ID: 1184038079

View in Genome Browser
Species Human (GRCh38)
Location 22:41927967-41927989
Sequence TCCCTAGACCTCAGTCCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184038079_1184038091 19 Left 1184038079 22:41927967-41927989 CCAGATGGACTGAGGTCTAGGGA No data
Right 1184038091 22:41928009-41928031 AAAGGGGAGCAAAGGCTTGGAGG No data
1184038079_1184038087 3 Left 1184038079 22:41927967-41927989 CCAGATGGACTGAGGTCTAGGGA No data
Right 1184038087 22:41927993-41928015 GATGGGGGTGAAGGCCAAAGGGG No data
1184038079_1184038086 2 Left 1184038079 22:41927967-41927989 CCAGATGGACTGAGGTCTAGGGA No data
Right 1184038086 22:41927992-41928014 AGATGGGGGTGAAGGCCAAAGGG No data
1184038079_1184038084 -6 Left 1184038079 22:41927967-41927989 CCAGATGGACTGAGGTCTAGGGA No data
Right 1184038084 22:41927984-41928006 TAGGGAGCAGATGGGGGTGAAGG No data
1184038079_1184038089 16 Left 1184038079 22:41927967-41927989 CCAGATGGACTGAGGTCTAGGGA No data
Right 1184038089 22:41928006-41928028 GCCAAAGGGGAGCAAAGGCTTGG No data
1184038079_1184038092 29 Left 1184038079 22:41927967-41927989 CCAGATGGACTGAGGTCTAGGGA No data
Right 1184038092 22:41928019-41928041 AAAGGCTTGGAGGCCCAAACAGG No data
1184038079_1184038088 11 Left 1184038079 22:41927967-41927989 CCAGATGGACTGAGGTCTAGGGA No data
Right 1184038088 22:41928001-41928023 TGAAGGCCAAAGGGGAGCAAAGG No data
1184038079_1184038085 1 Left 1184038079 22:41927967-41927989 CCAGATGGACTGAGGTCTAGGGA No data
Right 1184038085 22:41927991-41928013 CAGATGGGGGTGAAGGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184038079 Original CRISPR TCCCTAGACCTCAGTCCATC TGG (reversed) Intergenic
No off target data available for this crispr