ID: 1184037797

View in Genome Browser
Species Human (GRCh38)
Location 22:41926692-41926714
Sequence GCAGGTCGAAGCACTCGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184037786_1184037797 21 Left 1184037786 22:41926648-41926670 CCGCGGCGTGCGCAGGAGCCCGC 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1184037797 22:41926692-41926714 GCAGGTCGAAGCACTCGGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 62
1184037790_1184037797 3 Left 1184037790 22:41926666-41926688 CCCGCAGGCCACGCAGTGGCGGA 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1184037797 22:41926692-41926714 GCAGGTCGAAGCACTCGGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 62
1184037791_1184037797 2 Left 1184037791 22:41926667-41926689 CCGCAGGCCACGCAGTGGCGGAC 0: 1
1: 0
2: 3
3: 9
4: 93
Right 1184037797 22:41926692-41926714 GCAGGTCGAAGCACTCGGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 62
1184037792_1184037797 -5 Left 1184037792 22:41926674-41926696 CCACGCAGTGGCGGACCAGCAGG 0: 1
1: 0
2: 1
3: 6
4: 119
Right 1184037797 22:41926692-41926714 GCAGGTCGAAGCACTCGGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184037797 Original CRISPR GCAGGTCGAAGCACTCGGCC GGG Exonic