ID: 1184038086

View in Genome Browser
Species Human (GRCh38)
Location 22:41927992-41928014
Sequence AGATGGGGGTGAAGGCCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184038079_1184038086 2 Left 1184038079 22:41927967-41927989 CCAGATGGACTGAGGTCTAGGGA No data
Right 1184038086 22:41927992-41928014 AGATGGGGGTGAAGGCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184038086 Original CRISPR AGATGGGGGTGAAGGCCAAA GGG Intergenic
No off target data available for this crispr