ID: 1184036287

View in Genome Browser
Species Human (GRCh38)
Location 22:41919860-41919882
Sequence CTCTGCGCCCTCGGGAGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184036287_1184036298 11 Left 1184036287 22:41919860-41919882 CCCGGACTCCCGAGGGCGCAGAG No data
Right 1184036298 22:41919894-41919916 GAAGCAGGCGCCCTTGGCCTTGG No data
1184036287_1184036302 28 Left 1184036287 22:41919860-41919882 CCCGGACTCCCGAGGGCGCAGAG No data
Right 1184036302 22:41919911-41919933 CCTTGGTCCCGCCCCTTATCCGG No data
1184036287_1184036294 -4 Left 1184036287 22:41919860-41919882 CCCGGACTCCCGAGGGCGCAGAG No data
Right 1184036294 22:41919879-41919901 AGAGGTCGGGAGCCCGAAGCAGG No data
1184036287_1184036295 5 Left 1184036287 22:41919860-41919882 CCCGGACTCCCGAGGGCGCAGAG No data
Right 1184036295 22:41919888-41919910 GAGCCCGAAGCAGGCGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184036287 Original CRISPR CTCTGCGCCCTCGGGAGTCC GGG (reversed) Intergenic
No off target data available for this crispr