ID: 1184036835

View in Genome Browser
Species Human (GRCh38)
Location 22:41922421-41922443
Sequence TTCTCTGGGGACCACAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 308}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184036825_1184036835 26 Left 1184036825 22:41922372-41922394 CCTCGTCTGTTAAATGCATATGA 0: 1
1: 0
2: 1
3: 42
4: 391
Right 1184036835 22:41922421-41922443 TTCTCTGGGGACCACAGGCCAGG 0: 1
1: 0
2: 3
3: 21
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184036835 Original CRISPR TTCTCTGGGGACCACAGGCC AGG Intergenic
900367405 1:2316832-2316854 TTCCCTGGGAGCCTCAGGCCTGG - Intergenic
900373643 1:2343627-2343649 TTTCCTGGGGAGGACAGGCCAGG + Intronic
901005593 1:6170299-6170321 CTCTCTGGGGGTCCCAGGCCGGG - Intronic
901034307 1:6327144-6327166 TTCTCTGGGGTCCCCAGGGAGGG - Intronic
901062278 1:6477250-6477272 CTCTGTGTGGGCCACAGGCCAGG + Intronic
901211961 1:7531780-7531802 CGCTCTGTGGACCACAGGCACGG - Intronic
901217739 1:7564167-7564189 GTCTGGGAGGACCACAGGCCAGG - Intronic
901254588 1:7811549-7811571 TTCTCTGAGAAGCACAGACCTGG - Intronic
904900915 1:33856371-33856393 TTCTCTGGGGAACCCCAGCCTGG + Intronic
906519710 1:46459804-46459826 TGCTCTGGGGAACAATGGCCTGG - Intergenic
909350028 1:74641035-74641057 TTCTGTAGGGAATACAGGCCAGG + Intronic
912625582 1:111203025-111203047 TTCTCTGGAGAGCACTGGCCTGG - Intronic
914258196 1:145977427-145977449 TTCACTGGAGACCCCAGGCAGGG + Intronic
915849826 1:159309638-159309660 TTCTCTTGGAGCAACAGGCCAGG + Intergenic
917255825 1:173115240-173115262 TTCTTTCAGGAACACAGGCCTGG + Intergenic
919782385 1:201229250-201229272 GTGTGTGGGGACCACAGGGCTGG + Intergenic
920686510 1:208113157-208113179 TCATCTGGGGACCAGATGCCTGG + Intronic
921075421 1:211696758-211696780 TTCCCTGGTGACCACAGCCCTGG - Intergenic
921404540 1:214764810-214764832 TTCTCTGTGAGCCACAGGCAGGG + Intergenic
924331742 1:242946592-242946614 TTCTCTGTGTACCACAGGCAGGG - Intergenic
1064024321 10:11834768-11834790 TACTCTTGATACCACAGGCCAGG - Intronic
1064415176 10:15143247-15143269 TTATCTTGGGGCCACAGGCTGGG + Intronic
1065151587 10:22827890-22827912 TTCTTTAGTGACCACAGGTCAGG + Intergenic
1065180204 10:23117264-23117286 ATCTCTGGGGTCCTCAGACCAGG - Intronic
1068774702 10:60857321-60857343 TTCTCAGGGGCCCAAAGGGCTGG - Intergenic
1069767367 10:70873033-70873055 TTCTCTGGAGACCATATGTCAGG - Intronic
1069795738 10:71050696-71050718 GTCGCTGGTGACCACAGTCCAGG - Intergenic
1069815781 10:71193569-71193591 TTCTCTGGGTACCATAGGGCGGG - Intergenic
1071618351 10:87095463-87095485 TCCTCTGGCGGCCTCAGGCCGGG + Intronic
1072009900 10:91293287-91293309 TTCTCTGGGGATCACACTGCAGG + Intergenic
1075263247 10:120980418-120980440 TTCGCAGGGGACCACAGGCCAGG - Intergenic
1076498563 10:130916015-130916037 TGCTCTGGGGAAAACTGGCCAGG - Intergenic
1076761463 10:132608047-132608069 GTCTATGGGGAGCGCAGGCCTGG + Intronic
1076788107 10:132761290-132761312 TTGTCTGGAGACCACACGCTGGG + Intronic
1077141797 11:1028056-1028078 ACCTCTGGGGATGACAGGCCCGG + Exonic
1077178653 11:1202693-1202715 TCCTGTGTGGGCCACAGGCCTGG - Intergenic
1077604005 11:3594836-3594858 GTCTCTGGAGCCCACAGGACTGG + Intergenic
1078106668 11:8362110-8362132 TTCTCTGGGCAGCAGAGGCTTGG + Intergenic
1081728089 11:45346782-45346804 TTCCCAGGGGTACACAGGCCTGG + Intergenic
1083990104 11:66241618-66241640 TTCTTTGGTGACCACAGTCATGG - Exonic
1084406699 11:68978484-68978506 TTCTCTGGGACACACAGACCTGG + Intergenic
1085854720 11:80163157-80163179 TTCTTTGGGGCCCACTGCCCTGG - Intergenic
1086547626 11:88016489-88016511 TTCCTGGGGGAACACAGGCCGGG + Intergenic
1089336857 11:117731184-117731206 TTCTCTGGGCACAATAGGGCAGG - Intronic
1089388182 11:118081469-118081491 TGCTCTGGGGGCCACGGGCAGGG - Intronic
1090400008 11:126443017-126443039 CCCCCTGGGGAACACAGGCCGGG - Intronic
1090414737 11:126533228-126533250 TTGTCTGGGGCCCACAGCACTGG + Intronic
1090609392 11:128456661-128456683 AGCTCTGGGAGCCACAGGCCTGG - Intergenic
1090687880 11:129144518-129144540 ATATCTGGGCACCACAGACCAGG + Intronic
1091250469 11:134140036-134140058 TGCTCTGCGGTGCACAGGCCTGG + Intronic
1091337407 11:134782759-134782781 TTCTCATGGGGCCACATGCCGGG - Intergenic
1091663052 12:2398828-2398850 TTACCTGGGGACCTCAGGACAGG + Intronic
1092166995 12:6348413-6348435 TTCTCTGGGTGACACTGGCCAGG - Intronic
1092170418 12:6370697-6370719 ACGTCTGGGGACCACAGGCAGGG + Intronic
1092292043 12:7165962-7165984 ACCTCTGCTGACCACAGGCCAGG - Intergenic
1092408289 12:8235668-8235690 CTCTCACGGTACCACAGGCCTGG - Intergenic
1095906925 12:47388194-47388216 TTCTTGGTAGACCACAGGCCTGG - Intergenic
1095984563 12:47990842-47990864 AACTCTGGGGGCCACAGGCTGGG + Intronic
1096079749 12:48825502-48825524 TTCTCAGGCCACCTCAGGCCAGG - Intronic
1096751109 12:53759332-53759354 TGCTCTTGGGACCAGAGGCAAGG + Intergenic
1096856058 12:54484051-54484073 CTCTTGTGGGACCACAGGCCTGG + Intergenic
1096967734 12:55641828-55641850 GGCTCTCGGGACGACAGGCCTGG + Intergenic
1098022374 12:66169695-66169717 TTCTCCGGGTACCAGAGGACTGG - Intronic
1098504718 12:71236367-71236389 GTATCTGGGGACAACAGGGCAGG + Intronic
1102049504 12:109852442-109852464 TGCTCTGGGGGACACAGGCCAGG + Exonic
1102460908 12:113099045-113099067 AGCTTTGAGGACCACAGGCCTGG - Exonic
1103926354 12:124425590-124425612 TCCTCTGGGGACCCCGGGCCAGG + Intronic
1103981999 12:124742637-124742659 CTCTCTGGGCACCCCAGGCTCGG - Intergenic
1104931856 12:132343919-132343941 TCCTCTGGGGTCCTCAGGGCGGG + Intergenic
1104947786 12:132424576-132424598 TTCTCTGGTAATCACAGGCGTGG - Intergenic
1106612921 13:31300628-31300650 TTGGTTGGGGACCACAGGACTGG + Intronic
1107349685 13:39501033-39501055 TCCTTTGGGGACCACTGCCCTGG + Intronic
1107823482 13:44306810-44306832 TTTTCTGGGCACCCCAGGCTCGG + Intergenic
1107877442 13:44803181-44803203 AAGTCTGGGGACCACAGGCTAGG - Intergenic
1108611029 13:52083928-52083950 TTCTCTCTGGAGCAGAGGCCTGG - Intronic
1109304853 13:60627128-60627150 TTCTGTGGGTACCACTGGCTTGG - Intergenic
1110256905 13:73443141-73443163 TTCTTTGCTGACCACAGGTCAGG - Intergenic
1112301540 13:98235277-98235299 TTCCCTGGGGCCCACAGCCTTGG - Intronic
1113297980 13:108983333-108983355 TTCTCTGGGAAACACTGTCCTGG - Intronic
1113599410 13:111558061-111558083 ACCCCTGGGGACCCCAGGCCTGG - Intergenic
1113705207 13:112425895-112425917 TTCCCTGGGGATCCCAGACCTGG - Intronic
1113877065 13:113601283-113601305 AACTCAGGGCACCACAGGCCAGG - Intronic
1115984293 14:39088160-39088182 CTATCTGGGGAGCAAAGGCCAGG + Intronic
1118487801 14:66230375-66230397 TTCCCTGGAGACCTCAGCCCTGG + Intergenic
1119331332 14:73796251-73796273 TCCTCTGTGGACCACATCCCAGG + Intergenic
1119775043 14:77243075-77243097 CTCCCTGGGGTCCCCAGGCCTGG - Intronic
1121312453 14:92942562-92942584 TTCTCTGAGGATCACAGCCAAGG + Intronic
1121452248 14:94016450-94016472 TTCACTGGGGGCCAGATGCCCGG + Intergenic
1121638214 14:95467867-95467889 TGCCCTGGGGACCAGAAGCCCGG - Exonic
1121920785 14:97879065-97879087 TTCTCTGGAGACCTCAAGACTGG - Intergenic
1122135839 14:99632417-99632439 TTCTCTGGGCTTCACAGGGCAGG + Intergenic
1122457317 14:101864575-101864597 TTCTCTGGGGCGCCCAGGCAAGG - Intronic
1202857520 14_GL000225v1_random:60128-60150 TTCTCTGGGCTCCACAGGGAGGG - Intergenic
1123718309 15:23044904-23044926 TCCTCTGGGCACCTCTGGCCAGG - Intergenic
1123804702 15:23859344-23859366 TTCTCTGGGAAGCACAGATCTGG - Intergenic
1124019031 15:25903123-25903145 GACTGTGGTGACCACAGGCCAGG + Intergenic
1124227267 15:27904808-27904830 TGCTGTGGTGGCCACAGGCCAGG - Intronic
1127098311 15:55535538-55535560 TTCTCTGTGCACCACAGGCAGGG - Intergenic
1127978768 15:64018587-64018609 TTCTCTGGGTCCCACAACCCAGG + Intronic
1128136225 15:65265625-65265647 TTCCTTGGGGACCACACTCCAGG - Intronic
1128714571 15:69898388-69898410 TTCTCTCAGTACCACAAGCCTGG + Intergenic
1129378985 15:75153838-75153860 TTCCATGGGGCCCACAGGCAAGG + Intergenic
1129739569 15:77983730-77983752 TACTCTCGGGACCACGGGGCAGG + Intergenic
1129756648 15:78103000-78103022 CTCTCTGGGGACCACAGACCTGG + Intronic
1129846337 15:78769317-78769339 TACTCTCGGGACCACGGGGCAGG - Intronic
1130255582 15:82324609-82324631 TACTCTCGGGACCACGGGGCAGG + Intergenic
1130599385 15:85265377-85265399 TACTCTCGGGACCACGGGGCAGG - Intergenic
1131156180 15:90077148-90077170 TTCTCTGGGGCCCACAGGACGGG + Intronic
1131510674 15:93047992-93048014 TTCTCTGGGGCCCGGAGGCCAGG + Intronic
1131741981 15:95402818-95402840 TTATCTGGATACCACATGCCAGG - Intergenic
1131868974 15:96742181-96742203 TGCTCTGGGGACCAAAGGAGGGG + Intergenic
1132509569 16:331927-331949 GTCTCTGGAACCCACAGGCCTGG - Intronic
1132518055 16:375066-375088 TTCACTCAGGACCACAGGCCGGG - Intronic
1132569710 16:638729-638751 CCCTCTGAGGGCCACAGGCCTGG + Intronic
1132614862 16:835440-835462 TGCTCTGCAGACCCCAGGCCAGG + Intergenic
1132664196 16:1074173-1074195 TTGTCCTGGGAGCACAGGCCTGG + Intergenic
1133729751 16:8569335-8569357 CTCTCTGGGGAGCTCTGGCCTGG - Intergenic
1134070836 16:11258720-11258742 TAGTCCAGGGACCACAGGCCAGG + Intronic
1135594305 16:23729964-23729986 TTTTCTGAGGACCACAGGATTGG - Intergenic
1137755734 16:50900758-50900780 TTCTCAGCTGAACACAGGCCAGG + Intergenic
1139346057 16:66304594-66304616 CTCCATGGGGACCCCAGGCCAGG + Intergenic
1139545399 16:67647489-67647511 GTCTCTGGGGACCAGACCCCAGG - Exonic
1142692682 17:1616494-1616516 TTCTGTGGGGAACTCAGCCCAGG + Intronic
1143183467 17:4997814-4997836 CTCGCTGGGCCCCACAGGCCAGG + Intergenic
1143355073 17:6321582-6321604 TTCTCTCGAGACCACATGCAAGG - Intergenic
1143370316 17:6435276-6435298 CTGCCTGTGGACCACAGGCCCGG - Intergenic
1144584648 17:16480902-16480924 TTCTCCAGGGACCACTGGGCTGG + Intronic
1146279857 17:31538034-31538056 CTCCCTGGGGCCCACAGGGCAGG - Exonic
1146399432 17:32491743-32491765 TTCCCTGGGAGCCACAGGGCTGG - Intergenic
1147212760 17:38881618-38881640 TGCTTTGTGGACCACAGGCCTGG + Intronic
1148132649 17:45271206-45271228 TTCTCAGGGGACTACATCCCTGG - Exonic
1149608536 17:57942057-57942079 TTCCCTGGGGACCCCAGGCTCGG + Intronic
1151241234 17:72759918-72759940 TTCTCTGGGTATCACAAGGCAGG - Intronic
1151548244 17:74806491-74806513 TCCTCTGGGCACTACAGGCGTGG - Intronic
1152005907 17:77681032-77681054 TCCTCTCTGGACCTCAGGCCTGG + Intergenic
1152517828 17:80836610-80836632 TTCTCGTGGTACCCCAGGCCTGG - Intronic
1152904007 17:82960704-82960726 TCCGGCGGGGACCACAGGCCTGG - Intronic
1152932436 17:83116689-83116711 GTCTCTGAGGACGACAGGGCCGG - Intergenic
1153693749 18:7619392-7619414 TTCACTGGGGACTCCAGTCCCGG + Intronic
1153804863 18:8703319-8703341 CCCTCTGGGGACAGCAGGCCCGG + Intergenic
1155565620 18:27131224-27131246 TTCTCTGGGGTCCCTGGGCCAGG - Intronic
1158152041 18:54384238-54384260 TTCTTTACTGACCACAGGCCAGG + Intronic
1158405317 18:57154829-57154851 TGCTCTGGGGGGCACAGGACTGG + Intergenic
1160401085 18:78612021-78612043 GGTTCTGGGGAGCACAGGCCGGG - Intergenic
1160571335 18:79819415-79819437 TGCTGTGGGGACCCCAGGCCTGG - Intergenic
1160586748 18:79917443-79917465 TGCTCTGGAGGGCACAGGCCTGG + Intronic
1160740482 19:683273-683295 TTTTCTGGGCACCACAGGTAAGG - Exonic
1160903857 19:1442923-1442945 GTCTCTGGGCAGCACTGGCCAGG + Intergenic
1161930749 19:7337940-7337962 TTCTCTGGGGTCCAACAGCCTGG + Intergenic
1161949946 19:7462383-7462405 TCCTCAGGGAACCCCAGGCCAGG + Intronic
1162057117 19:8071454-8071476 TTCTCTGGGGACCCCAGCAGAGG - Intronic
1162943973 19:14031448-14031470 TTCTCTGGGGTCCACAGCCTTGG - Intergenic
1162957598 19:14107784-14107806 TTCTCTGGGGAGGCCGGGCCTGG + Intronic
1163582501 19:18146895-18146917 ATCCCTGCGGACCACAGCCCTGG + Exonic
1164598738 19:29547270-29547292 TTATCTGGCAACCCCAGGCCTGG + Intronic
1164717631 19:30405072-30405094 TTCCCTGGGCACCACTGTCCGGG + Intronic
1165115052 19:33523518-33523540 TTCTCAGGGGCCCCTAGGCCAGG - Intergenic
1165142272 19:33706890-33706912 TTGTGGGAGGACCACAGGCCGGG + Intronic
1166292102 19:41869843-41869865 TTCTCTGGAGGGCACAGCCCAGG + Intronic
1167414561 19:49363236-49363258 TTCCCTGAGGACCTCAGGTCCGG - Intronic
1167748279 19:51365613-51365635 CCCTCTGGGGACAACAAGCCAGG + Intronic
1168288688 19:55346841-55346863 TCCTCTGGGGAGCGCAGGGCAGG + Intronic
1168692010 19:58382989-58383011 TTCTGGTGGTACCACAGGCCTGG + Intergenic
926363688 2:12113774-12113796 TTCTCTGGGGAACACAGGAAAGG + Intergenic
927480337 2:23448787-23448809 TTCTCTGGCAAGCACAGGCAAGG - Intronic
927520078 2:23693250-23693272 TTCTCTGGGGGCGACAGCGCAGG - Exonic
927942418 2:27113270-27113292 TTCTCTGTGGCACCCAGGCCAGG - Intronic
928637036 2:33257472-33257494 TTCTCCCGGGAACACGGGCCAGG + Exonic
928920076 2:36517604-36517626 TTCTGTGGGACCCACAGGGCAGG + Intronic
930014049 2:46958507-46958529 TTCTTGGGGGAACACAGTCCCGG + Intronic
931228114 2:60351506-60351528 TTCCCCTGGGGCCACAGGCCCGG + Intergenic
932439187 2:71721096-71721118 TTCACTGGGGAGCATGGGCCAGG - Intergenic
932778097 2:74540529-74540551 TTGACTGGGGAACACAGGCCAGG + Intronic
933686180 2:85143098-85143120 TTATCTGGGGTCCTCAGGACAGG + Intronic
937214000 2:120299064-120299086 TGCTCTGGGGGCCATTGGCCAGG + Intergenic
939533617 2:143396467-143396489 GTCTCTGGGGACCACTTGACTGG - Intronic
942089995 2:172480519-172480541 TGCTCTTGGGAACACAGGGCGGG - Intronic
944926961 2:204475179-204475201 TTCTCTAAGGGCTACAGGCCAGG - Intergenic
945977113 2:216279638-216279660 TTCCCTGGAGGCCACTGGCCAGG - Intronic
946368465 2:219265731-219265753 TTTTCTGGGGACATAAGGCCAGG + Intronic
947201170 2:227615908-227615930 CTCTCTAGGGAGCCCAGGCCAGG - Intronic
948888613 2:240896338-240896360 TTCTCCAGGGACCCCAAGCCTGG - Intronic
948969755 2:241415767-241415789 TTGTGTGGAGACTACAGGCCTGG + Intronic
1171033532 20:21698196-21698218 TTCTATGAGGACCACAAGTCTGG + Intergenic
1172523246 20:35582707-35582729 TTCTCTGGGGAAAAGAGACCTGG + Intergenic
1173895214 20:46545836-46545858 GGCTCTGGGCCCCACAGGCCAGG - Exonic
1174103643 20:48146702-48146724 CTCTCTGGGGTTCACAGGCAAGG + Intergenic
1175242081 20:57557100-57557122 TCCTCTGGGTCCCCCAGGCCAGG - Intergenic
1175960618 20:62634622-62634644 TTCTCTGGGGGCTCCAGGCCTGG + Intergenic
1175980590 20:62736616-62736638 TTCCCTGGGAGCCACAGGCCAGG - Intronic
1176057486 20:63156303-63156325 TTCCCTGGGGACAGCAGGCCGGG + Intergenic
1176152057 20:63596507-63596529 AGCTGTGGGGACCACCGGCCAGG - Intronic
1178634944 21:34294238-34294260 TTCTCTGGGAACCACAGAAATGG - Intergenic
1179405222 21:41120397-41120419 TCCTGTGGGGACCTCAGTCCTGG - Intergenic
1179447627 21:41444064-41444086 TTTTCAGGGGACCACAGTCAGGG + Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179912183 21:44456189-44456211 ACCGCTGGGGACCAAAGGCCGGG - Intronic
1181162606 22:20967110-20967132 TTCCCTGGGGACCAGTGGACTGG + Intronic
1181464807 22:23105184-23105206 TCCCCTGGTCACCACAGGCCAGG - Intronic
1181910134 22:26231962-26231984 TGCTGTGGGGACCCCAGGGCAGG - Intronic
1183200058 22:36379844-36379866 TTCTCTGGGGACACCTGCCCGGG + Intronic
1183481935 22:38070014-38070036 GGCTCTGGGGAACCCAGGCCTGG + Intronic
1184004261 22:41697114-41697136 CTCTCTGGGGACTTAAGGCCTGG - Exonic
1184036835 22:41922421-41922443 TTCTCTGGGGACCACAGGCCAGG + Intergenic
950018150 3:9768577-9768599 TTAGCTGGGGGCCCCAGGCCAGG - Intronic
952741399 3:36738167-36738189 TTCTCTGGGGACCAGTGAGCTGG - Exonic
952964963 3:38615377-38615399 TGCCCTGGGGTCCACAGGTCTGG + Intronic
952988968 3:38814333-38814355 GTATCTGGGGACCATAGGGCTGG + Intergenic
953028258 3:39158007-39158029 ATATCTGGGGTCCACAGGTCAGG + Intergenic
953494268 3:43372727-43372749 CTCTCTGGAGACCACATACCAGG - Intronic
953537310 3:43786253-43786275 TACCGTGGGGACCACAGGGCTGG - Intergenic
954201010 3:49022998-49023020 TGCTGCGGGGAGCACAGGCCTGG + Intronic
955410101 3:58649944-58649966 TTCACTGGGGCCCAGGGGCCAGG - Intronic
955861461 3:63334985-63335007 TTCTCTGGGGTACAGAGTCCAGG + Intronic
956989913 3:74751348-74751370 CCCTTTGGGGACCCCAGGCCTGG - Intergenic
958698033 3:97551822-97551844 TTCTCTGGGGAATACAAGTCTGG + Intronic
959619715 3:108386732-108386754 TTCTCTAGGAACCAAATGCCAGG - Intronic
960090533 3:113633968-113633990 TCCTCTGGGCAGGACAGGCCAGG - Intergenic
961018647 3:123486022-123486044 TGCTCTGGGGACCACTGGTCAGG + Intergenic
962653319 3:137517701-137517723 TCCTCCAGGGACCTCAGGCCTGG + Intergenic
962685931 3:137847732-137847754 TTCTCTGGGGAAGTCAGGGCAGG - Intergenic
963063901 3:141247145-141247167 CTCACTGGGGACTCCAGGCCTGG - Intronic
963259288 3:143176925-143176947 CTCTTTGGGGGCCACGGGCCTGG - Intergenic
963605314 3:147408100-147408122 TTCTCTGGCGATCAAAAGCCTGG + Intronic
963843685 3:150133321-150133343 TTCCCTGGAGGTCACAGGCCAGG - Intergenic
965449890 3:168824806-168824828 GCCTCTGGGGACCAGAGGGCTGG + Intergenic
967531291 3:190551146-190551168 TTCTCTACTGACCACAGGTCAGG + Intronic
967547757 3:190751749-190751771 ATCTTTGGGGGCCACAGGACAGG - Intergenic
968047658 3:195632895-195632917 TGCTGTGGTGACCACAGGGCAGG + Intergenic
968306954 3:197657029-197657051 TGCTGTGGTGACCACAGGGCAGG - Intergenic
969497135 4:7532662-7532684 TTCTGCTGAGACCACAGGCCTGG + Intronic
970212077 4:13720324-13720346 TTCTCTGGGGGCCACGGGTAGGG - Intergenic
970218950 4:13787459-13787481 ATTTCTAGGCACCACAGGCCTGG + Intergenic
970324459 4:14909033-14909055 TTCTCTGGGCCCCACCAGCCAGG + Intergenic
971372958 4:26032923-26032945 TTGTCTGGGGAGCACAGGGTTGG + Intergenic
972150598 4:36084766-36084788 TGCTGTGGTGACCAAAGGCCTGG + Intronic
975526667 4:75358331-75358353 TTCTCTGGGTAGCCCCGGCCAGG + Intergenic
978229827 4:106385290-106385312 CCCTTTGGGGACCCCAGGCCTGG - Intergenic
978303498 4:107295649-107295671 TTCTCTGGTGAGCAGAGGCAGGG + Intergenic
978386850 4:108185150-108185172 TTCTCTTTGGACCACATTCCAGG + Intergenic
980257605 4:130402567-130402589 CTCTCTGTGCACCACAGGCAGGG + Intergenic
981324762 4:143433069-143433091 TACTCACAGGACCACAGGCCTGG + Intronic
983779643 4:171651568-171651590 TTCCCTGGGGACCCAAGGACAGG + Intergenic
985719338 5:1481164-1481186 GGCTCTGGGGACCTCAGGCTGGG - Intronic
985743954 5:1636269-1636291 TGCTGTGGTGACCACAGGGCAGG - Intergenic
985904428 5:2822671-2822693 TCCCCTGGGGACGACAGGGCAGG + Intergenic
987194282 5:15509837-15509859 TTCTCTGCGGTACACAGGCTGGG - Intronic
987847524 5:23305286-23305308 GTCTCTGGGATCCCCAGGCCTGG - Intergenic
987959780 5:24791515-24791537 CTGCCTGGGGACCACATGCCAGG + Intergenic
988882615 5:35519960-35519982 TTCTCTCCGGACCCCAGGCAGGG - Intergenic
988909799 5:35827618-35827640 TTCTCTCAGGACCACCAGCCTGG - Intergenic
991642976 5:68772932-68772954 TGTCCTGGGGAGCACAGGCCTGG + Intergenic
992331753 5:75724047-75724069 TTCTCTGGATTCTACAGGCCTGG + Intergenic
992624946 5:78628395-78628417 TTCTCTCTGGAGAACAGGCCAGG - Intronic
993856912 5:93087612-93087634 TTTTCTTTGTACCACAGGCCTGG - Intergenic
994097172 5:95857714-95857736 GTCTCTGCGGGCCAAAGGCCAGG - Intronic
994293909 5:98065717-98065739 TCCTCTGGGGCCCATAGGCAGGG + Intergenic
1000695624 5:164378130-164378152 TTCTCTGGGAACCAAATTCCAGG - Intergenic
1001304368 5:170560972-170560994 CCCTCTGGGGCCCAGAGGCCAGG + Intronic
1001444811 5:171774970-171774992 TTCTCTGACCACCAGAGGCCCGG - Intergenic
1002425920 5:179175854-179175876 TGCTCTGGGGAGCACTGCCCTGG - Intronic
1002567332 5:180119310-180119332 TGCACTGGGGGCCACAGGCCAGG + Intronic
1004048667 6:12050887-12050909 GTATCGGGGAACCACAGGCCAGG + Intronic
1004266158 6:14150232-14150254 TTCTATGGGGCCCATGGGCCAGG - Intergenic
1006187161 6:32188079-32188101 CTCTTTGGGGGCCACGGGCCTGG + Exonic
1006595965 6:35192663-35192685 CTCTCTGTGGGCCACGGGCCTGG + Intergenic
1006763588 6:36485400-36485422 TTCCATGGGGACCACAGGTTGGG - Intronic
1006796277 6:36734450-36734472 TTCTCTGGGGCCCAGGGACCTGG + Intergenic
1007323395 6:41042862-41042884 TTCTCTGAGGGGCTCAGGCCAGG + Intronic
1014773274 6:125480809-125480831 TTCTCTGGGGAGCAGTAGCCAGG + Intergenic
1015197121 6:130536489-130536511 TTGGCTGGGGAACACAGGCGAGG - Intergenic
1015863188 6:137701824-137701846 TGCTCTCAGGACAACAGGCCCGG - Intergenic
1017876438 6:158528970-158528992 TGCACTGGGGACCACAGAGCTGG + Intergenic
1018560416 6:165096668-165096690 TTAACTGGGGAACAGAGGCCTGG - Intergenic
1018909909 6:168095950-168095972 TTATCTGAAGTCCACAGGCCTGG + Intergenic
1018913921 6:168121221-168121243 TTATCTGGCGACCTGAGGCCTGG - Intergenic
1019359061 7:595445-595467 GTCTGTGGGGAACACAGGCAGGG - Intronic
1019716647 7:2542334-2542356 TTCTCTGCAGGCCACTGGCCAGG + Intronic
1019985276 7:4650882-4650904 TTTTCTGCGGAACAAAGGCCCGG + Intergenic
1022013487 7:26329151-26329173 CTCACTGTGGTCCACAGGCCCGG + Intronic
1023931608 7:44709590-44709612 TTCTCTAGGGAGCACCTGCCTGG + Intergenic
1023982417 7:45077780-45077802 TACTCATGGGACCCCAGGCCAGG + Intergenic
1024241690 7:47440622-47440644 CTCCCTGGGGCCCACAGGGCTGG - Intronic
1025215756 7:57054723-57054745 TTGGGTGGGGACCACAGGACTGG - Intergenic
1025626504 7:63227130-63227152 TTGGGTGGGGACCACAGGACTGG - Intergenic
1025655621 7:63515979-63516001 TTGGGTGGGGACCACAGGACTGG + Intergenic
1026190273 7:68119380-68119402 TTGGGTGGGGACCACAGGACTGG - Intergenic
1027053029 7:75031605-75031627 TGGTCGGGGGAACACAGGCCAGG + Intronic
1027221399 7:76216525-76216547 TTCTCTCAGGAAGACAGGCCAGG - Intronic
1028177107 7:87672162-87672184 TTGTCTGGAGAACACAGGCAGGG + Intronic
1031593534 7:123621888-123621910 TACTCTGGGCTCCACTGGCCAGG - Intronic
1032083140 7:128869905-128869927 CTCTCCGGGGCCCCCAGGCCTGG - Intronic
1032947755 7:136871252-136871274 GTCTCTGGGGAAAACGGGCCGGG + Intronic
1035029524 7:155848403-155848425 TTCTCTGGTGCCCCCAGGCCTGG + Intergenic
1036653467 8:10660818-10660840 TTCTCTGGGGACCCCGCTCCTGG + Intronic
1037176398 8:15951510-15951532 TTCTCTCGGTGTCACAGGCCTGG - Intergenic
1037664151 8:20953464-20953486 TTCTCTGGGTTCCACAAGGCTGG - Intergenic
1038782369 8:30579210-30579232 ATCTCAGGGGAACAAAGGCCCGG - Intronic
1039568346 8:38566535-38566557 CTCTCTGTGGCCCACAGGACTGG + Intergenic
1039680452 8:39730125-39730147 GTCTCTGGGATCCACAGACCTGG + Intergenic
1041314211 8:56544671-56544693 TTCCATGGGGAACACAGGCAAGG - Intergenic
1045170306 8:99658951-99658973 TACTATGGGGACTACAGGCATGG + Intronic
1045350100 8:101330605-101330627 TGCTTTGGGGACCCCAGGCGAGG - Intergenic
1046895163 8:119463933-119463955 TCCTCTGTGCACCACAGGCAGGG - Intergenic
1051130809 9:13858244-13858266 TTCTTTGGGAAATACAGGCCTGG + Intergenic
1053427017 9:38016895-38016917 TTCTCTGGGGAGAAGAGGCAGGG - Intronic
1054901371 9:70372596-70372618 TTTTCTGGGGACAGCAGGGCAGG - Intergenic
1056185281 9:84128634-84128656 TACTCTGAGGGGCACAGGCCTGG - Intergenic
1057672642 9:97107645-97107667 TTCTCTGGGAAGCCCAGGGCAGG + Intergenic
1059336107 9:113569335-113569357 GCCTCTGGGGACCACATGGCTGG + Intronic
1059390673 9:113997889-113997911 GTCTGTGGTGGCCACAGGCCAGG + Intronic
1059997995 9:119932410-119932432 TTCTCAGGGGCCCACAGCACAGG - Intergenic
1060250971 9:121986568-121986590 CTCCCTGGGAACCAAAGGCCAGG + Intronic
1061130474 9:128705309-128705331 TCCTCTGGGGGCCACTGGCTCGG - Exonic
1061368366 9:130184299-130184321 CTCTCAGGGACCCACAGGCCTGG + Intronic
1062044056 9:134417098-134417120 TTCCCTGGGAGCCACTGGCCGGG + Intronic
1062079915 9:134618377-134618399 TGCACTGGAGCCCACAGGCCGGG + Intergenic
1062155747 9:135047162-135047184 GTCACTGGGGGGCACAGGCCTGG + Intergenic
1185758152 X:2668373-2668395 ATCTCAGGTGACCACCGGCCTGG - Intergenic
1186083043 X:5954027-5954049 TTCTCTGGGTTTCACAGGGCGGG - Intronic
1186785936 X:12955970-12955992 CTCTCAGGGAACCACAAGCCAGG + Intergenic
1187039795 X:15581372-15581394 TTCTCTGTGCATCCCAGGCCTGG + Exonic
1189208584 X:39263469-39263491 TTCTGTGGTGACCCCAGGCAAGG + Intergenic
1189382039 X:40508906-40508928 TTTTCTGTGGGCCACAGCCCAGG - Intergenic
1190267385 X:48835494-48835516 TGCTCTGGGGGCCGCGGGCCGGG - Exonic
1190640868 X:52482022-52482044 GTCTGTGGGGACAGCAGGCCTGG - Intergenic
1190646804 X:52530843-52530865 GTCTGTGGGGACAGCAGGCCTGG + Intergenic
1194029132 X:88789773-88789795 TTCTCTGGGGACTCCATCCCAGG + Intergenic
1196035293 X:111137247-111137269 TTCTCTCAGGACTACAGGCTTGG + Intronic
1198216875 X:134563586-134563608 TTCTCTGATGACCTCAGCCCAGG + Intergenic
1198506942 X:137310361-137310383 TTCTTTGTGTACCACAGGGCAGG + Intergenic
1200176709 X:154122179-154122201 TTCCCTGGAGAACACAGGCACGG - Intergenic
1201890515 Y:18938811-18938833 TTCTCTGGAGAACTCTGGCCAGG - Intergenic