426 CAGCATATGGGGCTGGGGGAAGG - Intronic
985266881 4:188159189-188159211 CTGTCGGTGGGGCAGGGGGAGGG - Intergenic
985542408 5:493000-493022 GGGGCGATGGTGCTGGGGGACGG - Intronic
985550296 5:529285-529307 CTGAAGATGGGGCTGAGGGTGGG - Intergenic
985669996 5:1202136-1202158 CTGAGGGTGGGGCCGGGGGAAGG + Intronic
986629022 5:9751270-9751292 CTTTTGGTGGGGGTGGGGGAGGG - Intergenic
987077540 5:14398096-14398118 CTGTTCCTGGGGCTGGGGGATGG + Intronic
987204486 5:15610866-15610888 CTGTAAATGGGGCTGGGTGGAGG - Intronic
987287857 5:16476747-16476769 CTGTCAATAGGGTTGGGGGTGGG + Intronic
988395313 5:30690623-30690645 CTTTCACTGGGGCTGGTGGAGGG - Intergenic
988490786 5:31703470-31703492 CTGTCGGGGGGTCGGGGGGAAGG + Intronic
990461791 5:56037556-56037578 CTGAGGATGAGGTTGGGGGAGGG + Intergenic
990945944 5:61249619-61249641 CTATCGGGGGGGCTGGGAGAGGG - Intergenic
991264548 5:64701528-64701550 TTTTAGAAGGGGCTGGGGGAAGG + Intronic
992335388 5:75762831-75762853 CTGTCAGTGGGGCAGGAGGAGGG - Intergenic
995022458 5:107381742-107381764 ATGTTGGTGGGGGTGGGGGAAGG + Intronic
996770717 5:127082594-127082616 CTGGCGGTGGGGGTGGGGGTGGG + Intergenic
996808699 5:127488871-127488893 CCATGGATGGGGATGGGGGATGG + Intergenic
996909866 5:128643450-128643472 GTGTGCGTGGGGCTGGGGGAGGG + Intronic
997672562 5:135688037-135688059 CGGTTGCTGGGGCTGGGGAAGGG - Intergenic
997698642 5:135880932-135880954 GTGTGGGTGGGGGTGGGGGATGG - Intronic
997963268 5:138338383-138338405 CGGGCGGTCGGGCTGGGGGAGGG - Intronic
998128763 5:139640689-139640711 CAGTGGACAGGGCTGGGGGATGG + Intergenic
998137596 5:139682314-139682336 CTGGGGCTGGGGTTGGGGGAGGG - Intronic
998138474 5:139687036-139687058 GTGGTGATGGGGCTGGGAGAGGG - Intergenic
998557606 5:143140734-143140756 GTGTCGGTGGGGGTGGGGGTGGG + Intronic
998596051 5:143531620-143531642 CTGTCTTGGGGGCAGGGGGATGG - Intergenic
999075463 5:148791398-148791420 CTGTGGATGTGGGTGGGGGATGG - Intergenic
999167348 5:149561324-149561346 CTTTCCCTGGGGGTGGGGGAGGG + Intronic
999246910 5:150159975-150159997 CTCTCAGTGGGGCAGGGGGAGGG + Intergenic
999370262 5:151050844-151050866 TTTTTGTTGGGGCTGGGGGAGGG + Intronic
1000360459 5:160442154-160442176 CTATGGATGGGTTTGGGGGATGG - Intergenic
1001269739 5:170302305-170302327 CTGTGTGTGGGGCTGGGGGAAGG + Intergenic
1002910968 6:1490800-1490822 CTGTAGATGGGGTGGGTGGAGGG - Intergenic
1003269189 6:4592183-4592205 TTGTCCTTGGTGCTGGGGGAAGG + Intergenic
1003287043 6:4743509-4743531 CTGAAGATGTGGCTGGGGGAAGG - Intronic
1003988106 6:11457790-11457812 CTGTCGTGGGGTCGGGGGGAAGG + Intergenic
1006139613 6:31920506-31920528 CTGAGGATGGGCCAGGGGGAGGG - Intronic
1006167270 6:32072272-32072294 CTGTGGCTGGGGCTGGTGGGAGG + Intronic
1006196118 6:32243580-32243602 CTGTCCAGGGGGGTGGAGGAAGG + Intergenic
1006334875 6:33415250-33415272 CTCTGGTTAGGGCTGGGGGATGG - Exonic
1006445407 6:34077013-34077035 CTGGAGCTGGAGCTGGGGGAGGG + Intronic
1006579643 6:35069319-35069341 CTGTGGATGGGGCAGGGACAAGG - Intronic
1006656116 6:35594336-35594358 CTGTCTCGGGGGGTGGGGGAGGG + Intronic
1007155282 6:39736825-39736847 GTGGCGGTGAGGCTGGGGGAGGG + Intergenic
1007208196 6:40169875-40169897 CTATGGCTGGGGCTGGGGTAGGG - Intergenic
1007282131 6:40720520-40720542 CTGTGGGTGGAGTTGGGGGAGGG - Intergenic
1007373821 6:41443232-41443254 CAGGAGCTGGGGCTGGGGGAGGG + Intergenic
1007404336 6:41625196-41625218 TAGATGATGGGGCTGGGGGAGGG - Intergenic
1007616440 6:43182318-43182340 CTGTCCATGGGGCTGACGAAGGG + Intronic
1008177739 6:48288971-48288993 CTGCTGCTGGGGGTGGGGGAGGG + Intergenic
1008332391 6:50260315-50260337 GTGTCCATGGGCCTGGGGTAGGG + Intergenic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1010204926 6:73314415-73314437 CTGTCTGTGGGGTGGGGGGACGG + Intergenic
1010236620 6:73580156-73580178 CTGGGGATGGGGGTGGGGGTGGG - Intergenic
1010664652 6:78614404-78614426 CTGTCAGTGGGGCAGGGGGAGGG + Intergenic
1010682941 6:78817943-78817965 GTGGCAATGGGGCTGGGGGAGGG + Intergenic
1010846943 6:80720676-80720698 GTGGCGGTGGGGGTGGGGGATGG - Intergenic
1011603356 6:89080392-89080414 TTGTTGATGGGGGTGGGGAAGGG - Intergenic
1011806406 6:91077793-91077815 CTGTCTATGGGTCTGGGGTTAGG - Intergenic
1011847384 6:91582912-91582934 CTGAGGATGGAGTTGGGGGATGG + Intergenic
1013330400 6:109094882-109094904 CCACCGATGGGGCTGGGCGAAGG - Intergenic
1013349185 6:109290534-109290556 CCGTCGCTGGGGCAGGGGCAGGG - Intergenic
1014422862 6:121266905-121266927 CTGTCGGTGGGGAAGGGGCAAGG + Intronic
1015563067 6:134537291-134537313 ATGCCGATGGTGCTGGGGAAAGG - Intergenic
1015675761 6:135746491-135746513 CTGTCGGTGGGTCGGGGGAAGGG + Intergenic
1015800150 6:137052343-137052365 CTGGGGATAGGGCTGGGGGTGGG - Intergenic
1016890947 6:149006236-149006258 GTGTCAGTGGGGTTGGGGGAGGG - Intronic
1017146562 6:151240499-151240521 CTGTCCCTGCGGCTTGGGGAAGG + Exonic
1017798832 6:157873767-157873789 CTGTCTATGGGAATGGGAGAAGG - Intronic
1018415781 6:163601080-163601102 CTGTTGATGGGGGTGGGGGATGG - Intergenic
1018548298 6:164962816-164962838 CTGCCTATGGAGCTGTGGGAAGG + Intergenic
1018822547 6:167384343-167384365 CTGTTAGTGGGGCTGAGGGAAGG - Intronic
1019117461 6:169776769-169776791 CTGTCGATGGGGTTCAGTGAGGG - Intronic
1019284333 7:216128-216150 GAGAGGATGGGGCTGGGGGAGGG + Intronic
1019359552 7:597710-597732 CTGGCGATGAAGCCGGGGGAAGG + Intronic
1019540003 7:1547170-1547192 GTGCCGGGGGGGCTGGGGGAGGG + Exonic
1019701859 7:2477986-2478008 CTGTCCCTGGGGCTGGGGGCAGG - Intergenic
1020049598 7:5072814-5072836 CTGTCGCTGTGCCTGGGGGAGGG - Intronic
1020258215 7:6514518-6514540 GTGTCGATGTTCCTGGGGGAAGG + Exonic
1020363994 7:7360385-7360407 CTGTGGATGGGGCAGAGGGTAGG - Exonic
1020677788 7:11201412-11201434 CTGGAGATGGGCCTGGGGGGAGG - Intergenic
1021306003 7:19033339-19033361 CTGTCGAGGGGTCGGGGGCAAGG + Intronic
1022985150 7:35646523-35646545 CTGTCGATGAGGCTGGAGTGTGG - Intronic
1023319252 7:38975882-38975904 CTTCCTATGGGGCTGGGGGCTGG - Intergenic
1023710642 7:42988728-42988750 CTCAGGCTGGGGCTGGGGGAAGG - Intergenic
1023988666 7:45114256-45114278 CTGTCCATGGGACAGGGGGAAGG - Intergenic
1024479057 7:49845123-49845145 CTGTCAGTGGGGGTGGGGGAAGG + Intronic
1024941100 7:54764185-54764207 GTCTTGATGGGGCTGAGGGAGGG + Intergenic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1026945909 7:74316031-74316053 CTGTTGTGGGGGCGGGGGGAGGG - Intronic
1027128284 7:75572838-75572860 CTGCAGCTGGGGCTGGGGGCGGG - Intronic
1027236864 7:76303461-76303483 CTGGGGATGGGGCTGTGGGTGGG - Intronic
1027631243 7:80608911-80608933 CTGGCTATGGGGGTGGGGGTGGG - Intronic
1027987911 7:85318551-85318573 CAGTGGGTAGGGCTGGGGGAGGG - Intergenic
1028332482 7:89611673-89611695 CTGGGGGTGGGGCTGGGGGAGGG + Intergenic
1028849467 7:95520640-95520662 GTGTGGATGGGGATGGGGGGTGG - Intronic
1028887078 7:95946146-95946168 CTGTCAGGGGGGCAGGGGGAGGG + Intronic
1029010069 7:97250445-97250467 CTGTCAGAGGGGCAGGGGGAGGG - Intergenic
1029699876 7:102239404-102239426 CTGGTGCTGGGGCTGGGGGCTGG - Exonic
1029851805 7:103469381-103469403 CTGGGGATGGGGATGGGGGTGGG - Intergenic
1033648288 7:143321558-143321580 CTGTGGGTGGGGCTGGATGATGG - Intronic
1034426716 7:151017922-151017944 CTGTGGATGTGGCTGGGGTTGGG - Exonic
1034469542 7:151248117-151248139 CTGGGGGTGGGGGTGGGGGATGG - Intronic
1034536474 7:151728817-151728839 CTGTGGACGGGGCTGGGCGCTGG - Intronic
1034699523 7:153084097-153084119 CTGGAGATGGGGCTGGTGGGAGG - Intergenic
1035176399 7:157055132-157055154 CTGCAGGTGGGGCTGTGGGAGGG - Intergenic
1035243319 7:157546425-157546447 CTGTCAGTGGGGAAGGGGGATGG - Intronic
1035289949 7:157831465-157831487 CTGGGGCTGGGGCTGGGAGACGG + Intronic
1035291842 7:157844319-157844341 CTGGGGATGGGGCTGGGGCCTGG - Intronic
1035303555 7:157915506-157915528 CTCTCCATTGGGCTGGAGGATGG - Intronic
1036117057 8:5970273-5970295 GTGTTGGTGGGGCTGGGGGTGGG - Intergenic
1036369684 8:8152005-8152027 CTTTCGGTGGGGGTGGGGGTGGG - Intergenic
1036645356 8:10608911-10608933 CTGTCCAGGGAGCTGAGGGAGGG - Exonic
1036881205 8:12513639-12513661 CTTTCGGTGGGGGTGGGGGTGGG + Intergenic
1036985196 8:13521245-13521267 CTGTTGGAGGGGCTTGGGGAGGG + Intergenic
1037069508 8:14626302-14626324 CTGTTGAGGGGGTTGGGGGAGGG - Intronic
1037948101 8:23001834-23001856 CTGCTGAAGGGGCTGGGGAATGG + Intronic
1038284697 8:26196501-26196523 CTGGAGATGGGGCGGGAGGAGGG - Intergenic
1038368344 8:26961127-26961149 CTGTGGATGGGGCTGGCGTGGGG - Intergenic
1040534540 8:48297349-48297371 CTGGGGATGGGGGTTGGGGAGGG + Intergenic
1040753399 8:50739569-50739591 CTGGATGTGGGGCTGGGGGAGGG + Intronic
1042302803 8:67303675-67303697 CTGTCGCTGAGGCTGGAGGGTGG - Intronic
1043472945 8:80579080-80579102 GTGTCACTGGGGCCGGGGGACGG + Intergenic
1044569068 8:93698203-93698225 ATGGGAATGGGGCTGGGGGAGGG + Intergenic
1046778859 8:118193798-118193820 CAGTGGAGGGGGCTGTGGGAGGG + Intronic
1047125432 8:121954714-121954736 GTGGCAATGAGGCTGGGGGAGGG - Intergenic
1047177597 8:122556196-122556218 CTGTACATGAGGCTGAGGGAAGG - Intergenic
1048179822 8:132184498-132184520 CTGGGGATGGGGGTGGGGAAGGG + Intronic
1048333510 8:133486768-133486790 CTGTCCCTGGGGTTGGGGGTGGG - Intronic
1048559811 8:135522096-135522118 CTGTCATGGGGGCAGGGGGAGGG - Intronic
1048881678 8:138877109-138877131 TTGTGGCTGGGGGTGGGGGAGGG - Intronic
1049164099 8:141116137-141116159 CTGGGGATGGAGCTGGGGGCTGG - Intergenic
1049532062 8:143159824-143159846 CTGGAGAAGGGGCTGGGGGTGGG - Intronic
1049570275 8:143367051-143367073 CTGGCGAAGGGGGTGGGTGAAGG + Intergenic
1049703882 8:144029046-144029068 CTGTCGGAGGGGTTGGGGGAGGG + Intronic
1049795746 8:144496596-144496618 CAGCCGCTGAGGCTGGGGGAGGG - Exonic
1050985981 9:12083111-12083133 TGGTAGATGGGGTTGGGGGAGGG - Intergenic
1051154036 9:14120544-14120566 AGCTCGATGGGGCTGGAGGAAGG + Exonic
1051238127 9:15023468-15023490 CTGAGGATGGGGGTGGGGGTTGG - Intergenic
1051585930 9:18726889-18726911 CTGGGGCTGGGGCAGGGGGAGGG - Intronic
1052379569 9:27755517-27755539 CTGTCGGCAGGGTTGGGGGAAGG + Intergenic
1052939529 9:34121630-34121652 CTCTTGAAGGGGCTGGGGGTGGG - Intronic
1052986955 9:34494810-34494832 CACTAGGTGGGGCTGGGGGAGGG - Intronic
1053001061 9:34577676-34577698 GTGTCCATTGGCCTGGGGGAGGG - Intronic
1054172637 9:61855675-61855697 CTGGGGATGGGGCTGGGGCTGGG + Intergenic
1054194610 9:62017576-62017598 CTGTCGGTGGGGGTCGGGGTGGG - Intergenic
1054447488 9:65384686-65384708 CTGGGGATGGGGCTGGGGCTGGG + Intergenic
1054643798 9:67571114-67571136 CTGTCGGTGGGGGTCGGGGTGGG + Intergenic
1054664903 9:67725126-67725148 CTGGGGATGGGGCTGGGGCTGGG - Intergenic
1056057568 9:82843230-82843252 CTGTCGAGGGGTCAGGGGGAGGG + Intergenic
1057848309 9:98543205-98543227 CTGTGGCTGAGGCTGAGGGAAGG - Intronic
1057974468 9:99590014-99590036 CTGGGGATGGGGGTGGGGTAGGG + Intergenic
1059322355 9:113479599-113479621 CTGGGGCTGGGGTTGGGGGATGG + Intronic
1059433881 9:114265148-114265170 CTTTTGATGGGGGTGGGGGGCGG + Intronic
1059446682 9:114342502-114342524 CTGTGGTTGGGGCGGGGGGTTGG - Intronic
1059461038 9:114430240-114430262 CCTTCTATGAGGCTGGGGGAAGG + Intronic
1059965852 9:119612727-119612749 CTGGCACTGGGGCTAGGGGAGGG - Intergenic
1060420361 9:123464567-123464589 CAGTAGCTGGGGCAGGGGGAAGG + Intronic
1060546726 9:124466275-124466297 CTGTATATGGGCTTGGGGGATGG - Exonic
1060743262 9:126113393-126113415 CTGGACATGGGGCTGGGGAAAGG + Intergenic
1061222326 9:129259303-129259325 ATGGGGATGGGGCTGGGAGAAGG - Intergenic
1061222327 9:129259309-129259331 CTGGCGATGGGGATGGGGCTGGG - Intergenic
1061320121 9:129823486-129823508 CTGGGGCTGGGGCTGGGGGATGG - Intronic
1061320203 9:129823694-129823716 CTGGGGCTGGGGCTGGGGGATGG - Intronic
1061320263 9:129823855-129823877 CTGGGGCTGGGGCTGGGCGATGG - Intronic
1061368188 9:130183293-130183315 CTGACCATGCGGCTGGGGGGGGG + Intronic
1062132719 9:134908626-134908648 CTGGCTTTGGGGTTGGGGGAAGG + Intronic
1062263994 9:135678465-135678487 CTGTGGCTGTGGCTGGGGGGTGG + Intergenic
1062315909 9:135966953-135966975 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062315922 9:135966988-135967010 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062315935 9:135967023-135967045 CTGTGGTTGGGACTGGGGTAGGG - Intergenic
1062315947 9:135967058-135967080 CTGTGGTTGGGACTGGGGTAGGG - Intergenic
1062315959 9:135967093-135967115 CTGTGGTTGGGACTGGGGTAGGG - Intergenic
1062315971 9:135967128-135967150 CTGTGGTTGGGGCTGGGGTAGGG - Intergenic
1062681259 9:137782720-137782742 CAGTCAACGGGGCTGGGGGAGGG - Intronic
1185672889 X:1826080-1826102 TTGGAGATGGGGCTGGGTGAGGG - Intergenic
1186132411 X:6482098-6482120 CTCTTGATGGGAATGGGGGATGG - Intergenic
1186389820 X:9147937-9147959 CTGTGGCTGGGGGTGGGGGAGGG - Intronic
1186482536 X:9907032-9907054 CTGGCGTTGGGGCAGGGGGGAGG + Intronic
1186913920 X:14199465-14199487 CTGTCGGTGGGGTGGGGGGAGGG + Intergenic
1187415757 X:19092133-19092155 CTGTGGATTGGGCTGGCAGAGGG - Intronic
1187431605 X:19229909-19229931 CTGTCGATGGGGAGGGGCGCTGG - Intergenic
1187581576 X:20612817-20612839 CTCTCCATGTGGCTGGGTGAGGG + Intergenic
1189207840 X:39257037-39257059 GTGTCCAGGTGGCTGGGGGAGGG - Intergenic
1189315923 X:40056485-40056507 GTGTCCATGGAGCTGGGGGTTGG + Intronic
1190128505 X:47725727-47725749 ATGCCGAGGGGGCTGAGGGATGG + Intergenic
1190942265 X:55053364-55053386 CTGTCAAGGGGGCGAGGGGAGGG + Intergenic
1191672816 X:63764806-63764828 TTGTTGGTGGGGCTGGGGGAGGG + Intronic
1191714561 X:64185445-64185467 CTGTATATGGGGGTGGGGGTGGG - Exonic
1192149516 X:68703510-68703532 CTCTCCTTGGGGCTGGGGGAGGG + Intronic
1192188799 X:68978293-68978315 CGGTGGACGGGGGTGGGGGAGGG - Intergenic
1193759014 X:85442164-85442186 CTGAGGATGGGACTGGGGGTGGG - Intergenic
1194669148 X:96708534-96708556 ATGTCGCAGGGGGTGGGGGACGG - Intronic
1195668918 X:107452903-107452925 CTGGAGATGGGGGTGGGGGTGGG + Intergenic
1197479482 X:126964799-126964821 CTTTACATGGGGATGGGGGAGGG + Intergenic
1197534877 X:127675186-127675208 CTGTCAATGGGGCTGGGAGAGGG - Intergenic
1198123776 X:133621585-133621607 GTGGCAATGAGGCTGGGGGAGGG + Intronic
1198322598 X:135533544-135533566 CTGTGAATGGGGGTGGGGGAAGG - Intronic
1199600572 X:149539335-149539357 CTGTGGGTGGAGCTGGGGGAGGG - Intergenic
1199650010 X:149940606-149940628 CTGTGGGTGGAGTTGGGGGAGGG + Intergenic
1200042280 X:153379198-153379220 CAGTGAATGGGGGTGGGGGATGG + Intergenic
1200074930 X:153546170-153546192 CTGGGGGTGGGGCTGGTGGAGGG + Intronic
1200213792 X:154358568-154358590 CTGTCCCTGGGGCTGGGGCCAGG - Exonic
1201570827 Y:15412104-15412126 CTGTTGTGGGGGTTGGGGGAAGG + Intergenic
1202583281 Y:26403266-26403288 CTATGGCTGGGGCTGGGGCAGGG + Intergenic