ID: 1184039357

View in Genome Browser
Species Human (GRCh38)
Location 22:41933923-41933945
Sequence CACTGTCTGTAGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184039345_1184039357 5 Left 1184039345 22:41933895-41933917 CCCACCAGCCTGCCAGCCCGTAC No data
Right 1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG No data
1184039344_1184039357 10 Left 1184039344 22:41933890-41933912 CCTCGCCCACCAGCCTGCCAGCC No data
Right 1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG No data
1184039342_1184039357 21 Left 1184039342 22:41933879-41933901 CCCACGGCTCTCCTCGCCCACCA No data
Right 1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG No data
1184039343_1184039357 20 Left 1184039343 22:41933880-41933902 CCACGGCTCTCCTCGCCCACCAG No data
Right 1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG No data
1184039341_1184039357 22 Left 1184039341 22:41933878-41933900 CCCCACGGCTCTCCTCGCCCACC No data
Right 1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG No data
1184039347_1184039357 1 Left 1184039347 22:41933899-41933921 CCAGCCTGCCAGCCCGTACCGAG No data
Right 1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG No data
1184039349_1184039357 -7 Left 1184039349 22:41933907-41933929 CCAGCCCGTACCGAGCCACTGTC No data
Right 1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG No data
1184039348_1184039357 -3 Left 1184039348 22:41933903-41933925 CCTGCCAGCCCGTACCGAGCCAC No data
Right 1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG No data
1184039346_1184039357 4 Left 1184039346 22:41933896-41933918 CCACCAGCCTGCCAGCCCGTACC No data
Right 1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184039357 Original CRISPR CACTGTCTGTAGAGGGTGGA AGG Intergenic
No off target data available for this crispr