ID: 1184037560

View in Genome Browser
Species Human (GRCh38)
Location 22:41925989-41926011
Sequence GGGGAGAGAAGGGCTTTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 320}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184037560 Original CRISPR GGGGAGAGAAGGGCTTTAAG GGG (reversed) Intronic
900132338 1:1092417-1092439 GGGGAGAGAGGGGGTTTGTGCGG - Intronic
901244620 1:7719894-7719916 GGGCAGCCAAGGGCTGTAAGTGG + Intronic
901502336 1:9660708-9660730 GGGGAGACAAAGGCATGAAGGGG - Intronic
901737901 1:11323937-11323959 GGTGAGAGAAGGGCTCCCAGGGG - Intergenic
902211484 1:14907854-14907876 GGGGAGAGAAGGGTTGGAGGAGG - Intronic
902256190 1:15190126-15190148 GGTGAGAGACGGGATTTTAGAGG + Intronic
903047543 1:20575785-20575807 TGGGAGAGAGGGACTTTGAGAGG - Intergenic
903778681 1:25808654-25808676 GGGGAAGGAAGGGCTGGAAGTGG - Exonic
903784983 1:25854612-25854634 GGGGAGATAAGAGGTATAAGTGG + Intronic
903831439 1:26177613-26177635 GGGTAGAGTTGGGCTTGAAGGGG + Intronic
904886932 1:33745760-33745782 GGGGAGAGAAGGACATGAAAAGG + Intronic
904896933 1:33824596-33824618 GAGGAGAGAAGGGCATAGAGTGG - Intronic
905569181 1:38990959-38990981 GGGGAGGGGAGAGCTTGAAGGGG - Intergenic
907192389 1:52660300-52660322 GGGCAGGGAGGGGCTTTATGAGG - Intronic
907338864 1:53719293-53719315 CAAGAGAGAAGGGCTCTAAGAGG - Intronic
907612204 1:55882763-55882785 CTGGAGATAAGGTCTTTAAGAGG + Intergenic
907774774 1:57503247-57503269 TGAAAGAGAAGGGATTTAAGGGG - Intronic
908825401 1:68128117-68128139 GGGTAGAGAAGGCATTAAAGGGG + Intronic
909356572 1:74716560-74716582 TGGGAGAGAGTGGCTATAAGTGG - Intronic
910328960 1:86046831-86046853 GTGGAAAGAAGGGTTTTAAGGGG - Exonic
910488088 1:87738024-87738046 GGGCAGAGAAGTGCTTAAACCGG + Intergenic
911320617 1:96409741-96409763 AGGGAAAGAAGGGCATTGAGAGG + Intergenic
911672291 1:100620732-100620754 GTGTAGAGAATGGCTTTGAGAGG - Intergenic
912911205 1:113760241-113760263 GTGGGGAGAATGGCTGTAAGGGG - Intergenic
917183354 1:172323354-172323376 GGGGACAGAAGAGCTGCAAGAGG - Intronic
917265444 1:173216262-173216284 GGAGAAAGAAGGGAATTAAGGGG - Intergenic
918113351 1:181477038-181477060 TGGGAAAGAAAGGCTTGAAGTGG + Intronic
918247384 1:182671881-182671903 GCAGAGAGAAGAGCTTTCAGTGG - Intronic
918404479 1:184198030-184198052 GGAGAGAGCAGGGCTCTAGGGGG + Intergenic
918459173 1:184757731-184757753 GGGGAGATGGGGCCTTTAAGAGG - Intergenic
920242115 1:204560604-204560626 GGAGAGAGAATGGCTTTTGGGGG + Intergenic
922061587 1:222097652-222097674 GGGGACAGGAGGGTTTTATGCGG + Intergenic
922781505 1:228256570-228256592 GGGGAGAGAAGGCCTGGAAGGGG - Intronic
922781895 1:228259419-228259441 GGGGAGAGAAGGCCTGGAAGGGG - Intronic
923106971 1:230861803-230861825 GGGGAGTGAGGGGCTTTCTGGGG + Intronic
923674286 1:236065998-236066020 AGGGAGATAAGCGATTTAAGTGG + Intergenic
923980911 1:239322390-239322412 AGAGAGAGAAAGACTTTAAGAGG - Intergenic
1063214661 10:3913284-3913306 TGGGAAAGAAGGGCTTTACAGGG + Intergenic
1063950337 10:11216330-11216352 GGGGCCAGAAGAGCTTTGAGAGG - Intronic
1064699774 10:18007029-18007051 GGGGAGAGATGGGTGTTAAGAGG - Intronic
1065771935 10:29085885-29085907 TGAGAGAGCAGGGCTTCAAGAGG + Intergenic
1068801382 10:61144551-61144573 GGGCAGAGAAGGGCTAAAAATGG - Intergenic
1068810609 10:61251658-61251680 GAGGAGAGAAAGTATTTAAGGGG + Intergenic
1069856412 10:71443464-71443486 GGGGAGAGAAGGGCACAGAGAGG - Intronic
1069900572 10:71704601-71704623 GGGGAGAGCAGGGGATGAAGGGG + Intronic
1071986942 10:91061473-91061495 GGTGAGAGGAGGGCATTGAGTGG - Intergenic
1072208112 10:93222171-93222193 GAGCACAGAAGGGCTTTAAGTGG - Intergenic
1073002219 10:100294258-100294280 GGGGAGAAAAGTGCCTTATGAGG - Intronic
1073034887 10:100557080-100557102 GGGGACAGAAAGGGTTTAATAGG + Exonic
1073700294 10:105919117-105919139 GAGGAGAGAAGAGCACTAAGGGG - Intergenic
1074272714 10:111971010-111971032 GGGGAGTTAAGGGGTTTGAGGGG - Intergenic
1075048459 10:119164823-119164845 TTGGAGAGCAGGGCTTTAGGGGG - Intronic
1075429442 10:122368349-122368371 GGGGAAAGAAGGTCTTTAAGAGG - Intergenic
1076017311 10:127038417-127038439 GGGGAAAGAGAGGCTTAAAGAGG - Intronic
1077126756 11:942877-942899 GAGGGGAGAAGGGCTTGAGGTGG + Intronic
1077338229 11:2014821-2014843 GGGCAGAGAAGGGCTGGAAGAGG - Intergenic
1077410655 11:2402450-2402472 GGTGAGAGGAGGGCTTGGAGGGG + Exonic
1078368835 11:10728567-10728589 GGGGACAGAAGGGATGTGAGAGG - Intergenic
1079076595 11:17388724-17388746 GCGGGGAGAAGGGCTCTTAGCGG - Intronic
1079099967 11:17534982-17535004 GTGGAGAGATGAGCTTTCAGAGG - Intronic
1080008288 11:27432248-27432270 GGGGAGAGAAGGTGTTCAAGTGG - Intronic
1080552270 11:33382854-33382876 GGGGACTGAAGGGCTCTGAGGGG + Intergenic
1083061314 11:59875535-59875557 GGGGGGAGAATGGCTTGGAGAGG - Intergenic
1083212337 11:61195883-61195905 AGGGAGAGCAGGGCTGTGAGGGG + Intergenic
1083269231 11:61562934-61562956 GGAGAGGGAATGGCTTTCAGAGG + Intronic
1083428073 11:62599476-62599498 TGGGTGAGAAGGGGTTAAAGAGG - Intronic
1084094915 11:66904782-66904804 GGGAAGGGAACGGCATTAAGAGG + Intronic
1085229800 11:74956399-74956421 TGGGAGAGAAGCACTTTGAGGGG - Intronic
1085521598 11:77142421-77142443 GGGGAGAGCTGGGCTTTGAGAGG + Intronic
1085707576 11:78800470-78800492 TGGGAGGGAAGGGGTTTATGAGG + Intronic
1086200751 11:84198717-84198739 GGGGAGACAAGGACTTAGAGAGG + Intronic
1087132064 11:94677195-94677217 GGGGACAGCAGGCCTTTAAGAGG + Intergenic
1089936651 11:122371096-122371118 AGGGTGAGAAGGCATTTAAGGGG + Intergenic
1090235237 11:125142056-125142078 GGGGAGGGAAGGGCTCTGTGGGG + Intergenic
1090238796 11:125167206-125167228 GGGGGGAGGAGGGCATTGAGGGG + Intronic
1090420685 11:126573039-126573061 GGGGAGTGCAGGGTTTTTAGGGG + Intronic
1091233737 11:134005327-134005349 GGGGAGAGAGGGTCTCTAAGAGG - Intergenic
1202821213 11_KI270721v1_random:70003-70025 GGGCAGAGAAGGGCTGGAAGAGG - Intergenic
1091725184 12:2841382-2841404 GGGCAGAGAAGGGCTTAAAAAGG + Intronic
1092107919 12:5936466-5936488 GGGGGGAGAAGGGCAAAAAGAGG - Intronic
1092611410 12:10177140-10177162 AAGGAGAGCAGGGCTTTAGGTGG - Intronic
1093411140 12:18868521-18868543 GGGGAGGGAAGGGATTTACAGGG + Intergenic
1093480837 12:19602289-19602311 TAGGAGAGGAGGGCTTTGAGAGG + Intronic
1093540659 12:20280353-20280375 TTGGAGATAAGGTCTTTAAGAGG - Intergenic
1095990999 12:48034560-48034582 GGTGAGAGAAGAGCTTGAGGAGG - Intergenic
1096517924 12:52168154-52168176 GGGAAGAGAAGGGCTTGTGGAGG - Intergenic
1096778682 12:53979378-53979400 GGGGAGAGAGGGGCTCTGAGGGG + Intergenic
1098055106 12:66496819-66496841 AGGGAAAGAAGGGCAATAAGGGG + Intronic
1098162535 12:67659093-67659115 GGGAAAAGGAGGGCCTTAAGGGG - Exonic
1099151041 12:79114225-79114247 TGGGAGAGCACGGCTTTATGGGG + Intronic
1100591843 12:96036789-96036811 GGGAAGAAAAGGGGTTTAATTGG + Intronic
1100612369 12:96202118-96202140 GGGGAGAGAAGGGATCAGAGCGG - Intronic
1100854910 12:98750017-98750039 GGTGAGAGAAGAGCTTTGAGGGG + Intronic
1101509678 12:105381407-105381429 GGGCAGAGAAGGGCTTACTGGGG - Intronic
1101822089 12:108191958-108191980 GGTGCGAAAGGGGCTTTAAGAGG - Intronic
1102596599 12:113997518-113997540 GGTGAGAGAAGGGGTTTCAGAGG + Intergenic
1104262532 12:127197597-127197619 GGAGAGAGGAGGGCATTTAGTGG - Intergenic
1104450364 12:128864020-128864042 GGGGAGAGAAGAGCACTAGGGGG + Intronic
1106924758 13:34602049-34602071 GGGGAGAGAATGGCATGAAATGG - Intergenic
1107300463 13:38960804-38960826 GGGGAGGGGGGGACTTTAAGAGG - Intergenic
1108146236 13:47480264-47480286 GGAGAAAGAAGGGCTCTAAGAGG - Intergenic
1108290461 13:48955078-48955100 GGAGAGAAAAAGGCTTTATGAGG - Intergenic
1108300509 13:49069710-49069732 GGTGAGAGAAGTGCTATAATAGG - Intronic
1108442449 13:50469002-50469024 GGGGAGGAAAGGGCTTGCAGAGG + Intronic
1109640768 13:65188892-65188914 AGGGAGAGAAGGGATTTCTGAGG + Intergenic
1112962628 13:105145464-105145486 GGAGAGTAAAGGGCTTTAAGGGG + Intergenic
1112962634 13:105145488-105145510 GGAGAGAAAAGGGCTTTAAGGGG + Intergenic
1114290088 14:21280769-21280791 GGGGAGAGAACAGTGTTAAGAGG - Intergenic
1114424558 14:22611291-22611313 GGGCAAAGAAGGGCTTCCAGTGG + Exonic
1114535491 14:23419652-23419674 GGGGAATGAAGGGGTGTAAGAGG + Intronic
1115393465 14:32879553-32879575 TGTTAGAGAAGGGCTTTAAAAGG - Intergenic
1116186352 14:41605560-41605582 GAGGAGTGAAGTGCTTTAGGTGG - Intergenic
1118601220 14:67472578-67472600 GTGGAGGGAAGGGCTGCAAGGGG + Exonic
1119509228 14:75198080-75198102 GAGGAGAAAAGGGCTGGAAGAGG + Intergenic
1119856981 14:77908270-77908292 GGAGAGAGAAGGGCAGGAAGAGG - Intronic
1120212001 14:81642536-81642558 GGGGAGAGAAGGGCTAAAACAGG - Intergenic
1122027125 14:98886177-98886199 GGGCAGAGCAGGGCTCTATGCGG - Intergenic
1202872950 14_GL000225v1_random:180815-180837 GGAGAGAGAAGTGCATTTAGTGG - Intergenic
1124654693 15:31498887-31498909 GGAGAGGGAAGGGCTTGAGGTGG - Intronic
1127886583 15:63206834-63206856 GGGCAGAGCAGGACTTTGAGGGG - Intronic
1129452281 15:75657819-75657841 TGGGGGAGAAGGACTTTCAGGGG + Exonic
1129605388 15:77022578-77022600 GGGCAGAGAATGACTTTATGTGG + Intronic
1130046468 15:80449481-80449503 GGGGAGAGAATTACTTTAAGAGG + Intronic
1130148543 15:81293742-81293764 GTGGAAAGGAGGGCTTTAAGGGG - Intronic
1130322622 15:82853532-82853554 GGGGAGAAAAGGGGGTCAAGGGG + Intronic
1130881505 15:88059789-88059811 TTGGAGAAAAGGTCTTTAAGGGG + Intronic
1131643515 15:94317422-94317444 GCAGAGAGAAAAGCTTTAAGTGG - Intronic
1133725225 16:8530928-8530950 GGCAAGAGAATGGCTTGAAGTGG + Intergenic
1134117567 16:11560729-11560751 TGAGACAGAAGGTCTTTAAGAGG + Intronic
1134320103 16:13155095-13155117 GGGGACAGAATGGCTTGAAATGG + Intronic
1136036759 16:27546357-27546379 GGGGAAAGAAGGGACTTAATTGG - Intronic
1136054582 16:27678907-27678929 GGAGAGAGAAGGACTTGATGGGG + Intronic
1136061612 16:27730546-27730568 GAGGAGAGAAGAGTTTTATGGGG - Intronic
1136476783 16:30518515-30518537 GGGCAGAGAAGGGGTTCCAGGGG - Intronic
1136478928 16:30529514-30529536 TCGGATGGAAGGGCTTTAAGAGG - Intronic
1138074444 16:54026954-54026976 GGGGATAAAAGTGCTTTAAATGG - Intronic
1138119882 16:54391495-54391517 GGGAAAAGAAGGGGTTTTAGTGG + Intergenic
1138819618 16:60243411-60243433 TGGGAAATAAGGGCTTTAAAGGG - Intergenic
1139318283 16:66092061-66092083 GGGGAGGAAGGGGCTTTATGTGG + Intergenic
1139512317 16:67434494-67434516 AGGTAGAGAAGGGCTTCAAGAGG + Intronic
1141289914 16:82708297-82708319 GAGGAGAGAATGGGTTTTAGTGG + Intronic
1141560699 16:84866049-84866071 GAGGAGAGAAGGGATGGAAGTGG + Intronic
1142497125 17:311924-311946 TTGGAGAGAAGGTCTTTAGGAGG + Intronic
1142870411 17:2816131-2816153 GGGGAGGGAAGAGCTGGAAGAGG + Intronic
1142905925 17:3041814-3041836 TGGGTGAGAAGGGCTTTGCGTGG - Intergenic
1143165808 17:4896829-4896851 CGGGACAGCAGGGCTTTCAGAGG - Intronic
1143382241 17:6503705-6503727 GGGCAGAGCAGGGCATGAAGTGG - Intronic
1143508563 17:7383161-7383183 GGGAAGAAAAGGGCTGGAAGAGG - Intronic
1143626668 17:8114282-8114304 GGGGAGACAAGGGCAGGAAGGGG + Intronic
1143714393 17:8756567-8756589 GAGGAGAGAAGGACTTTCACTGG + Intronic
1144247929 17:13385863-13385885 GAGGAGAGCAGGTCTTTGAGAGG + Intergenic
1145258734 17:21342282-21342304 CGGGAGAGCGGGGCTGTAAGAGG + Intergenic
1145317896 17:21745722-21745744 CGGGAGAGCAGGGCTGCAAGAGG - Intergenic
1145768371 17:27475075-27475097 GGGTAGAGAAGGGCTCCATGGGG + Intronic
1145936263 17:28716757-28716779 GGGGATACAGGGGCTTAAAGAGG + Intronic
1145952222 17:28827800-28827822 GGGTAATGAAGGGCTTTAAAGGG + Intronic
1146615658 17:34355592-34355614 GGGGAGGGAATGGCTTAAAATGG - Intergenic
1147881994 17:43660238-43660260 GGGAAGAGAAGGGCTTTAGCTGG + Intronic
1147884574 17:43676054-43676076 GGGGAGAGAAATGCTCTGAGGGG + Intergenic
1148079970 17:44962337-44962359 GGCTGGAGAAGGGCTTTAAAGGG - Intronic
1148139451 17:45317682-45317704 GGGGAGCCAAGGGCTTACAGGGG + Intergenic
1148644781 17:49213470-49213492 GGGGAGAGAGGGGCTGCAGGTGG - Intronic
1148902398 17:50888233-50888255 GGCGAGAGGAGGGCTGTAAGTGG + Intergenic
1149516278 17:57283376-57283398 GGGGAGAAAAAGTCTTTAATGGG - Intronic
1149814955 17:59714399-59714421 AGTGAGACAAGGCCTTTAAGAGG - Intronic
1150759394 17:67947081-67947103 GGAAAGAGAAGGGTTTTAAGAGG - Intronic
1151453622 17:74213808-74213830 GGGGAGAGAAGGGGTCTGAGAGG - Intronic
1151489857 17:74426513-74426535 GAGGAGCCAAGGGCTTTAAAGGG + Intronic
1152259238 17:79257994-79258016 GGGGAGAGAAGGGGATAAAGGGG - Intronic
1152322744 17:79617334-79617356 GGGGAGAGAAGAGCATCTAGGGG - Intergenic
1152426578 17:80221410-80221432 GGGGGGCGAACGGCTCTAAGAGG - Intronic
1152601015 17:81262206-81262228 GGGGTCACAAGGGCTGTAAGAGG - Intronic
1152662571 17:81549610-81549632 CAGGAGAGAAGGGCTTTGAAGGG - Intronic
1153016667 18:588723-588745 GGAGAGAGAAAGGCTTTGAAGGG - Intergenic
1154021328 18:10666328-10666350 GGGGAGAGAAAGGCTTGCGGAGG - Intergenic
1156013571 18:32522381-32522403 GTGGAGATAAGGCCTTTAAGGGG - Intergenic
1156281363 18:35642488-35642510 GGGAAGAGATGGGATTTGAGAGG + Intronic
1156438012 18:37154527-37154549 GGGGAGAAAGTGACTTTAAGTGG - Intronic
1160699017 19:497396-497418 GGAGAGAGGAGGGAGTTAAGAGG + Intronic
1160960439 19:1718496-1718518 GGGGAGGGGAGGCCTATAAGAGG + Intergenic
1161347431 19:3775276-3775298 AGGGTGTGCAGGGCTTTAAGGGG + Intergenic
1161492192 19:4568103-4568125 GAGGAGAGGAGGGCATAAAGTGG - Intergenic
1161527166 19:4763488-4763510 GGGCAGAGAAGGGCTCTGAAGGG - Intergenic
1165390331 19:35534919-35534941 GGGTGGAGAAGGGCTGGAAGGGG - Intronic
1166260938 19:41640455-41640477 GGGGAGGGCAGGGCTCTGAGAGG - Intronic
1166300284 19:41908865-41908887 AGGGAGACAGGGGCTTTCAGGGG - Intronic
1166410658 19:42553883-42553905 GGGGAGAGAGGGGATGTCAGGGG + Intronic
1166822591 19:45589669-45589691 GGGCAGAGAAGGGCTTGCTGAGG - Intronic
1167356999 19:49010429-49010451 GGGCAGGGAAGGGCATGAAGGGG - Intronic
925836814 2:7954144-7954166 GGGTAGAGAAGGGAATCAAGAGG + Intergenic
926867497 2:17375874-17375896 GGGGAGGGGAGGGCTTTTAGAGG - Intergenic
927617996 2:24619985-24620007 GGGGAGAGAAGGTCAGGAAGAGG - Intronic
928066090 2:28165943-28165965 TTGGAGATAAGGCCTTTAAGAGG + Intronic
928087867 2:28356892-28356914 TGGGAGAGAGTGGCTTCAAGTGG + Intergenic
928975992 2:37087098-37087120 GGGGAAAGAAGGTCTTTTATGGG - Intronic
930514089 2:52383578-52383600 AGGGAGAGGAGGGCTTGTAGGGG + Intergenic
930993017 2:57683350-57683372 GGGGAGGGAAGAGATTAAAGAGG - Intergenic
931434988 2:62238333-62238355 GGGGAGAGGAGGACATTAAAAGG - Intergenic
933642828 2:84782554-84782576 AGGAAGTGAAGGGCTTTTAGGGG - Intronic
935350777 2:102150246-102150268 GGGGAGAGAGGGGCTGTCACAGG - Intronic
936828310 2:116608531-116608553 GAGGAGAGGAGGGCTATAGGAGG + Intergenic
937237059 2:120437369-120437391 GAGGAGAGAGGGCCTTAAAGGGG + Intergenic
937308878 2:120889138-120889160 GGGCAGAAAAGGGCTAAAAGAGG - Intronic
937482797 2:122280145-122280167 GGGGAGAGATGGGGTAGAAGGGG - Intergenic
939794499 2:146625372-146625394 GAGTAGAGTAGTGCTTTAAGAGG - Intergenic
942104472 2:172619169-172619191 GGGGAGAGCAGGGCCTTGTGAGG + Intergenic
942991285 2:182206551-182206573 GGGGAGAGAAAGGGATGAAGAGG - Intronic
943762637 2:191626599-191626621 GGGTAGAGAAGGGATTCAATTGG - Intergenic
946710325 2:222498797-222498819 GGTCAGAGAAGGCCTTTCAGAGG + Intronic
946950333 2:224867420-224867442 GGGGAGAGAAAGCCATGAAGAGG - Intronic
947876468 2:233471043-233471065 GGGGACAGAGGGGCTGTGAGTGG - Exonic
1170166552 20:13365674-13365696 GGGGAGAGGTGGGTTTGAAGAGG + Intergenic
1171390441 20:24798384-24798406 GGGTAGTGATGGTCTTTAAGAGG - Intergenic
1172048486 20:32098668-32098690 GGGGACAGAAGGACTTCAGGGGG - Intronic
1172276784 20:33684433-33684455 AGGGCAAGAAGGGCTTTTAGGGG - Intronic
1172440175 20:34959940-34959962 GGGGAAAGGAAGGCTTGAAGAGG + Intergenic
1174252736 20:49231572-49231594 GGGGAGAGAAATGCTGTAAGGGG + Intronic
1178425294 21:32474252-32474274 GCAGAGTGGAGGGCTTTAAGCGG - Intronic
1179116120 21:38494149-38494171 GGTGAGAGAAGCGCTATCAGGGG + Intronic
1180068380 21:45424099-45424121 GGGGAGGGTAGGGCTTAAGGAGG + Intronic
1180073337 21:45449553-45449575 GGGGAGAGAATGGGCTTATGGGG + Intronic
1180285149 22:10738701-10738723 GGAGAGAGAAGTGCATTTAGTGG + Intergenic
1181092918 22:20486514-20486536 GTAGAGAGAAGGGCATTTAGGGG - Intronic
1182110885 22:27722499-27722521 CTGGAGACAAGGTCTTTAAGAGG + Intergenic
1182424441 22:30264671-30264693 GGGGAATGAAGAGCTTCAAGAGG + Intronic
1182661673 22:31929474-31929496 GGGGAGGGAAGGGACTGAAGGGG + Intergenic
1183387678 22:37524482-37524504 GGGGAGAGAAGGGGTTGGGGAGG + Intergenic
1183579301 22:38714092-38714114 TGGGAGGGAAGTGCTTCAAGAGG + Intronic
1183703172 22:39461301-39461323 TAGGTGAGAAGGGCTTTCAGGGG + Intronic
1184037560 22:41925989-41926011 GGGGAGAGAAGGGCTTTAAGGGG - Intronic
949733287 3:7140309-7140331 GGGGAGAGAAAGGCTTAACCAGG + Intronic
950185012 3:10939526-10939548 GGACAGAGAAGGGCCTTAGGAGG - Exonic
950660713 3:14465257-14465279 GAGGAGAGAAGGTCTTTGGGAGG + Intronic
950753507 3:15151866-15151888 AGGGAGAGAAGGGTTTTGATGGG - Intergenic
952660982 3:35846452-35846474 TGGGAGACAAGGTCTTAAAGAGG - Intergenic
952946029 3:38478349-38478371 GGGGAGAGCAAGGCTTAAAAAGG - Intronic
953874278 3:46656900-46656922 GGTGAGAGAAGGGTTGAAAGAGG - Intergenic
953901810 3:46847757-46847779 GGGGAGAGAAGGGACTGTAGGGG + Intergenic
955818320 3:62871312-62871334 GGAGAGGGATGGGCTTTTAGTGG - Intronic
955822372 3:62909717-62909739 GGAGAGAGAAGGGTTTAGAGAGG + Intergenic
956161443 3:66357582-66357604 GGGAGGAGAGGGGCATTAAGGGG - Intronic
956386837 3:68728642-68728664 CTGGGGAGAAGGGCTTAAAGAGG + Intergenic
957854987 3:85863331-85863353 TGGGAGATAAGGCCTTTAAGAGG + Intronic
957854993 3:85863375-85863397 TGGGAGATGAGGCCTTTAAGAGG + Intronic
957854999 3:85863419-85863441 TGGGAGATGAGGCCTTTAAGAGG + Intronic
959293212 3:104501065-104501087 GAGGAGAGAAGGGAGTAAAGAGG - Intergenic
959991527 3:112637354-112637376 TGGGAGAGGTAGGCTTTAAGGGG + Intronic
960973211 3:123153967-123153989 GGGCACAGAAGGGCTCTGAGGGG - Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965475221 3:169147803-169147825 GGGTAGAGAAGTGCTTTCAGGGG + Intronic
966207904 3:177423572-177423594 GGAGAGAGGCGGGCTTTAAGGGG + Intergenic
966433479 3:179857252-179857274 GGGGTGAGATGGGCATGAAGAGG + Intronic
967204757 3:187109357-187109379 GGTGAGAGAAGTTCTCTAAGTGG - Intergenic
967729472 3:192894083-192894105 GGGGAGAGAAGAGCTTGAACAGG - Intronic
967951944 3:194847996-194848018 GTGGAGTGAAGGGCTTTAAAAGG - Intergenic
968575722 4:1365180-1365202 GGGAAGAGAAAGGCTTTACCAGG + Intronic
969324423 4:6432696-6432718 GGATAGAGAAGGGCTATAAATGG + Intronic
970557428 4:17248762-17248784 TGGGAGAGAGGGCCTTCAAGTGG - Intergenic
972234644 4:37116870-37116892 AGGGAGGGAAGGGTTTCAAGAGG + Intergenic
975632096 4:76414424-76414446 GGGGAAAGAAAGGCATTAAGGGG + Intronic
976455791 4:85245910-85245932 GTGGAGAGAAGGAGTTTAACAGG - Intergenic
976697001 4:87927404-87927426 GGGGAGAGATTGGCTTGGAGAGG - Intergenic
979151185 4:117316626-117316648 AGGAAGACAAGGGCTTTTAGGGG + Intergenic
982154081 4:152498056-152498078 GGGGAGGGAAGAACTTTAAAAGG + Intronic
982215992 4:153082931-153082953 GGGGAGAGAAGGGGGTGAAGGGG + Intergenic
982710068 4:158749081-158749103 GGGGGAAGAAGAGCTTGAAGAGG + Intergenic
984636736 4:182119104-182119126 TGGGAGAGAATGGCTGGAAGGGG + Intergenic
984648638 4:182245735-182245757 GGAGAGAGAAAGGGATTAAGAGG + Intronic
984822920 4:183898721-183898743 AGGGAGGGAAGAGTTTTAAGGGG + Intronic
985143108 4:186863365-186863387 AGGAAGAGAAGGGCTACAAGAGG - Intergenic
985893779 5:2737498-2737520 TGGAAGAGATGGGCTTTCAGGGG + Intergenic
985923617 5:2998872-2998894 GGGGAGAGGAGGCCTTCATGAGG + Intergenic
985966741 5:3343574-3343596 GGGGAGAGAAAGGCTGTCGGTGG - Intergenic
987011452 5:13770321-13770343 GGGAAGAGAAGGGCAAGAAGAGG + Intronic
990829187 5:59937686-59937708 GAGGAGAGAGGGCCTTTAGGAGG - Intronic
992207082 5:74441508-74441530 GGGGAAAGGAGGGATATAAGAGG - Intergenic
995124237 5:108564230-108564252 AGGTAGAGATGGGATTTAAGAGG - Intergenic
996019743 5:118578069-118578091 GCTGAGAGAGGGGCTTTAGGAGG - Intergenic
996628007 5:125593519-125593541 GGGGAGAAAAGAGCTTGAAATGG + Intergenic
997394523 5:133547527-133547549 TGGGAGATGGGGGCTTTAAGAGG + Intronic
997619925 5:135280859-135280881 GGGGAGAGAGGAGATTTATGAGG + Intronic
998554758 5:143112381-143112403 GGGTAGAGGAGGGCCTTGAGAGG + Intronic
998892544 5:146761953-146761975 TGGCAGAGAAGGGCTGTAGGAGG + Intronic
1000107282 5:158072102-158072124 GGGGTGTGAAGGGGTTGAAGGGG + Intergenic
1000165867 5:158648169-158648191 GAGGAAAGATGGGATTTAAGTGG - Intergenic
1000209766 5:159098338-159098360 AGTGAGAGAAGGGCTGGAAGGGG + Intronic
1001937839 5:175718429-175718451 GGGGAGAAAAGGGCTTTTCTGGG - Intergenic
1003933717 6:10954222-10954244 GGGGAGAGAGTGGTTTTAAGTGG + Intronic
1004060010 6:12185430-12185452 TGGCAGAGAAGGGCTATAAGAGG + Intergenic
1004479315 6:16003747-16003769 GGGGAGAGAAGCTCTTGAAGGGG + Intergenic
1005202029 6:23358201-23358223 GGAGGGAGATGGGCTTGAAGTGG + Intergenic
1005728711 6:28674644-28674666 GGGCAGAGAAGCGCTTTCAAAGG - Intergenic
1006807775 6:36799635-36799657 GGGGAGAAAAGGGCTCCCAGAGG + Intronic
1007756301 6:44101897-44101919 GGAGAGAGATGGGCTGTAACTGG - Intergenic
1008833059 6:55792437-55792459 GGCGAGAGAATGGCTTGAATCGG + Intronic
1009405751 6:63310279-63310301 GGGGACAGAAGGGCTACAAAAGG + Intronic
1009552440 6:65116435-65116457 GGGGATACAAGTGCTATAAGTGG + Intronic
1010833262 6:80556335-80556357 GGACAGATAAGGGCTTGAAGGGG + Intergenic
1011663999 6:89617679-89617701 GGGGCAAGAAGTGCTTTAGGAGG - Intronic
1012884273 6:104826827-104826849 GGGGAGAGAAGGGGTGGAATTGG - Intronic
1013836817 6:114343243-114343265 GGGGAGGGCAGGGCCTTAGGCGG + Intergenic
1015146460 6:129993066-129993088 GGAGAGAGAATGGCATAAAGTGG + Intergenic
1015533254 6:134242033-134242055 AGGGAGAGAAGGGATTAATGTGG + Intronic
1016101908 6:140113477-140113499 TGGGAGACAAGGCCTTTAAAAGG - Intergenic
1017801389 6:157899253-157899275 GGGGAGAGAAGGGCAACGAGGGG - Intronic
1019271544 7:151881-151903 GGGAACAGAAAGGCTTTCAGCGG + Intergenic
1020000483 7:4752898-4752920 GGGGAGAGAAAGGTTTTGACTGG - Intronic
1021890594 7:25182317-25182339 GGGGAGACAAGGAATTTAATGGG - Intergenic
1022551351 7:31242472-31242494 GGGGAGAGTAAGGATTTGAGTGG + Intergenic
1022624655 7:32022518-32022540 GGGGAATGAAGTGGTTTAAGGGG + Intronic
1024120301 7:46230025-46230047 GTGGAGAGAAGGACTTTATGTGG - Intergenic
1024300560 7:47884400-47884422 GGTGAGAGAAGGGCAGAAAGAGG + Intronic
1026500120 7:70936834-70936856 GGGAAGATAAGGGCTTTTATTGG + Intergenic
1026903805 7:74051337-74051359 CGGGAGAGCAGGGCTGTGAGGGG + Intronic
1029642273 7:101828809-101828831 TGGGAGAGGAGGGCTTAGAGAGG + Intronic
1029709280 7:102290736-102290758 GAGGGGAGAAGGGTTTTAACAGG + Intronic
1030068823 7:105680934-105680956 AGGGAGAGCAGGGCTGCAAGAGG - Intronic
1030464138 7:109878348-109878370 GGAGAGAGAAGGGGTTGAGGGGG - Intergenic
1030889706 7:114984213-114984235 GTGGTAAGAAGGGCTTTAAGAGG - Intronic
1031500933 7:122515302-122515324 GTGGAGCAAAGGGTTTTAAGGGG - Intronic
1031750371 7:125563927-125563949 GGAGACAGAAGAGGTTTAAGTGG - Intergenic
1032296786 7:130646091-130646113 GGCAAGAGCAGAGCTTTAAGTGG - Intronic
1034154010 7:148939360-148939382 GGGGAGAGAAAGGCTATTATGGG + Intergenic
1035259768 7:157653899-157653921 GGGGAGAGACGGGCGTCATGTGG - Intronic
1035940295 8:3892578-3892600 GGGGAGAGAACAGATTTAACTGG - Intronic
1036208645 8:6824312-6824334 AGGGAGAGAAGGGGGTGAAGGGG + Intronic
1037391634 8:18398968-18398990 GATGAGAGAAGGGTTATAAGCGG - Intronic
1037608229 8:20455301-20455323 GGAGAGGGAAGAGCCTTAAGGGG + Intergenic
1037675251 8:21045414-21045436 GGGGAGAGAAAGGCTGTTTGGGG + Intergenic
1037955153 8:23050477-23050499 GGGGCGTGAAGGCCTTTAAAAGG + Intronic
1038217473 8:25575698-25575720 TTGGAGATAAGGTCTTTAAGGGG - Intergenic
1038265404 8:26035849-26035871 AGAGAGACAAGGGCTTTAGGAGG - Intronic
1039085253 8:33773478-33773500 GGGGAAAGATGAGATTTAAGGGG + Intergenic
1041698531 8:60762863-60762885 GGGGAGACAATGGCATTCAGAGG + Intronic
1043166758 8:76912016-76912038 GGCGTGGGAAGGGCTTTAACTGG - Intergenic
1043803178 8:84637595-84637617 CTGGAGAGAGGGGCTTTAAAGGG + Intronic
1044424368 8:92034064-92034086 GGGAAGAGAAGGGGTTAAAGAGG + Intronic
1044820225 8:96151025-96151047 GGAGTGTGAAGGGCTTTAAGGGG + Intronic
1044888776 8:96809588-96809610 GGGGAGAGATTGGCTGTAAGAGG + Intronic
1045764583 8:105651604-105651626 GGGTAAAGAAGGCCTTTTAGAGG - Intronic
1046165184 8:110424468-110424490 GGCAAGAGAATGGCTTGAAGTGG + Intergenic
1046379913 8:113437115-113437137 GAGCAGAGGTGGGCTTTAAGAGG - Intergenic
1049184209 8:141240884-141240906 GGGGAGAGGAGGGCTTTGTCTGG - Intronic
1049392523 8:142379607-142379629 AGGCAGAGAAGGGCTTTCAAGGG - Intronic
1049478812 8:142810377-142810399 AGGGAGGGAAGGGCTTTCAGAGG - Intergenic
1049853812 8:144849263-144849285 GGAGAGAGAAGGGCTTTACCTGG + Intronic
1056771196 9:89479462-89479484 GGGGATACAGGGGCTTTGAGGGG - Intronic
1056822742 9:89854906-89854928 GTGGAGGGAAGGGCTGTAAGAGG + Intergenic
1058136650 9:101315305-101315327 GGGAAGAGAAGGGTTTCAAAGGG + Intronic
1058231480 9:102431786-102431808 GAGAAGAGGAGGACTTTAAGAGG + Intergenic
1058753582 9:108063542-108063564 GGGGAGAGAAGGGCAGAAATGGG + Intergenic
1060329513 9:122653745-122653767 AAGGAGAGAGGGGTTTTAAGTGG + Intergenic
1060528151 9:124332093-124332115 GGAGAGGGAAGGGCCTTAAGGGG + Intronic
1061040222 9:128137378-128137400 GTAGAGGGAAGGGCTGTAAGAGG - Intergenic
1062190623 9:135246093-135246115 GGGGAGAGAGGGGCTTTCTCAGG + Intergenic
1203731509 Un_GL000216v2:95730-95752 GGAGAGAGAAGTGCATTTAGTGG + Intergenic
1185509533 X:652670-652692 GGCCAGAGAAGGGGTTTCAGAGG + Intronic
1186009397 X:5112431-5112453 GTGGAGATAAGGGATTTGAGTGG - Intergenic
1186588740 X:10905128-10905150 GGGGAGAGAAGAACATTTAGTGG + Intergenic
1187734824 X:22292862-22292884 GGAGAGAGAAGGGCTTGATTGGG - Intergenic
1189327261 X:40120415-40120437 GGGGAGTGAAGGGATTGGAGAGG - Intronic
1189602912 X:42647057-42647079 AGGGAGAGAAGGGATTGAATGGG - Intergenic
1189853438 X:45199571-45199593 GGGAAGTGAAGGGCTTAAGGTGG - Intronic
1190024681 X:46912567-46912589 GGGGCGAGGAGGGGATTAAGGGG + Exonic
1190688564 X:52895317-52895339 AGGGAGAGGTGGGCTTCAAGAGG - Intronic
1190697419 X:52960475-52960497 AGGGAGAGGTGGGCTTCAAGAGG + Intronic
1192578541 X:72261930-72261952 GGGGAGAGAAGGACTTTCCAGGG - Intronic
1193920796 X:87423707-87423729 GGGGAGAAAAGGGCTTCTATGGG - Intergenic
1197119516 X:122873761-122873783 GCAGAGGGAAGGCCTTTAAGAGG - Intergenic
1199471092 X:148197503-148197525 GAGGAAACAAGGGCTTTGAGAGG - Intergenic
1201109716 Y:10790388-10790410 GGGGAGAGAAGGGATTGGAAGGG - Intergenic