ID: 1184032391

View in Genome Browser
Species Human (GRCh38)
Location 22:41902736-41902758
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 574
Summary {0: 2, 1: 1, 2: 9, 3: 98, 4: 464}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184032385_1184032391 -5 Left 1184032385 22:41902718-41902740 CCTGTCAGAGCCTTGCTTTCTCA 0: 1
1: 1
2: 1
3: 39
4: 419
Right 1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG 0: 2
1: 1
2: 9
3: 98
4: 464
1184032384_1184032391 -4 Left 1184032384 22:41902717-41902739 CCCTGTCAGAGCCTTGCTTTCTC 0: 1
1: 1
2: 3
3: 46
4: 366
Right 1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG 0: 2
1: 1
2: 9
3: 98
4: 464
1184032382_1184032391 14 Left 1184032382 22:41902699-41902721 CCCTATACAAGCTGCTGTCCCTG 0: 1
1: 0
2: 1
3: 14
4: 164
Right 1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG 0: 2
1: 1
2: 9
3: 98
4: 464
1184032381_1184032391 27 Left 1184032381 22:41902686-41902708 CCTGTGCTGTATTCCCTATACAA 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG 0: 2
1: 1
2: 9
3: 98
4: 464
1184032383_1184032391 13 Left 1184032383 22:41902700-41902722 CCTATACAAGCTGCTGTCCCTGT 0: 1
1: 1
2: 2
3: 10
4: 148
Right 1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG 0: 2
1: 1
2: 9
3: 98
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901021734 1:6259563-6259585 TCCCATCTGCAGTGTGGGGACGG - Intronic
901041699 1:6368160-6368182 CCTCACCTTCAAACTGGGGAGGG - Intronic
901636079 1:10670808-10670830 TCACAGCTGAAGGATGGGGAAGG - Intronic
901679429 1:10904579-10904601 TCTCATCTGTAAAATGGGCATGG + Intergenic
902232985 1:15040076-15040098 TCCCACCTGTAAAATGGGGCTGG - Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902617284 1:17630691-17630713 CCTCACCTGGGCAATGGGGATGG + Intronic
902818042 1:18927220-18927242 TCCCACCTCCAGAGTTGGGAGGG + Intronic
902873625 1:19328449-19328471 TCCCACCTGCAGCGTGGGGGTGG + Intronic
902892048 1:19451602-19451624 TCCCATCTGCAGGGTGGGGATGG - Intronic
903000900 1:20264992-20265014 TCTAACCTGTAAAGTGGGGATGG + Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903500572 1:23798111-23798133 TCTCACCTCCAGAAGCTGGATGG + Exonic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904556359 1:31367442-31367464 GTTCACCTGCAGAAATGGGACGG - Exonic
904840268 1:33368011-33368033 CCTCATCTACGGAATGGGGAGGG - Intronic
904856262 1:33500246-33500268 ACTCAGCTGCAGCATGGGGTGGG - Intergenic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905447586 1:38037091-38037113 CCTCACCTGTAGGCTGGGGATGG + Intergenic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
905907248 1:41627275-41627297 TCTCACTTGCAAAATGAGGCTGG - Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906087140 1:43145486-43145508 TGTCTCCTGCAAAAAGGGGAGGG + Intronic
906543356 1:46604787-46604809 TCGCAGCTGCAGACTTGGGAAGG - Intronic
906635423 1:47406524-47406546 TCTCATCTGTAAATTGGGGATGG + Intergenic
906778206 1:48548796-48548818 TTTCATCTGCAAAATGGAGATGG - Intronic
907457744 1:54586216-54586238 TCTCATCTGCAGAATGGATGGGG + Intronic
908029826 1:59987416-59987438 TCTCACCTGTACAATGGGCATGG + Intronic
908040047 1:60102697-60102719 TCTCTCCTCCAGAATGGAGGTGG + Intergenic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
909852106 1:80480383-80480405 CCTCACCTGTATAATGGGGTTGG - Intergenic
909907520 1:81216933-81216955 TATTACCTGCAGAATTGGGTGGG - Intergenic
910226753 1:84943739-84943761 TCCCACCTACAAAATGGGGAGGG + Intronic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911068820 1:93815601-93815623 CCTCCCCAGAAGAATGGGGAGGG + Intronic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911587977 1:99713189-99713211 ACTCACCTGTAAAATGGGGGTGG - Intronic
912117996 1:106431608-106431630 TCTCACCTACAGAATCTGTAAGG - Intergenic
912233867 1:107827298-107827320 TCACACCTGGAGAATAAGGAAGG - Intronic
912254862 1:108048303-108048325 TCTCCACTGGAGATTGGGGAGGG - Intergenic
913092150 1:115483709-115483731 TCTCACCTAAAGAATGGGACTGG + Intergenic
915627453 1:157124100-157124122 TCTCAGCTGCATAGTTGGGACGG - Exonic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
916582666 1:166122702-166122724 TCTTAGCTGCCAAATGGGGATGG + Intronic
917087639 1:171319557-171319579 TCTCACCTGTAAAATGTGAATGG - Intronic
917495916 1:175540072-175540094 TCTCAGATGTAGAGTGGGGAGGG + Intronic
918458935 1:184755544-184755566 TCTCGTCTGCAAAAGGGGGATGG - Intergenic
918516328 1:185367439-185367461 TCTCCCCTACAGCATGTGGAAGG + Intergenic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
920977851 1:210802700-210802722 TCCCACCTGTAAAATGGAGAGGG - Intronic
922230794 1:223683907-223683929 TCTCACCTGTAGAATGTGGCTGG - Intergenic
922810182 1:228410940-228410962 GCTCACCTGCAGCATCTGGAGGG + Exonic
923558728 1:235022172-235022194 TGTCTCCTGCAGAATGAGCACGG + Intergenic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1062995127 10:1858465-1858487 TCTCACCTGCAAAATGAGTAGGG - Intergenic
1063769294 10:9179085-9179107 TCTAACCTGACGATTGGGGATGG + Intergenic
1064220096 10:13432932-13432954 TCTCACCTGTGAAGTGGGGATGG + Intergenic
1065236861 10:23660757-23660779 TCTCCCCTGCAGATTGAGAATGG + Intergenic
1065844507 10:29734554-29734576 TCTCCCCTACACAATGTGGAAGG - Intronic
1066180288 10:32955848-32955870 TCTCATGTGCAGAATGTTGAGGG + Intronic
1067844899 10:49711829-49711851 TCTCACCTATAAAATGGGGGTGG + Intergenic
1067897316 10:50197629-50197651 TCTCATTTGCAAAATGGGAATGG - Intronic
1067951656 10:50744391-50744413 TCTCATTTGCAAAATGGGAATGG + Intronic
1068653041 10:59543735-59543757 TCTTACCTGAAGAACTGGGAAGG - Intergenic
1068698031 10:59989932-59989954 TCTTACCAGCAGAGAGGGGAAGG + Intergenic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1070370986 10:75781798-75781820 TCTCATCTGCAAAATGGGAGTGG - Intronic
1071035833 10:81244102-81244124 TCTCACATGCAGAAAGGTCAAGG - Intergenic
1071499054 10:86190573-86190595 GCACACCTGCAGGATGGGGATGG - Intronic
1071549260 10:86553713-86553735 TCTCATCTGAAGACTGGGGATGG + Intergenic
1072043107 10:91628112-91628134 TCTCAGCTTTAAAATGGGGAAGG - Intergenic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1072916681 10:99541032-99541054 TCTCACCTGCAGAGTCGGCTAGG - Intergenic
1073113259 10:101075415-101075437 TCTCACTTACAAACTGGGGAGGG + Intergenic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073471681 10:103726380-103726402 CCTCACCCGTAGTATGGGGATGG - Intronic
1073569389 10:104563731-104563753 TCTCTGCTGATGAATGGGGATGG + Intergenic
1073919596 10:108443614-108443636 TCTCACCTGTAGAATGGCCATGG + Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074309334 10:112308673-112308695 TGTCATCTGCAAAATGGGGGTGG - Intergenic
1074870114 10:117569669-117569691 TCTCCCCTGCACAATGGGAGTGG - Intergenic
1076032726 10:127173236-127173258 TCTGTCCTGCAGACAGGGGATGG - Intronic
1076107707 10:127836450-127836472 ACTCACATGCAGAATGGAAATGG + Intergenic
1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG + Intergenic
1077150596 11:1071369-1071391 TCTGGCCTGCAGAATGGGTGTGG + Intergenic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1080222930 11:29927368-29927390 TCTCACATGGAGGCTGGGGATGG - Intergenic
1080394106 11:31874199-31874221 CCTCACCTGGAAAATGGGGCTGG - Intronic
1080682643 11:34490650-34490672 TCTCCTCTGTAGAATGGGGTGGG + Intronic
1080801169 11:35611643-35611665 ACTCATCTGTAGAATGGAGATGG - Intergenic
1081039265 11:38191010-38191032 TTTGACCAGCAGAATGTGGAAGG - Intergenic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1082641186 11:55663551-55663573 TCTCATCTGCAGTATAAGGATGG - Intergenic
1082790770 11:57345487-57345509 TCTCATCTGTCGAATGGGAATGG + Intronic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1084102206 11:66957264-66957286 TCTCAGCTGGAGAACGGGTAAGG + Intronic
1085267220 11:75244011-75244033 CCTCATCTTCAGGATGGGGATGG + Intergenic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1086840726 11:91681014-91681036 TCTCATCTACAGAATGGGGGTGG - Intergenic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1088368189 11:109060740-109060762 TCTCACCTGTAAAATGGGGTTGG + Intergenic
1089117801 11:116110619-116110641 TTCCACCTGTAGAAAGGGGATGG - Intergenic
1089342505 11:117768016-117768038 CCTCACCTGTAAAATGGGCAAGG + Intronic
1089480666 11:118802360-118802382 TCTCATCTGTTTAATGGGGATGG + Intergenic
1089959702 11:122604949-122604971 TCTAACCTGCAGGAAGGAGAAGG - Intergenic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091613551 12:2032062-2032084 TCTACCTTGCAGCATGGGGATGG - Intronic
1091645152 12:2267558-2267580 TCTCATCTGTAAAATGGGCATGG - Intronic
1092094415 12:5829423-5829445 TCTTACTTGCAGGATGGGCAAGG - Intronic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094567902 12:31616617-31616639 CCTCACCTGCAAAATGAGAATGG + Intergenic
1096914641 12:55017966-55017988 ACACCCCTGAAGAATGGGGAGGG - Intergenic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1097631013 12:62062422-62062444 TCACAGCTGCAGCATGAGGAAGG - Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098621715 12:72608951-72608973 TTTGATCTGTAGAATGGGGATGG + Intronic
1098890544 12:76006125-76006147 TCTCATCTTCAGAATAGGGATGG - Intergenic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1100400085 12:94221778-94221800 TCTCACATACAGAAGGGGCAGGG + Intronic
1100803941 12:98261650-98261672 AATCCCCTGTAGAATGGGGAGGG + Intergenic
1101291727 12:103377425-103377447 CCTCACCGTCAGAATGGGAAAGG + Intronic
1101407377 12:104440702-104440724 TGTCACCTGCTGAGTGGGGAGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103598479 12:122038804-122038826 TTTAATCTGTAGAATGGGGATGG + Intronic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1104831681 12:131756729-131756751 CCTCACCTGCAGGCTGGGGTGGG + Intronic
1105887382 13:24653461-24653483 GGTCTCCTGCAGAATGTGGAAGG - Intergenic
1106455854 13:29925975-29925997 TCACACCTGCAGACCTGGGAGGG + Intergenic
1106609353 13:31263729-31263751 TCTCACAAACACAATGGGGAAGG - Intronic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107583337 13:41816228-41816250 TCTCATCTGTAAAATGGGAACGG - Intronic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1108219661 13:48220393-48220415 TCTCACCTGGAGCATCTGGAGGG + Intergenic
1108983618 13:56553894-56553916 CCTCACCTGTAGATTGGGTAAGG + Intergenic
1110466963 13:75813397-75813419 TCTCACCTGCTAAGTGAGGAAGG - Intronic
1111192617 13:84830456-84830478 TTTCACCTGAAGAATGGTGAGGG + Intergenic
1111861733 13:93715730-93715752 TCTCATGTGCAAAATGGGAATGG + Intronic
1111883797 13:93993144-93993166 TCTCACCTGCATTATGGCAAAGG + Intronic
1112030364 13:95451002-95451024 CCTCACCTGCAAAACGGGCATGG - Intronic
1112329605 13:98467060-98467082 TCTCATCTGTAGAATGGAGGTGG + Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1115301622 14:31892100-31892122 TCTAAACTTCAGAATGAGGAGGG + Intergenic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118608173 14:67518343-67518365 TCTCATCTGCAAAATGGAAATGG + Intronic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1121327690 14:93031056-93031078 TCTCACCTCCGGAACTGGGAGGG + Intronic
1121497177 14:94401195-94401217 TCTCTCATGCAGATTGGGTATGG - Intergenic
1121545922 14:94763630-94763652 CCTCACCTGCAAAATGGGCTTGG - Intergenic
1121642833 14:95497289-95497311 TCTCATCTGTAATATGGGGATGG + Intergenic
1121702257 14:95963489-95963511 ACTCATCCGCAAAATGGGGATGG - Intergenic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1122416731 14:101553414-101553436 TCTGGCTTGCACAATGGGGAGGG - Intergenic
1122836942 14:104435108-104435130 CCAGACCTGCAGAATGGGAAAGG + Intergenic
1123159126 14:106260418-106260440 TCACACCTGCAGGAGGGGCAGGG + Intergenic
1123160244 14:106271256-106271278 TCACACCTGCAGGAAGGGCAGGG + Intergenic
1123207871 14:106730794-106730816 TCACACCTGCAGGAGGGGCAGGG + Intergenic
1123682744 15:22774329-22774351 TCACACCTGTAAAATGGGGATGG - Intronic
1123760184 15:23425700-23425722 TCTCACCTGAGTAATGGGAATGG + Intergenic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1123917757 15:25049360-25049382 TTTCACATGCAGGATGGGCATGG - Intergenic
1124026646 15:25972985-25973007 TCTCTTCTTCAAAATGGGGAGGG + Intergenic
1124223179 15:27867050-27867072 TCTCAACTGCACACTGGGAATGG - Intronic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1124689135 15:31807185-31807207 TTTCACCTGCAAAATGGGAACGG - Intronic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1125754399 15:42053121-42053143 TCTCACCTGCACAGTGGGGTGGG - Intergenic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1127661734 15:61105859-61105881 TCTCACCTGAAGAATGGAAGTGG - Intronic
1128355417 15:66923157-66923179 TGTCACCAGCATATTGGGGAGGG - Intergenic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1128735696 15:70052672-70052694 TCTCACCTATAAAATGGGGATGG - Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129750134 15:78056890-78056912 GCTCACCTGTGGCATGGGGATGG - Intronic
1129952169 15:79601499-79601521 TCTCCTCTGCAGCCTGGGGAGGG - Intergenic
1130423020 15:83767158-83767180 GTTCACCTGCAAAATGGGGATGG + Intronic
1130862170 15:87900831-87900853 TCTCATCTGCATAATTGGTAGGG + Intronic
1130867145 15:87942736-87942758 TCTCACCTGTAAAATGGGTATGG + Intronic
1131763771 15:95653211-95653233 TCAGACCTGCAGGATGGGAAAGG - Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132307842 15:100830565-100830587 TCTCAGCTGGAGATCGGGGAGGG - Intergenic
1132343348 15:101091772-101091794 TCCCATGTGCACAATGGGGATGG - Intergenic
1132464207 16:70299-70321 TCCCACCTGCAGCCTGGGGAGGG - Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133850707 16:9500676-9500698 TCTCACCTGTAAAATGGAGAGGG + Intergenic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134213596 16:12298500-12298522 TCTCATCTGTAAAATGGGAATGG + Intronic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134833989 16:17346285-17346307 TCTCACCTGCAAAGTGGACAAGG - Intronic
1134838586 16:17382854-17382876 CCTCACCTGGGTAATGGGGATGG - Intronic
1135345047 16:21681809-21681831 ACACACCTGCAGGCTGGGGATGG - Exonic
1136043847 16:27600598-27600620 GCTCACCAGGAGAATGGGGGAGG - Intronic
1136098649 16:27977131-27977153 TCTCATCTGTAAAATGGGAATGG - Intronic
1136928256 16:34395343-34395365 TCTCACCTGTGAAGTGGGGATGG - Intergenic
1136976318 16:35016461-35016483 TCTCACCTGTGAAGTGGGGATGG + Intergenic
1137569900 16:49558509-49558531 TTTCTCCTGCACACTGGGGAGGG - Intronic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137823072 16:51464062-51464084 TTTCACTTGTAAAATGGGGAGGG + Intergenic
1137943763 16:52714450-52714472 TCTGACCTGGAAAATGAGGAGGG - Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138284136 16:55794916-55794938 TCTCACCTGCAGGCAGGAGACGG + Intergenic
1138284866 16:55802071-55802093 TCTCACCTGCAGGCAGGAGACGG - Intergenic
1138405795 16:56792986-56793008 TCTTACCTGTAAAATGGGGCAGG + Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1139223202 16:65205955-65205977 TCTCACTTGCTGGATGGGGAGGG + Intergenic
1140440497 16:74984350-74984372 TCTCACCTGTAGAAGGGAGATGG - Intronic
1140443323 16:75003493-75003515 CCTTACCTGCACAATGGGGGTGG - Intronic
1140971021 16:80012610-80012632 TCTTATTTGCAGAATGGGAATGG - Intergenic
1140989953 16:80201144-80201166 CCTCAACTGCAAAATGGGAATGG - Intergenic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1141586127 16:85034775-85034797 TCTCATCTGTGAAATGGGGACGG - Intronic
1141804518 16:86334057-86334079 TGGCACGTGGAGAATGGGGACGG - Intergenic
1141824421 16:86468856-86468878 CCTCAGCTGGGGAATGGGGATGG + Intergenic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1142233712 16:88911597-88911619 TCTCATCTGTAAAATGGGAATGG + Intronic
1142352064 16:89585098-89585120 TTTCACCTGCAGGAAGTGGAAGG - Intronic
1142590602 17:1003944-1003966 TCCCACCCCCAGAGTGGGGAGGG - Exonic
1143048853 17:4105488-4105510 CCTGACCTGAAGAATTGGGAAGG - Intronic
1143087565 17:4427549-4427571 TCTCACCTACAAAATGGGGATGG - Intergenic
1143374436 17:6458933-6458955 AGTCACCTGCAGGATGGGGTAGG - Intronic
1144504286 17:15817115-15817137 TATCACATGCACAATGGGGGGGG - Intergenic
1144602864 17:16633906-16633928 TCTCATTTGGAGAATGGGAAAGG - Exonic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145168142 17:20632624-20632646 TATCACATGCACAATGGGGGGGG - Intergenic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1146380265 17:32322714-32322736 TCTCACCTGTGTAATGGGGTGGG - Exonic
1146921024 17:36711756-36711778 TTTCACCTGTGAAATGGGGATGG + Intergenic
1147210799 17:38871353-38871375 CCTCCCCTCCAGACTGGGGAGGG - Intronic
1147655745 17:42089760-42089782 TCTCAGCAGCAGAATGTGTACGG + Intergenic
1148088438 17:45008283-45008305 CCTCACCTGCAGCTGGGGGACGG + Intergenic
1148336802 17:46847540-46847562 GGTCACCTGGAGGATGGGGAAGG + Intronic
1148992809 17:51681191-51681213 TCTGATCTGCAAAATGGGTATGG + Intronic
1149315457 17:55434276-55434298 TCTCACCTGTAAAATGGGGGAGG + Intergenic
1149496149 17:57118965-57118987 TGTCACCTGAAGAAGGGGGGTGG - Exonic
1149576197 17:57715377-57715399 CCTCACCTGTGCAATGGGGAGGG - Intergenic
1150456760 17:65312489-65312511 TCTCCCCTTGAGACTGGGGAAGG + Intergenic
1151676576 17:75601858-75601880 CCTCACCTGTAAAATGGGTATGG + Intergenic
1151967425 17:77438658-77438680 TCTCCCCTGCAGCCTCGGGAGGG + Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1153016764 18:589720-589742 TCTAACATGCAGAAAGGGAAAGG - Intergenic
1153487810 18:5618153-5618175 ACTCAGCTGTAAAATGGGGAAGG + Intronic
1154486301 18:14874054-14874076 CCTCACCTGTAGAATGGGAATGG + Intergenic
1156147863 18:34207986-34208008 TGACACCTGCAGAATGTGGAGGG - Intronic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157528255 18:48401571-48401593 CCCCATCTGCAGTATGGGGATGG + Intronic
1157546677 18:48551371-48551393 TCTCCCCTGCAGCTTGTGGAGGG + Intronic
1157558314 18:48627992-48628014 TCTCCCCTGCAGCAAGGAGACGG - Intronic
1158219819 18:55139109-55139131 TCTCAACTGTAAAATGGGCATGG + Intergenic
1158846081 18:61444168-61444190 TCTATGGTGCAGAATGGGGAGGG - Intronic
1159464248 18:68760060-68760082 TCACACCTGTAGAATGGAGAAGG - Intronic
1160563255 18:79771948-79771970 GCCCCCCTGCAGACTGGGGAGGG + Intergenic
1160596118 18:79975566-79975588 TCTCACCTGAAGAATTCTGAGGG + Intronic
1160848537 19:1178075-1178097 TCCCACCTATAAAATGGGGAGGG + Intronic
1161418474 19:4161608-4161630 TCTCATCTGCAAAATGGGTTTGG - Intronic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1163273386 19:16267547-16267569 TCTCATCTGTGAAATGGGGATGG + Intergenic
1165705149 19:37970647-37970669 CCTCTCCTGCAGGATGTGGAGGG + Intronic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1166545244 19:43630585-43630607 TCTCACCTATAAAATGGGAATGG - Intronic
1166774400 19:45303473-45303495 TCTCATCTGCAGAATGGGAGCGG + Exonic
1167619233 19:50551884-50551906 TCTCTCCTTCTGAACGGGGAGGG + Intronic
1167660345 19:50792452-50792474 TCCCATCTGCACAGTGGGGATGG + Intronic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168410280 19:56135583-56135605 TGTCACCTGCAGACAGGGCAGGG + Intronic
1168564221 19:57409667-57409689 TCTCTCCTGCAGAATTGGTGAGG - Intronic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926147120 2:10403404-10403426 TTTCAACTGCAGAATGGAGCTGG - Intronic
928314969 2:30237913-30237935 GCTCACCAGCTGAGTGGGGAGGG + Intronic
928918428 2:36499927-36499949 TGTCACCTGAAGAATGGTCAAGG - Intronic
929670524 2:43873674-43873696 TCTCCTATGCAAAATGGGGATGG - Intronic
929868341 2:45737089-45737111 TCTCCCCTGCAGCATGGGGTTGG + Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
932084356 2:68745168-68745190 TCTCATCTGAAAAATGGGGCCGG + Intronic
932467039 2:71930543-71930565 TCTCCCATGCTGAAAGGGGAGGG - Intergenic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
932748998 2:74359146-74359168 TGTCAGCTGAGGAATGGGGATGG + Intronic
932834747 2:75025876-75025898 TCTCATCTGTAATATGGGGATGG + Intergenic
934653412 2:96104846-96104868 TCTCAGCTGCAGAAACAGGATGG - Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937129546 2:119497244-119497266 TGACACCTGCAGAGTGGGGGAGG - Intronic
937144395 2:119629939-119629961 TCTGACCTGCAGATTGAAGAAGG - Exonic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937343285 2:121105518-121105540 TCTCATCTGGGAAATGGGGATGG - Intergenic
938064428 2:128273401-128273423 TCACATCTGCAGAAAGGGGCAGG - Intronic
938191144 2:129281892-129281914 TGTCTCCTGCAGGATGTGGATGG + Intergenic
940419120 2:153457907-153457929 CCTCACCAACAGGATGGGGAGGG - Intergenic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
940899523 2:159113654-159113676 TCTCACCTGGAGAATAGAGAAGG + Intronic
941034322 2:160551128-160551150 CCTCACCAGCAACATGGGGATGG + Intergenic
941747873 2:169106331-169106353 TCTCATCTGTATAATGGGGGTGG + Intergenic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
944399896 2:199313558-199313580 TCTCACCTGCATAGTTGGAAGGG - Intronic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
945967251 2:216201707-216201729 TCTCTTCTGCAGAAAGGGGTAGG - Intronic
947385165 2:229584273-229584295 CCTCACCTGGAGGATGGGGTAGG - Intronic
947454099 2:230237362-230237384 CCTAACCTACAGAATGGTGAAGG - Intronic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948639852 2:239368727-239368749 CCTCACCTGCAGAACAGGGAGGG - Intronic
948699309 2:239750420-239750442 TCACACCTGCAGAACGAGCATGG + Intergenic
1168976495 20:1969863-1969885 TAAGACCTGAAGAATGGGGAAGG - Intergenic
1169152962 20:3304976-3304998 TCTCAGCTGAAGACTGGTGAAGG + Intronic
1170624174 20:18018906-18018928 TCTGTGCAGCAGAATGGGGATGG - Intronic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1171491945 20:25526131-25526153 TCACAGGGGCAGAATGGGGAAGG - Intronic
1172007911 20:31830150-31830172 TCTCAGCTGCCAAATGGGAATGG + Intronic
1172807644 20:37624116-37624138 TCTCATCTGCAAAATGGGATTGG - Intergenic
1172943741 20:38672594-38672616 TCTAAACTGCAGTTTGGGGAGGG + Intergenic
1173058231 20:39636659-39636681 TGTCATCTGCAGAATGAGAATGG - Intergenic
1173348770 20:42225395-42225417 TCTCATCTGTAAAATGGGAATGG - Intronic
1173785983 20:45792932-45792954 ACTCACGTACAAAATGGGGAAGG + Intronic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1173929564 20:46807484-46807506 TCTCAACTGTAAAATGGGGGTGG - Intergenic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174412122 20:50343149-50343171 TCTCACCTTGAAAGTGGGGATGG - Intergenic
1175147242 20:56906139-56906161 TCTCTCCTGGAAAGTGGGGATGG + Intergenic
1175243536 20:57567407-57567429 TCTCAGCTCCTTAATGGGGAAGG - Exonic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175692628 20:61076463-61076485 TCTAGCCTCCAGAATGCGGAGGG - Intergenic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1175969647 20:62677960-62677982 CCACACCTGCAGATTTGGGAAGG + Intronic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1176795000 21:13365325-13365347 CCTCACCTGTAGAATAGGAATGG - Intergenic
1177026933 21:15932076-15932098 TGACACCTGCAGAGTGGGGTGGG + Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1180999599 22:19981856-19981878 TCCCACCTGCAGAGTGGACATGG - Intronic
1181345177 22:22214836-22214858 TCTCACCTGCAGAGTGAGTGAGG - Intergenic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1182068488 22:27446693-27446715 TCTCATCTGTAAGATGGGGATGG + Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182626178 22:31648203-31648225 TGTCACCAACAGAATGGGCAGGG + Intronic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182843372 22:33410263-33410285 TCTAACCTATAGACTGGGGAGGG + Intronic
1183057913 22:35318299-35318321 TCCCGCCTGCAGAATGCAGATGG - Intronic
1183191711 22:36325789-36325811 CAGCTCCTGCAGAATGGGGACGG - Intronic
1183316899 22:37141872-37141894 TCCCACCTTCAGGCTGGGGAGGG + Intronic
1183346174 22:37309618-37309640 TCTCCCCAGCGGAATGGGGAGGG + Intronic
1183697553 22:39431711-39431733 TCTCACCTGCAGAACAGAGATGG - Exonic
1183974322 22:41502013-41502035 TGTTACCTGCAGAATGGTGGGGG - Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
1184424744 22:44402886-44402908 TCTCATCTGCACAGTGGGGATGG + Intergenic
1184658587 22:45954876-45954898 GCACACCTGCAAAATGAGGATGG - Intronic
1184972653 22:48037525-48037547 TTGCACCTCCAGAATGGAGATGG - Intergenic
1185019226 22:48364097-48364119 TTTCACCTCCAGGAAGGGGATGG + Intergenic
949484507 3:4524873-4524895 TCTCACCTGTAAAATGGGAGAGG + Intronic
949866451 3:8551451-8551473 TCTCACCTGTAAAATGGGTTTGG - Intronic
950106629 3:10392810-10392832 TGTCATCTGTAGAGTGGGGAGGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
952352684 3:32555649-32555671 ACTCAGCTGCAGGATGGGAATGG - Intronic
952966055 3:38621975-38621997 TCTCATCTGTGCAATGGGGAAGG + Intronic
953716606 3:45321382-45321404 TCTCATCAGCACGATGGGGAGGG + Intergenic
953958139 3:47247076-47247098 CCTCACCTGCCTAGTGGGGAGGG - Intronic
954388269 3:50255663-50255685 TCCCACCTGTAGAATGGGAATGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955254849 3:57320620-57320642 TCACACCTGCAGAAACTGGAAGG + Intronic
955772488 3:62399619-62399641 TCTCATCTCCATGATGGGGAGGG + Intronic
955931988 3:64066592-64066614 ACTGAACTGCAGAATGGAGAAGG + Intergenic
956499590 3:69868266-69868288 TCTCAGCTGCAAAATGGGGGTGG - Intronic
956754171 3:72368877-72368899 TCCCAACTGCAGAAGAGGGAAGG - Intergenic
956974009 3:74559213-74559235 TCTCAACAGCAAAATGAGGAAGG + Intergenic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
958195301 3:90235669-90235691 TCCCACCTTCAGGCTGGGGAAGG + Intergenic
958418710 3:93907076-93907098 TCCCACCTTCAGGCTGGGGAAGG + Intronic
958455433 3:94325344-94325366 TCTCACCTGCAAAATGGAGATGG + Intergenic
958546317 3:95556035-95556057 TCCCACCTTCAGATAGGGGAAGG + Intergenic
958902132 3:99899819-99899841 TCTCATCTGTAAAATGGGAATGG + Intronic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
961683656 3:128615566-128615588 GCCCACCTGGAGAATAGGGAAGG + Intergenic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
961911018 3:130316678-130316700 TGACACCTGCAGAACAGGGAAGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964098434 3:152961176-152961198 TCTTACCTGCAGAATGTACAGGG - Intergenic
965603108 3:170473858-170473880 TCTCATCTGCAAAACGGGGTTGG + Intronic
965615479 3:170587614-170587636 TCTCATCTTCAGAATGGGAAAGG + Intronic
965953831 3:174344153-174344175 TCTCACCTGGAGAATGCTCAAGG + Intergenic
968069899 3:195778304-195778326 TCTCTCAGGCAGGATGGGGATGG + Exonic
968609093 4:1549066-1549088 TCTCACCCGCAGAGCGGGGAGGG - Intergenic
968613790 4:1568486-1568508 TCTCAGCTGGAGAATGGGGCAGG + Intergenic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
968890593 4:3366605-3366627 TCTCAACAGCAGAAAGGAGACGG - Intronic
968927842 4:3559209-3559231 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
969138197 4:5048087-5048109 TCTGGCCTCCAGAATGGTGAGGG + Intergenic
969226045 4:5798956-5798978 TCTCCCTCGCAGAATGGGGAGGG + Intronic
969319342 4:6402422-6402444 TCTCACCTGCAAAATGGGCATGG + Intronic
969583666 4:8079972-8079994 CCTCACCTGCACCATGCGGAAGG + Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
976995465 4:91426957-91426979 CCTCACCTAGAAAATGGGGATGG - Intronic
977722361 4:100254449-100254471 TGACACCTGCAGAAGGAGGAAGG + Intergenic
978453161 4:108859206-108859228 TCCCATCTACAGAATGAGGATGG - Intronic
979382904 4:120029609-120029631 TTTCACCTGCAACATGGAGAAGG + Intergenic
980860219 4:138490369-138490391 TCTCACCTCTATAATGAGGAAGG + Intergenic
982097836 4:151939144-151939166 TCTCATCTGCGTAATGGGAAAGG - Intergenic
984247039 4:177287133-177287155 AGTCACCTGTAGAATGAGGAAGG - Intergenic
984526625 4:180866234-180866256 TGTCACCTGCAGAGTGGCAAGGG + Intergenic
984643678 4:182198214-182198236 TCTAATCTGCAGAATGTGTAGGG - Intronic
984883878 4:184432900-184432922 TCTGACCTCCAGAATTGTGATGG + Intronic
985139572 4:186825337-186825359 TCTCATCTGCAAAATGGGAGTGG + Intergenic
985319031 4:188688378-188688400 TCTCACCTGGAGGTTGGGGGCGG - Intergenic
985869885 5:2545801-2545823 TCTCCCCTGCTGAATGGAGGTGG - Intergenic
985999755 5:3621089-3621111 TCTCTGCTGCAGAAAGGGGAGGG - Intergenic
986102419 5:4626275-4626297 TCTCACATCCTAAATGGGGAAGG + Intergenic
986234355 5:5893513-5893535 CCTCACCTGGAGAATGGGCGTGG - Intergenic
986321496 5:6635523-6635545 CCCCACCTGTAGAATGGGCATGG + Intronic
986986363 5:13504932-13504954 TCTCACCTGCTGAAAGGATATGG - Intergenic
987048303 5:14127662-14127684 GTGCACCTGCAGCATGGGGAAGG + Intergenic
987074123 5:14364888-14364910 TCTGACCTGTAGCATTGGGAAGG + Intronic
987622076 5:20347409-20347431 TCACTACTCCAGAATGGGGAAGG + Intronic
987769660 5:22284398-22284420 TCTCATCTGAAGACTGAGGATGG + Intronic
989062275 5:37421080-37421102 CCTCACCTGTCGAAAGGGGATGG - Intronic
989661426 5:43802486-43802508 ACTAACCTGCAGAATGAGGAAGG + Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
995035381 5:107528134-107528156 TGTCATCTGCAAAATGGGAATGG + Intronic
996155139 5:120090166-120090188 TCTCACCTGTAAAATGTGGTAGG + Intergenic
996347043 5:122498833-122498855 TCCCACTTGTAAAATGGGGATGG - Intergenic
998349456 5:141491474-141491496 GCTCACCTGCAGGTTGGGGCTGG - Exonic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998498446 5:142611363-142611385 CCTCACCTGTGGAATGGGAATGG - Intronic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
999271671 5:150300270-150300292 TATCATCTGTAGAATGGGGGTGG - Intronic
999563447 5:152830571-152830593 CCTCAACTGCAGAATGGTGATGG - Intergenic
999682771 5:154075395-154075417 TCTGACGTGGAGGATGGGGAAGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1000247900 5:159464634-159464656 TCGAACCTGCAGAATGGTGATGG + Intergenic
1000281529 5:159786561-159786583 TCCCACCTGTAAAATGGGAATGG + Intergenic
1000334071 5:160228994-160229016 GCTGACCTGGAGCATGGGGAAGG - Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001752091 5:174139250-174139272 TCTCATCTGTAAAATGGGAATGG + Intronic
1001852269 5:174979969-174979991 TCCCACCTTCAGGATGGGGAGGG + Intergenic
1003849734 6:10209441-10209463 TCTCACCTGTAAAATGGGGCTGG - Intronic
1006181745 6:32157704-32157726 TCTCACCTGTGGCATTGGGATGG - Exonic
1006561692 6:34918346-34918368 TCTCACTTCCAAAATGGGGGTGG + Intronic
1007283611 6:40731027-40731049 CCTCACCTGTATAATGGAGATGG - Intergenic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008010483 6:46461897-46461919 TCTTGACTGCAGAATGGAGAAGG + Intronic
1013015770 6:106159491-106159513 TCTGATCTGCAGTGTGGGGAAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1014637683 6:123868259-123868281 TCTCACCTGAGCAATGGTGATGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1016190769 6:141261496-141261518 GCTCCTCTGCAGAAAGGGGAGGG + Intergenic
1018838571 6:167503031-167503053 CCTCACCTACAAAATGAGGATGG + Intergenic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019561405 7:1660510-1660532 TGTCACCTGTAAAAGGGGGAAGG + Intergenic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1019706954 7:2501516-2501538 TCTCAGCTGCAGAGGGGGTATGG + Intergenic
1019736424 7:2652226-2652248 TCTCACCTGCTGGAAGGGGTTGG - Exonic
1020026689 7:4904698-4904720 TCTCAGTTGCTAAATGGGGAAGG - Intergenic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1020257642 7:6510842-6510864 TCCCACCTGCAAAATGGGCTTGG - Intronic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1023056121 7:36291433-36291455 TCGTACCTGCAGAAGGGAGATGG + Intronic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1023212393 7:37821391-37821413 GTTCTCCTGCAGAATGGTGAGGG - Intronic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1027227406 7:76252782-76252804 TCTCATCTGCAAAATGGAAAGGG + Intronic
1028074839 7:86499177-86499199 TCTCACCTGCTCATTGGTGAGGG + Intergenic
1028367534 7:90050993-90051015 TCTCAACTTCAGATGGGGGAGGG + Intergenic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029595093 7:101533469-101533491 TCCCACCTCCAGAATGGGGCTGG + Intronic
1030065180 7:105653867-105653889 GTTCACCTGGAGAATGGGGGAGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1035073155 7:156159409-156159431 CCACTCCTGCAGCATGGGGATGG + Intergenic
1035344439 7:158188762-158188784 GCTCACCCGCTGTATGGGGAAGG + Intronic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1037720407 8:21439019-21439041 TCTCACCTGTATAGTAGGGATGG + Intergenic
1038003843 8:23413223-23413245 TCTCACCTGTAAAATAGGGAGGG + Intronic
1038136359 8:24790558-24790580 TCGGAGCTGGAGAATGGGGAGGG - Intergenic
1038214102 8:25545855-25545877 TCTGATCTTCAGCATGGGGAGGG - Intergenic
1039213849 8:35245717-35245739 TCTCCGCTGCAGAATGTGGTAGG - Intronic
1041984622 8:63907559-63907581 TCTTACCTGCAAAATGGGTATGG - Intergenic
1042998217 8:74724898-74724920 GCTTACCAGCAGAATTGGGAAGG - Intronic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1047301927 8:123620935-123620957 TCCCATCTGTAGAATGGGAATGG + Intergenic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1049098001 8:140560209-140560231 TCTCACCTGCAGTGTTGGGTGGG - Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049282484 8:141757146-141757168 TCTCAGCAGCACCATGGGGAGGG + Intergenic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1050862086 9:10447738-10447760 TCTTACTTGAAGAATGAGGAAGG - Intronic
1051674701 9:19547308-19547330 CAGCACCTGCAGAATGGGCAGGG - Intronic
1052495081 9:29214245-29214267 GCTCAGCTGGAGAAAGGGGAGGG + Intergenic
1052959402 9:34281930-34281952 TCCCACCAGCAGTATGAGGATGG - Intronic
1053004297 9:34593934-34593956 TCTAGGCTGCAGAATGGGGTGGG - Intergenic
1053265336 9:36708939-36708961 ACACACCTGCAGAATGCAGATGG - Intergenic
1053481131 9:38417368-38417390 TCTCATCTGTGAAATGGGGATGG - Intronic
1053546328 9:39026808-39026830 TCTCACATGTATAATTGGGAAGG - Intergenic
1053802693 9:41774290-41774312 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1053810643 9:41848470-41848492 TCTCACATGTATAATTGGGAAGG - Intergenic
1053887222 9:42652866-42652888 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054190999 9:61985636-61985658 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054226242 9:62460317-62460339 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054462292 9:65471930-65471952 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1054619950 9:67338969-67338991 TCTCACATGTATAATTGGGAAGG + Intergenic
1054647370 9:67602081-67602103 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056829408 9:89902676-89902698 TCTTTCCTGCACAGTGGGGAGGG + Intergenic
1056893397 9:90517272-90517294 TATCACCTGCAGGATGGTGGGGG - Intergenic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057207602 9:93183098-93183120 TCTCACCTTCACAATGTAGAGGG - Intergenic
1057504085 9:95618332-95618354 TGTCACCTGGAAAATGTGGAGGG - Intergenic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059130694 9:111745682-111745704 TCTCACCTCCAGAACTGTGAAGG + Intronic
1059434500 9:114267902-114267924 TTCCAACAGCAGAATGGGGAGGG - Intronic
1059467356 9:114477508-114477530 TCTAACTTGCAGAAGGGGGCAGG - Intronic
1059651475 9:116319679-116319701 TCTCATCTGCAGAATGGACTGGG + Intronic
1059694344 9:116716497-116716519 TCCCATCTGTAGAATGGGAATGG + Intronic
1060509355 9:124220872-124220894 CCTCCACTGCAGCATGGGGAGGG + Intergenic
1060556833 9:124512350-124512372 CCTCAGCTGCAGTGTGGGGAGGG + Intergenic
1060588352 9:124800675-124800697 TCTCGCCTGCGGAATTGGCACGG - Intronic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG + Intronic
1062053335 9:134458333-134458355 GCCCACCTGCAGAGTGGGAAGGG - Intergenic
1062360765 9:136186875-136186897 TCTCACCTGCAGTGTGGGGTCGG - Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186789759 X:12985525-12985547 TCTCACCTGCCTAATGTGGAAGG + Intergenic
1188870718 X:35367594-35367616 CCTCACCTGCTGCATGGGGAAGG + Intergenic
1189902774 X:45724497-45724519 TATAACCTACAGAATGGGAAAGG - Intergenic
1190051825 X:47156270-47156292 TATCACCTTAAGAGTGGGGAAGG - Intronic
1190503058 X:51098119-51098141 TGTCACCTGCTGCATGGGGTTGG - Intergenic
1191033959 X:56005667-56005689 TCACACCTGCAGGATAGGCATGG + Intergenic
1191763788 X:64673538-64673560 TGTCACTTGCAGAATGGAGCTGG + Intergenic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192496251 X:71618199-71618221 TCTCGTCTGCAAAATGGGGGGGG - Intronic
1193764168 X:85505563-85505585 TTTCACCTGCAAATTGGGCATGG - Intergenic
1193799156 X:85914313-85914335 TCTTACCTGCAGGATTGGGCCGG + Intronic
1196051788 X:111313273-111313295 TCACACATGCAGAATGAGGTAGG - Intronic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1201408713 Y:13675633-13675655 TCCCACCTGCAGTATGGTGAAGG - Intergenic
1201782999 Y:17743863-17743885 TCTCACCTCTAAAATAGGGATGG - Intergenic
1201818554 Y:18162124-18162146 TCTCACCTCTAAAATAGGGATGG + Intergenic