ID: 1184041068

View in Genome Browser
Species Human (GRCh38)
Location 22:41944141-41944163
Sequence TAGAGTAAACAAAAAGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 731
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 670}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184041068 Original CRISPR TAGAGTAAACAAAAAGAGGA CGG Intronic
901882315 1:12201466-12201488 TAGAGTAAAAAAAAAAAAAAAGG + Intronic
902079113 1:13809103-13809125 TGGAGTAAACAAGAACAGAAGGG + Intronic
902202820 1:14846378-14846400 AAGAGAGAACAAAAAAAGGAAGG + Intronic
902404775 1:16176612-16176634 TAGAGAAAACAGACACAGGAAGG - Intergenic
903679003 1:25084512-25084534 CATAGAAAACAAAAAGAAGAGGG + Intergenic
904865264 1:33573718-33573740 GAGAGAACACAAAAAGTGGATGG + Intronic
905173075 1:36120451-36120473 AAAAATAAATAAAAAGAGGACGG + Intronic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
906123299 1:43410022-43410044 TATAGTAACCAAAAACAGCATGG + Intronic
906778101 1:48548197-48548219 TGGAGTAAAGATAAAGAGTAGGG + Intronic
906778620 1:48552468-48552490 TAGAGTAAACAAAACAGGAATGG + Intronic
906925460 1:50110960-50110982 CAGTGTAAAAAAAAAGGGGAGGG + Intronic
906966453 1:50461889-50461911 AAAAGAAAAAAAAAAGAGGAAGG + Intronic
907644429 1:56227715-56227737 TATAGTAAATAAAGATAGGAAGG - Intergenic
907970657 1:59377740-59377762 TAGGGTTAACCAAATGAGGAAGG + Intronic
908204573 1:61832407-61832429 TAATGTAAACAAAAAAGGGAAGG - Intronic
908299622 1:62751183-62751205 TAGTGTAGAAAAAAAGAGCATGG - Intergenic
908393930 1:63707884-63707906 TAGAGAAACTTAAAAGAGGAAGG - Intergenic
908453643 1:64280876-64280898 GAGAGAAGACAAAAAGCGGATGG + Intergenic
908721286 1:67129003-67129025 AAGAGTAAAAAAAAAGCTGAAGG - Intronic
908825941 1:68132643-68132665 TAGCGTGAACAGAAATAGGAGGG + Intronic
909204023 1:72729742-72729764 TAAAGTAAACATAAATAGCATGG - Intergenic
909307574 1:74100669-74100691 TACAGTAACCAAAAACAGCATGG + Intronic
909381980 1:75009227-75009249 TACCATAAATAAAAAGAGGAGGG - Intergenic
909645766 1:77915150-77915172 TAGAGAAAAAAAAAAGAGCTGGG + Intronic
909782453 1:79563413-79563435 TATCTTAAGCAAAAAGAGGAAGG + Intergenic
909808578 1:79903426-79903448 GAGAGTGAACGAAAAGTGGACGG - Intergenic
911042460 1:93601743-93601765 TTGAATAAAGAAAAAGAAGAAGG + Intronic
911412656 1:97529652-97529674 AAGAGAAAAGAAAAAAAGGAAGG - Intronic
911720633 1:101187467-101187489 AAGAGTAAACAAAATGTGGAAGG + Intergenic
912045208 1:105445073-105445095 TACAGTAACCAAAAACAGCATGG - Intergenic
912166738 1:107050436-107050458 TACAGTAAACAAAAAAAGCATGG - Intergenic
912196056 1:107398283-107398305 TATAATAAAAAAAAATAGGATGG + Intronic
912754871 1:112316085-112316107 GAGAAGAGACAAAAAGAGGACGG + Intergenic
912891367 1:113535459-113535481 TTGAGTTAAAAAAAAGAGGAAGG - Intronic
913615986 1:120559513-120559535 TAGATTGCACACAAAGAGGAGGG + Intergenic
914574292 1:148951385-148951407 TAGATTGCACACAAAGAGGAGGG - Intronic
915679244 1:157564306-157564328 CACAGCACACAAAAAGAGGATGG - Intergenic
915755327 1:158254254-158254276 CAGAGTGATCAAAAAGAGCAGGG + Exonic
916212466 1:162369994-162370016 TAGAAGAATGAAAAAGAGGAAGG - Exonic
916987328 1:170205877-170205899 AAGAGACAACAAAAAGAAGAAGG - Intergenic
917583726 1:176403870-176403892 TACTGTAAACAAAAACAGCATGG - Intergenic
917606980 1:176641570-176641592 TACAGTAACCAAAAACAGCATGG - Intronic
917694704 1:177510216-177510238 TACAGTAACCAAAAACAGCATGG - Intergenic
917938016 1:179888197-179888219 TATAGAGAAGAAAAAGAGGAAGG + Intronic
918029517 1:180791013-180791035 AGGAGGAAACTAAAAGAGGAGGG + Intronic
918546210 1:185687452-185687474 GAGAGAAAAGAAAAGGAGGAAGG - Intergenic
918633023 1:186741699-186741721 AAGAGAGAACAAAAAGAGGGTGG + Intergenic
918724301 1:187897949-187897971 TAAAACAAACAAAAAGTGGATGG + Intergenic
918879053 1:190090374-190090396 TATCCTACACAAAAAGAGGATGG - Intergenic
918890797 1:190264813-190264835 TAGAGGAAACAAACAATGGAAGG + Intronic
919077283 1:192829158-192829180 TATAGTAACCAAAAACAGCATGG + Intergenic
919237750 1:194868216-194868238 CAGAGAAAAAAAAAAAAGGAAGG + Intergenic
919503742 1:198371541-198371563 TGTAATAAAAAAAAAGAGGAAGG + Intergenic
919676778 1:200391740-200391762 TTGGGGAAACAAAATGAGGAAGG + Intergenic
919708138 1:200698683-200698705 AAGAGAAAAAAAAAAGAAGATGG + Intergenic
920602412 1:207341634-207341656 TATAGTAACCAAAAACAGCATGG - Intronic
922412198 1:225387778-225387800 GACAGTAAACAAAAGGAGAAAGG + Intronic
922514905 1:226200068-226200090 AAGAGGAAATAAAAAGAGGAAGG - Intergenic
922924658 1:229338252-229338274 AAGATTAAATAAAAAGAGGGTGG + Intronic
922982742 1:229841624-229841646 AATAGAAAAAAAAAAGAGGATGG - Intergenic
922985399 1:229862406-229862428 TTGGTTAAAAAAAAAGAGGAGGG - Intergenic
923116852 1:230948482-230948504 AAGAAAAAAAAAAAAGAGGAAGG - Intronic
923643954 1:235796136-235796158 TAGAATACAAAAAAAGAGGAGGG + Intronic
923871754 1:238002821-238002843 TACAGTAACCAAAAACAGCATGG + Intergenic
924467890 1:244314595-244314617 TACAATAAAAAAATAGAGGATGG - Intergenic
924637619 1:245803703-245803725 TAGAGTTAACAAAAGCTGGAAGG + Intronic
1063027080 10:2190496-2190518 TAAAGAAAAAAAAAAGAAGAAGG + Intergenic
1063590143 10:7387632-7387654 AAGAGGAAACCAAAGGAGGATGG + Intronic
1064452331 10:15453730-15453752 TAGAGGAAACAAAAAGGGTGGGG + Intergenic
1064689964 10:17906388-17906410 AAGAGGAAAGACAAAGAGGAAGG - Intronic
1065163926 10:22954732-22954754 TAGAGAAAACAAATTGAGGAGGG - Intronic
1065348038 10:24767723-24767745 AAGAGAAAACAAAAGAAGGAAGG - Intergenic
1065372320 10:25000367-25000389 TAGAATAGACAAAATCAGGAAGG - Intronic
1065392993 10:25203634-25203656 TACAGTAACCAAAAACAGCATGG - Intronic
1065622493 10:27597553-27597575 TAGATAAAAGAAAAAGAGAAAGG - Intergenic
1066379896 10:34892328-34892350 TCGAGGAAACAGAATGAGGAGGG + Intergenic
1066420881 10:35263556-35263578 TAAAATAAAGAAAAAGGGGAGGG + Intronic
1067050680 10:43017492-43017514 TACAGTAACCAAAAACAGCATGG - Intergenic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067555959 10:47271763-47271785 TAGAATAAACAGGCAGAGGAAGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1067965682 10:50910180-50910202 TGGAGTCCACAGAAAGAGGATGG + Intergenic
1068233510 10:54202319-54202341 AAGAGAAAAAAAAAAGAGGGAGG + Intronic
1068626385 10:59253050-59253072 TTGAGGAAACAAAAACAGGAAGG + Intronic
1068802471 10:61157753-61157775 TGGAGGAAAAAAAAAGAAGAAGG + Intergenic
1069043194 10:63716111-63716133 TTGAGAAAACAAAAGCAGGAAGG + Intergenic
1070073516 10:73112792-73112814 TTAAGTAAACAAAAAAAGCAAGG - Intronic
1070400245 10:76046890-76046912 TAGAGGAAAGAAAAATATGATGG + Intronic
1070998763 10:80810835-80810857 AAGAGTAAGCAAGAAGAGAAGGG - Intergenic
1071007911 10:80904025-80904047 TACAGTAACCAAAAACAGCATGG - Intergenic
1071060125 10:81560372-81560394 TAAATTAAAAAAAAAGAGTAAGG - Intergenic
1071372140 10:84963009-84963031 TAGAAAAAACAAAAGGGGGAAGG - Intergenic
1071440925 10:85693545-85693567 TATAGTAAAAAAAAACAGCAGGG + Intronic
1071947951 10:90669157-90669179 TTGTGGAAACAAAAAGAGGAGGG + Intergenic
1072519525 10:96218784-96218806 TAGATAAGACAGAAAGAGGAGGG - Intronic
1072906066 10:99455089-99455111 TAGAGAAAACAAGAAAATGAAGG + Intergenic
1073502118 10:103949638-103949660 TATAGGAAGCAAAGAGAGGAGGG + Intergenic
1073698588 10:105898581-105898603 TAGATTGAACAAAAGGAGAATGG + Intergenic
1073782498 10:106854493-106854515 TAAAGGAAACAAAAAGAAAATGG - Intronic
1075432508 10:122400191-122400213 TAAAGACAACTAAAAGAGGATGG - Intronic
1075500326 10:122967242-122967264 AAGATTAAAAAAAAAGAGAAGGG + Intronic
1078295262 11:10061954-10061976 TACAGTAACCAAAAATAGCATGG + Intronic
1078526754 11:12107350-12107372 TAAAGAAAAGAAAAAGAGGCCGG - Intronic
1078953508 11:16163094-16163116 AAGAGTATGAAAAAAGAGGAGGG + Intronic
1079248361 11:18769766-18769788 TAGAGCAAATAGAAAGAGCAAGG + Intronic
1079300675 11:19276387-19276409 TAGGGCAAACATAATGAGGATGG + Intergenic
1079484571 11:20922068-20922090 TAGAGTGAACAAAAAGAAGGAGG - Intronic
1079631621 11:22684550-22684572 AATAGGAAACAAAAAAAGGAAGG + Intronic
1079719133 11:23788783-23788805 CATAATAAAGAAAAAGAGGAAGG + Intergenic
1079911415 11:26315263-26315285 TGGAGTCTAGAAAAAGAGGATGG - Intronic
1081093113 11:38897675-38897697 TAGAGTGAACAGGAAAAGGAAGG + Intergenic
1081480438 11:43482147-43482169 AAGAGAAAACAAAAAGATGGTGG - Intronic
1081950974 11:47042215-47042237 TAAAATAAAGAAAGAGAGGAAGG + Intronic
1082180885 11:49117886-49117908 TAGAGAAAACATAAAGATGTAGG + Intergenic
1082830144 11:57610928-57610950 AAGAGAAAAAAAAAAGAAGAAGG - Intronic
1083513800 11:63236804-63236826 TATAGTTAATAAAAAGAAGAAGG - Intronic
1084819692 11:71677299-71677321 TAAAATAAACAAAAATAGGGCGG + Intergenic
1085888300 11:80546630-80546652 AACAGAAAACAAAAAGAGCAAGG + Intergenic
1086047293 11:82547878-82547900 AAGAGAAAAAAGAAAGAGGAGGG + Intergenic
1086342859 11:85865029-85865051 TAGAGTAAACAAAAGTAGGGAGG + Intronic
1086735382 11:90299906-90299928 AAGAGTAAATAAAAAAATGAAGG - Intergenic
1087119344 11:94556833-94556855 TATAGTAACCAAAAAAAGCATGG - Intronic
1087266692 11:96069263-96069285 AAGAGAAAAGAAAGAGAGGAAGG - Intronic
1087446759 11:98265413-98265435 TAGACTAAGGAAAAAGAGAAAGG + Intergenic
1087477418 11:98653707-98653729 TAGCTAAAAGAAAAAGAGGAAGG - Intergenic
1087590984 11:100187555-100187577 TACAGTAAACTAAAACAGCATGG + Intronic
1087851762 11:103039127-103039149 TACAGTAACCAAAAACAGCATGG - Intergenic
1087898702 11:103616093-103616115 TACAGTAACCAAAAACAGCATGG + Intergenic
1088891442 11:114047896-114047918 TAGAGGAAAGAAAAAGAGGCTGG + Intergenic
1089248409 11:117138851-117138873 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG + Intergenic
1090233633 11:125129116-125129138 TAGACTAAAGGAGAAGAGGAAGG - Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1090872235 11:130758614-130758636 TGGAGCAAAGAACAAGAGGACGG + Intergenic
1092068776 12:5615531-5615553 TTGAGTAGACAAGAGGAGGAAGG - Intronic
1092441209 12:8506388-8506410 TACAGTAACCAAAAAGAGTGTGG - Intergenic
1092463654 12:8708976-8708998 TGGAGGAAATAAAGAGAGGATGG + Intronic
1092607404 12:10135705-10135727 TAGAGAAAACAAGGAAAGGAAGG - Intergenic
1093359079 12:18201723-18201745 TAGAGTTAACATAAGGAGAAAGG - Intronic
1093400129 12:18735739-18735761 TAGAGTAAGAAAAAAGAGAGAGG - Intronic
1093599740 12:21007441-21007463 TACAGTAACCAAAAACAGCATGG + Intergenic
1093706535 12:22280910-22280932 TACAGTAAAGTAAAAGAGCAAGG - Intronic
1093850093 12:24026109-24026131 TAAAGTAAACACAATGAAGAAGG + Intergenic
1094396286 12:30009257-30009279 AAGAAAAAAAAAAAAGAGGAAGG + Intergenic
1095114147 12:38332005-38332027 AAGAGTAAACAAAAGAAGGCAGG - Intergenic
1095513684 12:42981973-42981995 TAAAGCAAAAAAAAAAAGGAAGG - Intergenic
1095568848 12:43658839-43658861 AAGATGAAAGAAAAAGAGGAGGG + Intergenic
1095744840 12:45646392-45646414 TGGTATAAACAATAAGAGGATGG + Intergenic
1095756073 12:45768592-45768614 AAGAGTATTCAAAAACAGGAGGG + Intronic
1096444544 12:51677382-51677404 TAAATTAAAAAAAAACAGGATGG - Intronic
1096796809 12:54082868-54082890 TAAAATAAAAAAAAAGAAGAAGG - Intergenic
1097784059 12:63739276-63739298 AAGAGTAACAAAACAGAGGAAGG - Intergenic
1098622490 12:72619925-72619947 TAAAGTAAAAATAAAAAGGAAGG - Intronic
1099578670 12:84412600-84412622 TAGAGTTAGAAAAAAGAGGTTGG + Intergenic
1099633387 12:85179095-85179117 TGGTATAAATAAAAAGAGGAAGG - Intronic
1100213372 12:92421606-92421628 TGAATAAAACAAAAAGAGGAAGG + Intronic
1101082716 12:101205548-101205570 TAGAGTAGAAAAGAAGAGGAAGG + Intronic
1101864763 12:108512540-108512562 AAGACTTAACAAAGAGAGGAGGG + Intergenic
1102364806 12:112323225-112323247 TAAAATAAATAAAAAGAGCAAGG + Intronic
1102834993 12:116047899-116047921 TGGAGTTAAGAAAAAGAGTAAGG + Intronic
1102944598 12:116974900-116974922 TAAAATAAATAAAAAGATGAAGG + Intronic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1104197522 12:126555172-126555194 CAGAGCAAACAAAGATAGGAAGG + Intergenic
1104250171 12:127085763-127085785 TAGAGGAAACAAGGAAAGGAAGG + Intergenic
1105435594 13:20375440-20375462 TTGAATAAACTAAAAGAAGATGG + Intergenic
1106859018 13:33884853-33884875 CAGAGGAAAGAAAAAGAGAAAGG + Intronic
1106875972 13:34073264-34073286 AACAGTAACCAAAAAGAGCAAGG - Intergenic
1106881191 13:34132381-34132403 TAGAGTAAATGAAAATAGCACGG - Intergenic
1107397934 13:40037569-40037591 TACAGTAACCAAAAACAGCATGG - Intergenic
1108343597 13:49522055-49522077 GAGTGAAAAGAAAAAGAGGAAGG + Exonic
1109929950 13:69202708-69202730 TTGAGTAAATAAAAAGAGTATGG + Intergenic
1110317363 13:74125837-74125859 TAGAATAAAGCAAAAGTGGAAGG - Intronic
1110513892 13:76385864-76385886 TCAAGTAAAAAAAAAAAGGAAGG + Intergenic
1110846516 13:80195882-80195904 TAAAGAAAAAGAAAAGAGGAAGG + Intergenic
1110968442 13:81730672-81730694 TACAGTAACCAAAAACAGCATGG - Intergenic
1111233275 13:85372761-85372783 GAGAGGAAACAAGAGGAGGAGGG - Intergenic
1111320059 13:86615252-86615274 GAGAGTAAACAACAACAGAATGG - Intergenic
1111623145 13:90749609-90749631 TAGTGTGAAGAAAATGAGGAGGG - Intergenic
1111776923 13:92675575-92675597 TATAGTTAAAAAAAAAAGGAGGG - Intronic
1111990300 13:95109798-95109820 TAGAGTAAACTCATAGAAGAAGG + Intronic
1112341514 13:98556466-98556488 TAGTTTAAGCAAAAAGAAGAAGG - Intronic
1112691075 13:101894739-101894761 AAGATTAAAGAAAAAAAGGAGGG + Intronic
1112829632 13:103433145-103433167 AAGAGAAAGCAAAAAGAGAAGGG - Intergenic
1112869995 13:103958993-103959015 TAAATTAAACAAAAACAGCATGG - Intergenic
1113164261 13:107420238-107420260 AAGACAAAACAAAAAGAGGAAGG + Intronic
1113394660 13:109935738-109935760 TACAGTGACCAAAAAGAGCATGG - Intergenic
1114290834 14:21287034-21287056 AAGAGGAAAGAAAGAGAGGAAGG + Intergenic
1114651112 14:24285044-24285066 TACATTAAACAGGAAGAGGATGG - Intergenic
1114982539 14:28183598-28183620 TATAGTAAAAAAAAATAGTATGG + Intergenic
1114991069 14:28290654-28290676 TACAATAAACAAAAACAGCATGG - Intergenic
1115009721 14:28530463-28530485 TAAAGGAAAGAAAAAGAAGAAGG + Intergenic
1115919702 14:38359034-38359056 TAGACTAAGCAAAAAAAGGATGG + Intergenic
1116079229 14:40152402-40152424 TATAGTAAACAAATAGATGTAGG + Intergenic
1116283005 14:42932727-42932749 TAGAGTAAAAAAACATAGAATGG + Intergenic
1116905621 14:50400799-50400821 TAGCCTAAAAAAAAGGAGGAAGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116967041 14:51025774-51025796 TAGAGTAAAGAACAGGATGAAGG + Intronic
1117698312 14:58388737-58388759 TATAGTAATCAAAAACAGGGTGG + Intergenic
1118169402 14:63372083-63372105 GAGAGAAAAAAAAAAGAGAAAGG + Exonic
1118367482 14:65108237-65108259 TAGAAAAAAAAAAAAGAGGCCGG + Intergenic
1119270244 14:73297291-73297313 AAGAGAAACCAAAAAGGGGAGGG + Intronic
1120092221 14:80345375-80345397 AAGAGTAGAGAAAAAAAGGAAGG + Intronic
1120652912 14:87155809-87155831 TAGAGGGAAGAAAAAGAGGGTGG + Intergenic
1121077035 14:91077455-91077477 AAGAAAAAACAAAAAGAGGCTGG + Intronic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122512182 14:102278278-102278300 TAGATTAAATAAAAATAGCAGGG + Intronic
1122907600 14:104808913-104808935 TAGTGAAAACAAAACCAGGAGGG - Intergenic
1123221678 14:106863327-106863349 TATAATAAACAAAAAAAGAAAGG - Intergenic
1123700593 15:22912108-22912130 GGGAGAAAACAAAAAGAGAAAGG + Intronic
1124081514 15:26502386-26502408 AAAAATAAACAAGAAGAGGAAGG - Intergenic
1124499671 15:30216389-30216411 TAGATTGAACACAAAGAAGAGGG + Intergenic
1124584949 15:30996213-30996235 TGGGGGAAACAAAAAGAGGGAGG + Intergenic
1124743908 15:32322278-32322300 TAGATTGAACACAAAGAAGAGGG - Intergenic
1124807085 15:32895338-32895360 AAAGGGAAACAAAAAGAGGAAGG + Intronic
1124832377 15:33161616-33161638 TAGATTAAAAAAACAAAGGAAGG + Intronic
1125254819 15:37751411-37751433 AAGAGGAAGGAAAAAGAGGAAGG + Intergenic
1125312514 15:38395973-38395995 TAAAGTAAAATGAAAGAGGATGG - Intergenic
1125826295 15:42679354-42679376 TGGAGCATACAGAAAGAGGAAGG - Intronic
1125865130 15:43040210-43040232 TACAGTAACCAAAAACAGCATGG + Intronic
1125869874 15:43090068-43090090 TACAGGAAACAGAAAGAGGGAGG + Intronic
1126097755 15:45101276-45101298 TAGAGAAAAGAACAAGAGGCAGG + Intronic
1126196265 15:45935579-45935601 TAGAGAAAACAAATAAGGGAGGG + Intergenic
1126622018 15:50649822-50649844 GGTAGAAAACAAAAAGAGGAGGG + Intronic
1127159550 15:56166989-56167011 GAGAGTCAACCAAAGGAGGATGG - Intronic
1127165083 15:56236466-56236488 AAGACTAAACAGAAAGAGAATGG + Intronic
1127210852 15:56773025-56773047 TTGAGTAAACAAAAAGGGAAGGG + Intronic
1127340453 15:58038007-58038029 TAGAGAAAAAAAGAAGGGGAAGG - Intronic
1128302154 15:66572882-66572904 AAAAGTAAAAAAAAAGAGGCTGG + Intergenic
1129009845 15:72405606-72405628 CAGAATAAAAAAAAAGTGGAGGG + Intronic
1129990753 15:79960279-79960301 TAAAATTAAAAAAAAGAGGAAGG + Intergenic
1130542467 15:84831011-84831033 TAAAGTAGAAAAAAAGAGGCCGG - Intronic
1130717776 15:86352780-86352802 AAGAGTAAAGAAAAAGTGGCTGG - Intronic
1131570124 15:93526138-93526160 CAGAGTAAACAAAAATAGAAGGG - Intergenic
1131932585 15:97460856-97460878 TATTGCAAAAAAAAAGAGGAGGG + Intergenic
1133691975 16:8224508-8224530 TACAGTAAACCAAAACAGCATGG - Intergenic
1133833669 16:9348248-9348270 TAGCAAAAACAAAAAGTGGAGGG - Intergenic
1134377864 16:13695169-13695191 CAGACTAAGGAAAAAGAGGAGGG + Intergenic
1134839821 16:17392846-17392868 TAAAGTAAACATAAAGTGGAGGG - Intronic
1135083097 16:19452877-19452899 TAGAGCAAATGAAAAGAGGCAGG + Intronic
1135088090 16:19490763-19490785 AAGAGAAAAGAAAAAAAGGAAGG - Intronic
1135904667 16:26500259-26500281 GAGAGAAAAAAAAAAGAAGAAGG + Intergenic
1137249943 16:46733922-46733944 AAGAGTCAACCAAGAGAGGAAGG + Intronic
1137518897 16:49174916-49174938 TAGGCTATACAAAAACAGGAAGG + Intergenic
1137779110 16:51082211-51082233 TAAAGTAAAGCAAGAGAGGAAGG - Intergenic
1137785917 16:51137590-51137612 GAGAGAGAAAAAAAAGAGGAGGG + Intronic
1137861717 16:51853618-51853640 TAAGGTCAACAAAAAGAGGTTGG + Intergenic
1137927715 16:52557072-52557094 TAGAGTTAAGAAAAAAAAGAGGG - Intergenic
1138295265 16:55880008-55880030 TAGAGTCATCAAAAAGTGCATGG - Intronic
1138486211 16:57345682-57345704 AAAAATAAACAAAAAGATGAAGG + Intergenic
1138621258 16:58213059-58213081 GGGAGGAAAGAAAAAGAGGAAGG + Intergenic
1139013751 16:62664780-62664802 TTGAGTAAACAAAATTAGGTTGG - Intergenic
1139167620 16:64586943-64586965 TAATGTAGAAAAAAAGAGGATGG - Intergenic
1139191880 16:64873671-64873693 TAGAGTCAAGAGAATGAGGATGG + Intergenic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140139720 16:72244121-72244143 CAGAAGAAATAAAAAGAGGAAGG + Intergenic
1141009493 16:80384217-80384239 GAGATTAAAAAAAAAGAAGATGG + Intergenic
1141237648 16:82233568-82233590 TAGAGAAGACAGAAAGTGGAAGG - Intergenic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141932492 16:87215407-87215429 AAGAGGGAAAAAAAAGAGGAGGG + Intronic
1142485323 17:244026-244048 TAGAGGAAAGTAATAGAGGAAGG - Intronic
1143674761 17:8424056-8424078 TACAGAAAAGAAAAAAAGGAAGG + Intronic
1144212320 17:13025916-13025938 AAGAGAAAGGAAAAAGAGGAAGG - Intergenic
1144562013 17:16328705-16328727 TACAGTAAAACAAAAGAGGCAGG - Intronic
1145247858 17:21281399-21281421 TAGAGGAAGAAGAAAGAGGAAGG + Intergenic
1145730870 17:27184409-27184431 TACAGTAACCAAAAACAGCATGG - Intergenic
1148118040 17:45189475-45189497 TAAAGAAAAAAAAAAGAAGAAGG - Intergenic
1149733535 17:58970716-58970738 TAGAGTCCACACAAAGAGGTGGG + Intronic
1150918523 17:69460038-69460060 TGGAGGAAAGAAAAAGATGAAGG - Intronic
1151019136 17:70592604-70592626 AAGAGAAAACAAAAAGAAAAGGG - Intergenic
1151098069 17:71522148-71522170 TAGAGAAAAGAAAGAAAGGAAGG + Intergenic
1151528571 17:74688631-74688653 GAGTGTAAAAAAAAAGAGAACGG + Intronic
1155284760 18:24276182-24276204 GATAGTACACAAAATGAGGAGGG + Intronic
1155325004 18:24656387-24656409 TATAGGAAAAAAAAATAGGAGGG - Intergenic
1155363509 18:25027832-25027854 TAGGGAAAACAAAAGGAAGAAGG + Intergenic
1155612870 18:27687123-27687145 TAGAGAACAGAAAAAGAGGGAGG + Intergenic
1155839359 18:30627859-30627881 TAAAGGCCACAAAAAGAGGATGG - Intergenic
1155870441 18:31020525-31020547 AACAGTAAAATAAAAGAGGAAGG - Intronic
1155908992 18:31487114-31487136 TACAGAAGAGAAAAAGAGGATGG + Intergenic
1156690235 18:39698545-39698567 TAGAGTGTTTAAAAAGAGGATGG - Intergenic
1156747300 18:40407585-40407607 TAGAGTAAAGAAATAAAGAAAGG - Intergenic
1157049076 18:44139157-44139179 GAGAGGGAAGAAAAAGAGGAGGG + Intergenic
1157115086 18:44854901-44854923 TAGAGCAGAGAAAAAGAGCAAGG - Intronic
1157877227 18:51285124-51285146 AAGAGTAAACAAAAAGTTTAAGG - Intergenic
1158267104 18:55671674-55671696 TGGAGTAAACAAAAACATTAAGG - Intergenic
1158710517 18:59833345-59833367 TAGAATTAAGAAAAAGAGAAAGG - Intergenic
1158762249 18:60403630-60403652 CAGAGTAAAACAAGAGAGGAGGG - Intergenic
1159024424 18:63169490-63169512 AAGAGAAAAGAAAGAGAGGAGGG - Intronic
1159031025 18:63232266-63232288 TAAAGTAAAAAAGAAGAAGAAGG + Intronic
1159764878 18:72476852-72476874 TTAAGTAAGCTAAAAGAGGAAGG - Intergenic
1160308259 18:77761696-77761718 AAGAGTAAAGTAAAAGAGGGAGG - Intergenic
1160402487 18:78621089-78621111 AAAAGTAAAAAAAAAGAGGCAGG - Intergenic
1162485458 19:10957643-10957665 TAGTGTAAAGAAAAACAGGCCGG - Intergenic
1164258935 19:23552536-23552558 AAGAGAAAGCAAAAAGAGGCTGG - Intronic
1165311529 19:35031562-35031584 GAGAGTGGACAAAAAGTGGAGGG + Intronic
1166869033 19:45859630-45859652 GAAAGAAAACAAAAATAGGACGG + Intronic
1167770957 19:51517659-51517681 GAGATTAAAGAAAAAAAGGATGG - Intergenic
1168594415 19:57664142-57664164 AAGAGAAAAGAAAAAGAGAAAGG + Intergenic
925834874 2:7934827-7934849 TAGTGTAAACATGAACAGGAAGG - Intergenic
926255621 2:11193445-11193467 GAGATTAAACAAAAACAGAAAGG + Intronic
926463555 2:13163611-13163633 AAGAGGAAAGAAAAAGAGAATGG + Intergenic
926486620 2:13469086-13469108 TTGTGAAAACAAAAAGATGATGG - Intergenic
926539577 2:14158770-14158792 TACAGTAACCAAAAACAGCATGG - Intergenic
927427021 2:22992624-22992646 TAGACTAAACAAAGAGACGCAGG - Intergenic
927481755 2:23459436-23459458 TGGAGTAAAAAAAGAGAAGAGGG + Intronic
927901730 2:26824311-26824333 TAAAAAAAAAAAAAAGAGGAAGG - Intergenic
927995212 2:27480367-27480389 CAGAGAAAACAAAAAGACCAGGG + Intronic
928591935 2:32826143-32826165 AAAAGGAAAGAAAAAGAGGATGG + Intergenic
928819231 2:35341397-35341419 TAGAGGAAAGAAAAAGAGATGGG + Intergenic
928855408 2:35797027-35797049 AAGGGGAAACTAAAAGAGGAGGG + Intergenic
929047457 2:37803834-37803856 TACACAAAAGAAAAAGAGGAGGG - Intergenic
929425720 2:41842805-41842827 TAGAATTAACAACAAGAGAATGG - Intergenic
930763109 2:55057664-55057686 TTGAGAAAGCGAAAAGAGGATGG + Intronic
931165826 2:59746680-59746702 TGGAAGAAAAAAAAAGAGGAAGG + Intergenic
931179373 2:59884372-59884394 TAGAGGAAACAACACGGGGAAGG - Intergenic
931735560 2:65190230-65190252 TAGATTAAAGAAAATGAGGACGG - Intergenic
932588338 2:73046068-73046090 TAGAGTAAATTCCAAGAGGAGGG - Intronic
932913204 2:75827025-75827047 TATAGTAAACAAAAACAGCATGG + Intergenic
933078979 2:77965618-77965640 TGGAGCAAAGAACAAGAGGAAGG - Intergenic
933343878 2:81058380-81058402 AAGTGGAAACAAAAAGAGCAGGG - Intergenic
934510950 2:94942644-94942666 CAGAGAGAAAAAAAAGAGGAAGG + Intergenic
935510031 2:103959906-103959928 TATAGTAAACAAAGAGAGAGGGG + Intergenic
935874791 2:107494749-107494771 CAGAGGAAAGAAAGAGAGGAAGG + Intergenic
935918962 2:107988621-107988643 CAGAGTAAAAACAAAGAGGTGGG + Intronic
937165959 2:119817544-119817566 TACAGTAACCAAAAACAGTACGG - Intronic
937557037 2:123170946-123170968 GAGACTAAACTAAAAGAGAAAGG + Intergenic
937645714 2:124264028-124264050 TACAGTAACCAAAAACAGCATGG - Intronic
939495248 2:142920753-142920775 TAAAATAAACAAAGCGAGGATGG - Intronic
939973596 2:148690255-148690277 TAGAGAAAAAAAAGAGAGTATGG + Exonic
940492004 2:154374514-154374536 TTGAGTAAGGAAAAAAAGGATGG + Intronic
940529651 2:154864923-154864945 TAGAATAAAGACAAAGAGGGAGG - Intergenic
940982686 2:160021022-160021044 TAGAGAAAGGAAAAATAGGAAGG + Intronic
941404026 2:165066689-165066711 TAGAGAAAACAGAAAAAGGAAGG + Intergenic
941405769 2:165085385-165085407 AAGAGTAAACAATAGGAGGAAGG - Intergenic
941416862 2:165231705-165231727 CAGAGAGAACAAAAAGAAGAGGG - Intergenic
942016308 2:171820430-171820452 TACAGTAAAGAAAAAGAGGCCGG + Intronic
942395961 2:175549901-175549923 AAAAGTAAACAGGAAGAGGAAGG - Intergenic
943317315 2:186406161-186406183 TAGAATCAACAGAAAGAGCATGG - Intergenic
943356960 2:186867796-186867818 TAGAGGAAAGATAAAGAGGAAGG + Intergenic
943693870 2:190901406-190901428 TAGACTGAAGAAGAAGAGGAGGG + Intronic
944932181 2:204530967-204530989 TAGAGTGAGGGAAAAGAGGATGG - Intergenic
944939408 2:204607404-204607426 TAGAGAAGGCAAATAGAGGATGG + Intronic
945042729 2:205755606-205755628 TAGGGAAAAAAAAAAAAGGAGGG + Intronic
945101742 2:206268677-206268699 TAGAGAAAGAAAAAAGAGAAAGG + Intergenic
945358066 2:208861972-208861994 TAGAGTAAACACAATCAGGTGGG + Intergenic
945509749 2:210686589-210686611 AAGAGTAAACAAGAGCAGGAGGG + Intergenic
945636369 2:212357154-212357176 TATTGTAAACAAAAAGAAAATGG - Intronic
945779333 2:214148625-214148647 GAGAAAAAACAAAAAGAGGTAGG - Intronic
947101562 2:226626706-226626728 TAGTGTAAACAATAAAAGCATGG - Intergenic
947250967 2:228103366-228103388 TAGAGAAAACAAATAAAGCAAGG - Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947961593 2:234242671-234242693 TAGGGTTAATAAAAAGAGTAGGG + Intergenic
949035887 2:241815603-241815625 GGGAGTAAAGAATAAGAGGAAGG - Intronic
1168810411 20:701139-701161 TAGAATAAATAAATAGAAGAGGG + Intergenic
1169240979 20:3980626-3980648 CAGAGTATACAAAAAAATGATGG + Intronic
1169740811 20:8892272-8892294 TAGAGTAAATACAGAGATGAGGG - Intronic
1170198509 20:13716291-13716313 TGTACTCAACAAAAAGAGGAAGG + Intronic
1170648691 20:18219602-18219624 TAGAGCAAACAAAAAGTTTAGGG + Intergenic
1173899390 20:46576032-46576054 GAGAGGAAAGAAAAAGAGGAAGG + Intronic
1174306027 20:49614931-49614953 TAGAGAAAACAAAGGGAGAACGG + Intergenic
1174727351 20:52876970-52876992 TAAATTAAAAAAAAAGGGGAAGG + Intergenic
1174753948 20:53139929-53139951 ATGAGTGAACATAAAGAGGATGG - Intronic
1175625176 20:60483807-60483829 TAGTTTAACCAAAAAGGGGAGGG + Intergenic
1176974355 21:15302087-15302109 GAGGTTAAACAAAAAGAAGATGG - Intergenic
1177211025 21:18070887-18070909 TGGAGTAAACAAAAAAAAAAAGG - Intronic
1178042514 21:28655204-28655226 TAGAATAGACAAATAGAGGAGGG - Intergenic
1178324854 21:31636557-31636579 TACACAAAAGAAAAAGAGGAAGG - Intergenic
1178364969 21:31982515-31982537 AAGAGGAAACCAAAAGAGAAGGG - Intronic
1178742895 21:35219666-35219688 AAGAGGAAACAATAAAAGGAAGG + Intronic
1179364714 21:40747315-40747337 TAGACTAAGGAAAAAGAGAAAGG + Intronic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1180109116 21:45639756-45639778 TAGAATGAACACAGAGAGGATGG - Intergenic
1181449324 22:23007758-23007780 TATAGTGAACAAAAAGGGCATGG + Intergenic
1183013464 22:34966864-34966886 ATGAGTAAACAAAAAGGGGACGG - Intergenic
1183209234 22:36440369-36440391 TAGAGTAAAAAAGATGAGGTTGG + Intergenic
1184041068 22:41944141-41944163 TAGAGTAAACAAAAAGAGGACGG + Intronic
1184177400 22:42796005-42796027 AAGAAAAAAAAAAAAGAGGAAGG - Intergenic
1184900020 22:47440254-47440276 CAGAGAAAACAAAAATAGCATGG - Intergenic
949365713 3:3278397-3278419 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
949547544 3:5084677-5084699 AAGAGTTAGGAAAAAGAGGAGGG - Intergenic
949795599 3:7847074-7847096 TAGAAAAAAAAAAAAAAGGAGGG - Intergenic
950486573 3:13277527-13277549 TAGAGTCCACAGAAAGACGAGGG - Intergenic
950890044 3:16396552-16396574 TAGAGTGAAAAAAGAGAGGAGGG + Intronic
951267121 3:20581109-20581131 TACAGTAATCAAAAACAGCATGG + Intergenic
951778669 3:26338978-26339000 TATAGTAACCAAAAACAGCATGG - Intergenic
951824738 3:26855929-26855951 TAAAGTAAAAGAAAAGGGGATGG + Intergenic
951850481 3:27134055-27134077 TAGAGAAAGAAAAGAGAGGAAGG + Intronic
952141996 3:30490138-30490160 TATAGTAAACAACAGGAGAATGG + Intergenic
953380526 3:42468114-42468136 TAGATTAAACAAACAGAAAATGG + Intergenic
954064158 3:48092574-48092596 CAGAGGAAACAATATGAGGAGGG - Intergenic
954867030 3:53738347-53738369 TAGTGTCAATATAAAGAGGAAGG + Intronic
954991340 3:54843282-54843304 TAGAGTAAACATAGTGATGATGG + Intronic
955063053 3:55510681-55510703 CAGATTAAAGAAATAGAGGAGGG + Exonic
955123940 3:56090795-56090817 TAGAAATAAAAAAAAGAGGAAGG - Intronic
955352366 3:58203265-58203287 TAGGGGGACCAAAAAGAGGATGG - Intronic
955873586 3:63466252-63466274 AAGAGAAAAGAAAAAGAGAAAGG - Intronic
955975772 3:64478115-64478137 AACAGAAAACAAAAAAAGGAAGG + Intergenic
956382799 3:68683922-68683944 TACAGTAACCAAAAACAGCATGG - Intergenic
956511969 3:70003383-70003405 AAGAGAAAAGAAAAAGAAGAGGG - Intergenic
957002565 3:74903080-74903102 CAGAGTATATAAAATGAGGATGG + Intergenic
958031287 3:88114208-88114230 TAGAGAAAAATAAAGGAGGATGG + Intronic
959125696 3:102288215-102288237 TAGAGTCAACAAAGAAAGAATGG - Intronic
959667323 3:108936494-108936516 TAAAGTAACAAAAATGAGGACGG + Intronic
960214249 3:115010951-115010973 TAAAGTAATTAAAAAGAGGCAGG + Intronic
960537482 3:118829157-118829179 AAGAAGAAACAAAAAGAGGGAGG + Intergenic
960644848 3:119868119-119868141 GAAAGAAAAGAAAAAGAGGAAGG + Intronic
960840825 3:121956817-121956839 TATAGTGAACAAAAACAAGAAGG - Intergenic
961608518 3:128116761-128116783 TAGAGAAATCACAAAGATGAGGG - Intronic
962879711 3:139564805-139564827 TAGAGCAATTAAAAACAGGAAGG - Intronic
963029189 3:140950517-140950539 GAAAGTAAACTAAAAGAAGATGG - Intronic
963411951 3:144939830-144939852 TGGAGGGAACAAAAATAGGAAGG + Intergenic
963526083 3:146415172-146415194 TAGAGTAAAAATAAAGAAGGTGG + Intronic
963983319 3:151564429-151564451 AGGAGGAAACAAAGAGAGGAAGG - Intergenic
964488835 3:157213276-157213298 GAAAGAAAACAAAAAGAGGAGGG + Intergenic
964491694 3:157242813-157242835 TGGATTAAACAATAAGAGAAAGG + Intergenic
965041656 3:163516816-163516838 TAGAGCAGACAAAAAGAAAAAGG + Intergenic
965475312 3:169148702-169148724 TGGAGAAAACAAAAAGTGGGTGG - Intronic
967292743 3:187937069-187937091 TAGAGTAAAAATAAAGAGGGAGG - Intergenic
967424532 3:189311303-189311325 AAAAGTAAACATAAAAAGGACGG - Intronic
968463769 4:739486-739508 TGGAATAAACAAAAACAGGCTGG - Intronic
970173435 4:13312033-13312055 TATAGTAACCAAAAACAGCATGG + Intergenic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
970552406 4:17195566-17195588 TAGTTTAAAAAAAAATAGGAGGG + Intergenic
970817684 4:20177732-20177754 TAGAGAAAACAATAAAAGAAAGG - Intergenic
970867418 4:20774999-20775021 TAGAGTAAACAGAAAAGAGAGGG - Intronic
970995549 4:22263562-22263584 TAGAGTGAGCAAAAAGAAAACGG + Intergenic
971943931 4:33250387-33250409 TATAGTTATAAAAAAGAGGAGGG + Intergenic
972008835 4:34148777-34148799 TACAGTAGAAAAAAAGAGGTTGG + Intergenic
973142324 4:46783724-46783746 TAGCTTAAACAAAAAGGGAAGGG + Intronic
973814804 4:54609892-54609914 TAGAATAAACAAAAAAACTAAGG - Intergenic
974467561 4:62276569-62276591 CAGAGTAAAAAAAAAAAGTAAGG + Intergenic
974627647 4:64444731-64444753 AAAAGAAAAAAAAAAGAGGATGG - Intergenic
975155092 4:71062552-71062574 TAGAGGGAAGAAAAAGAGCAAGG + Intergenic
975330938 4:73112043-73112065 CAGCACAAACAAAAAGAGGATGG + Intronic
975878934 4:78878699-78878721 TTGAGTAAGAAAAAAGAAGATGG - Intronic
976052629 4:81027217-81027239 GGGAGTAATAAAAAAGAGGAAGG + Intergenic
976229715 4:82828999-82829021 CAGAGTACCCAAAAAGAAGAAGG - Exonic
976323235 4:83740273-83740295 AAGAGGAAACAAAAAGGAGATGG + Intergenic
976360395 4:84171555-84171577 TAGAGTAATGAAAAAGATAAGGG + Intergenic
976492789 4:85691660-85691682 TATGGAAAACAAAAAGAGCAAGG - Intronic
978258394 4:106719785-106719807 TAAAGGAAACAAAAAGAGTTGGG + Intergenic
978386465 4:108180450-108180472 AAGAGGAAGCAAAAAGAAGAGGG + Intergenic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
978858339 4:113418789-113418811 TAGAGCAAGGAAAAATAGGAAGG + Intergenic
979052923 4:115956912-115956934 TTGGGTAAACAAAGAGAGTAGGG - Intergenic
979362472 4:119781117-119781139 TAGAGCAAATAAAAAGATGGGGG + Intergenic
979934488 4:126674337-126674359 TACAGTAACCAAAAACAGCATGG + Intergenic
980099896 4:128531265-128531287 TACAGTAACCAAAAACAGCATGG - Intergenic
980386695 4:132094135-132094157 TAGAGAAAACAAGCAGAAGAAGG - Intergenic
980829107 4:138108247-138108269 TAAAAAAAAGAAAAAGAGGAAGG - Intergenic
981206454 4:142046594-142046616 TAGAGTGAAAAGAAAGAGGAGGG + Intronic
981211301 4:142109135-142109157 TTGAGAAAAAAAAAAAAGGAAGG - Intronic
981491214 4:145341503-145341525 CAAAGCAAAAAAAAAGAGGAAGG + Intergenic
981978924 4:150768270-150768292 TAGAGGAATCAACATGAGGAAGG + Intronic
982183945 4:152777662-152777684 AGGAGGAAAGAAAAAGAGGAAGG + Intronic
982502126 4:156170578-156170600 GATAGTAACCAAAGAGAGGAGGG + Intergenic
983054927 4:163090686-163090708 AAGAGTAGCCAAAAACAGGAAGG + Intergenic
983203160 4:164884205-164884227 AAGAAGAAAGAAAAAGAGGAAGG + Intronic
983564566 4:169135852-169135874 TAGAGAAGAGAAAAAGAGCAAGG - Intronic
983610392 4:169638078-169638100 AACAGAAAACAAATAGAGGATGG - Intronic
983967736 4:173833519-173833541 TAGAGAAAAGAAAATGAGAAGGG - Intergenic
984331567 4:178327384-178327406 TAGAGTGACCGAAAAGAGGAAGG + Intergenic
984486683 4:180379100-180379122 TAGAGGAATTCAAAAGAGGAAGG - Intergenic
986578765 5:9241740-9241762 TAGAGAAAAGAAAAAGAGATTGG + Intronic
986915529 5:12615062-12615084 TAAAGCAAAAAAAAAAAGGAAGG + Intergenic
987245601 5:16045197-16045219 TAGAGAAAAGAAATAGAGGCAGG + Intergenic
987287077 5:16467080-16467102 AAGAGAAAACCAAAAGAAGATGG + Intergenic
987334393 5:16885966-16885988 TAGAGTACTCAAACAGAGTAGGG + Intronic
987462987 5:18236367-18236389 TAGAGTAAGGAAATAGAGTAAGG + Intergenic
987734399 5:21821256-21821278 TGCAATAAACAAAAAAAGGAAGG - Intronic
987780477 5:22427549-22427571 TAGAGTAAAGACAAAGAAAAAGG - Intronic
988034953 5:25815488-25815510 TAGAGCAAAAAAGTAGAGGAAGG - Intergenic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
989329244 5:40236399-40236421 AATAGTAAACATAAAAAGGAAGG - Intergenic
989458275 5:41667207-41667229 TAGAGGAAACAAGAGGAAGAAGG + Intergenic
990010189 5:50988290-50988312 AAGAGAAAAAGAAAAGAGGAAGG - Intergenic
990429559 5:55720998-55721020 AAGAGTAAGCAAAAGCAGGAGGG + Intronic
991260366 5:64661351-64661373 TAGAGTAAAGAGAAAATGGAAGG - Intergenic
991364864 5:65858075-65858097 AAAAGAAAAAAAAAAGAGGAAGG - Intronic
991704525 5:69345448-69345470 TAGATTAACAAAAAAGAGAAGGG - Intergenic
992341189 5:75825078-75825100 TAGAGTAGGCGGAAAGAGGAGGG + Intergenic
992372215 5:76154927-76154949 AAGAGAAAAATAAAAGAGGAGGG + Intronic
992719698 5:79548337-79548359 GAGAGGAAAAAAAAAAAGGAAGG + Intergenic
993249185 5:85494655-85494677 TACACTAAACAAAAATAGAAAGG + Intergenic
993491069 5:88550343-88550365 TAAAGAAAAAAAAAAGAAGAAGG + Intergenic
993651382 5:90526922-90526944 GAGAGTATAGAAAAAGAAGAGGG + Intronic
993873828 5:93282881-93282903 TTGAGTAAACAATAAAATGACGG - Intergenic
994073383 5:95625234-95625256 TAGGGTCAACACAAATAGGATGG - Intergenic
994656764 5:102603852-102603874 TACAGTAACCAAAAACAGCATGG - Intergenic
994852269 5:105070926-105070948 TATATTAAACAAAAACAGGAAGG - Intergenic
995341829 5:111069695-111069717 AAGAGGAAACAAAAAAAGGGAGG + Intergenic
995412088 5:111869807-111869829 AAGAGTAGGTAAAAAGAGGAGGG + Intronic
995421413 5:111971484-111971506 TAGAGTAAACAAATTCAGTATGG + Intronic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995962931 5:117866586-117866608 TAGAGAAAAAAAAAAGCAGAAGG - Intergenic
995994669 5:118283563-118283585 AAAAGAAAAAAAAAAGAGGAGGG + Intergenic
996074528 5:119174781-119174803 TAGAGGAAAGAGAAAGAGAAAGG - Intronic
996334170 5:122365155-122365177 TAGGGAAAGCAAAAAGAAGATGG - Intronic
996542201 5:124642202-124642224 GAGACTAAACAAAAATAGGATGG - Intronic
996735721 5:126756317-126756339 TAGAATAAAAAAAGAGAGGCTGG - Intergenic
997401487 5:133606642-133606664 CAGAGTAAACACACAGAGCAAGG + Intronic
997907895 5:137838035-137838057 TATAGATAACAAAAAGAGGCAGG + Intergenic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
997953720 5:138262244-138262266 AAGAGAAAACTGAAAGAGGAAGG + Intronic
998894505 5:146785188-146785210 AAGAGTATAGAAAAGGAGGAAGG + Intronic
998990997 5:147816684-147816706 TAGAAAAAACAAAAAGAAAAAGG - Intergenic
999005539 5:147973271-147973293 TAAAGTAAACAAAGAGTGCAGGG + Intergenic
999363061 5:151002449-151002471 TAGGATAAAGAAAAAGAGGCTGG + Intergenic
999494740 5:152085712-152085734 TAGTGTAAACAAAAAAAAAAAGG - Intergenic
1000187766 5:158877232-158877254 TAGAGGATACAAAAAGAATAGGG - Intronic
1000237359 5:159374593-159374615 TAGATTAATCAAAAAGAGAGAGG - Intergenic
1000578376 5:163005261-163005283 AAAAGTACACAAAAAGAGAAAGG - Intergenic
1000600029 5:163261740-163261762 TAGAGTCAACAAGAACTGGAAGG + Intergenic
1000688031 5:164277465-164277487 TAGAGAAAACAAGAAAAGAATGG - Intergenic
1000690708 5:164316595-164316617 TAGAGTAAACAATGAGAAAAAGG + Intergenic
1001061606 5:168495291-168495313 TGGGGTAGACAAAAAGAGAAAGG - Intronic
1001120069 5:168972707-168972729 TAGAGAAGACAGCAAGAGGAAGG - Intronic
1002395776 5:178952830-178952852 TAAAATAAACAAAAATAGAAAGG - Intronic
1003355110 6:5361552-5361574 TAGTATGAACAAAAAGAGAAGGG - Intronic
1003381416 6:5628014-5628036 AAAAGGAAACAAAAAGAGAAGGG + Intronic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004343421 6:14827274-14827296 TGGAATAAAGACAAAGAGGAAGG + Intergenic
1004700931 6:18078873-18078895 TGGAGAAAACAGAAACAGGAAGG + Intergenic
1005955613 6:30661392-30661414 TAAAGGAAAAAAAAAGTGGAAGG + Intronic
1006085294 6:31590830-31590852 AAGAAAAAAGAAAAAGAGGAAGG - Intronic
1006244026 6:32714177-32714199 CAGAGAAAACAAAAAGATAATGG - Intergenic
1006748096 6:36359143-36359165 CAGATTAAACAGAAAGGGGATGG + Intronic
1007042012 6:38731044-38731066 TATATTAAACAATTAGAGGAAGG - Intronic
1007557357 6:42777774-42777796 GACAGTAAAAAAAAAGAGGATGG - Intronic
1007622710 6:43224663-43224685 TAAAGGAAACATAAAGATGAGGG - Intergenic
1007961748 6:45966644-45966666 AAAAGGAAACAAAAAGAGGAGGG - Intronic
1008946171 6:57099441-57099463 GAGAGTAAAGGAAAAGAGAAGGG - Intronic
1009518474 6:64651470-64651492 TAAAGTAAAATAAATGAGGAAGG + Intronic
1009540102 6:64943963-64943985 TACAGTAACCAAAAACAGCATGG + Intronic
1009828484 6:68898301-68898323 TAGCTGAAACAAAAAGGGGAAGG - Intronic
1010059511 6:71606354-71606376 TTGTGTCAACAAAAAGAGCATGG + Intergenic
1010835498 6:80582880-80582902 TAGAGAAAAAAGAAAGAGCAGGG + Intergenic
1010839877 6:80636330-80636352 CACAGAAAACAAAAAGAGAAGGG + Intergenic
1011038971 6:83009960-83009982 GAGAGTAGACAAATGGAGGAGGG + Intronic
1011556097 6:88572821-88572843 TTGAGCAGACAAGAAGAGGAGGG + Intergenic
1011726860 6:90218484-90218506 GAAAGAAAAGAAAAAGAGGAGGG - Intronic
1011931113 6:92714728-92714750 TAGAGCATGCAAAAAGGGGAGGG + Intergenic
1012360274 6:98368949-98368971 TATGGTAAACAAAAAAATGAAGG + Intergenic
1012575032 6:100784819-100784841 TAAAATAAACAAAAGGAGAAAGG + Intronic
1012812908 6:103983694-103983716 AAGAGAAAAAAAAAAGGGGAGGG + Intergenic
1013069549 6:106716209-106716231 TAGAGGAAACAGGAAGAGAATGG - Intergenic
1013588079 6:111597155-111597177 GAGAGGAAAAAAAAAGAAGAGGG - Intronic
1013788514 6:113809877-113809899 TAGAGGAAGAAAAAAGGGGAAGG - Intergenic
1014020719 6:116585557-116585579 TAGAGTAAACAAATAAAGGTAGG - Intronic
1014134667 6:117874599-117874621 TACAGTAAAAAAAAACAGCATGG - Intergenic
1014275464 6:119382905-119382927 TATAGTAACCAAAAACAGCATGG - Intergenic
1014830514 6:126097901-126097923 AAGAATAAACAAAAAGAGTATGG - Intergenic
1014877438 6:126678170-126678192 TACAGTAACCAAAAACAGCATGG + Intergenic
1014916863 6:127161120-127161142 CAGAGGAAACAATAAGAGGTGGG - Intronic
1014917657 6:127171712-127171734 TTTAGCAATCAAAAAGAGGAAGG - Intronic
1015032468 6:128612073-128612095 TAGATTTAACAAAAATAAGATGG - Intergenic
1015145757 6:129984590-129984612 GAGAGGAACAAAAAAGAGGATGG + Intergenic
1015670284 6:135681374-135681396 TACAGTAAAAAAAAAAAGGAAGG - Intergenic
1015869969 6:137766290-137766312 TGGAGCTAACAATAAGAGGATGG + Intergenic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016785341 6:148005431-148005453 TAGAAAAAACAAAAAGGGCAAGG - Intergenic
1016802644 6:148182353-148182375 TAAAATAAAGAAAAAGAGGGAGG + Intergenic
1016822534 6:148360208-148360230 TAGATTAAAAAAAAAAATGAAGG - Intronic
1017070850 6:150574609-150574631 TTTTGTGAACAAAAAGAGGAAGG + Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1018322406 6:162625577-162625599 CAGAGTAGAAAAAAAGAGGAAGG - Intronic
1018667255 6:166149934-166149956 TAGATTAAAAAATAAGATGATGG - Intergenic
1019772270 7:2891175-2891197 AAGAAAAAAAAAAAAGAGGAGGG - Intergenic
1020428603 7:8096319-8096341 TAGAAAAAAAAAAAAGAGGCTGG - Intergenic
1020530717 7:9330808-9330830 AAGAAAAAAGAAAAAGAGGAAGG - Intergenic
1020646117 7:10816254-10816276 TAGAGTAACTAAAAGGAGGATGG + Intergenic
1020789725 7:12612011-12612033 TAGAATGAAAAAAAATAGGAGGG - Intronic
1020835693 7:13147776-13147798 TAGAGAAAAAAAAAAAAGGAGGG - Intergenic
1020936984 7:14478238-14478260 AATAGAAAACAAAAACAGGATGG + Intronic
1021937926 7:25649627-25649649 TACAGTAACAAAAAAGAGAAAGG + Intergenic
1022078226 7:26994371-26994393 TAGAGGAAACAAAACGTGCAAGG - Intronic
1022419183 7:30204688-30204710 GAGAGAAAACATAAAGAGAATGG - Intergenic
1022842620 7:34179260-34179282 TGGAGGAAATAAAAAGAGCAAGG + Intergenic
1022900463 7:34803754-34803776 TAGAAAAAAAAAAAAGAAGAGGG + Intronic
1023283771 7:38597131-38597153 TAAAGTAAACTAAAAGGGCAGGG + Intronic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023768139 7:43531055-43531077 TAGAGCATACAGAATGAGGAAGG - Intronic
1023904230 7:44510646-44510668 AAGAATATACAAAGAGAGGAAGG - Intergenic
1024033106 7:45481733-45481755 AAGAGTAAAGAAAAAGATCATGG - Intergenic
1024276390 7:47680352-47680374 TAGTGTCAAAAAAAAGAGGCCGG + Intergenic
1024497504 7:50065201-50065223 TAGAGGAATTAGAAAGAGGAAGG + Intronic
1024592921 7:50905143-50905165 TACAGTAACCAAAAACAGCATGG + Intergenic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1024955093 7:54910281-54910303 AAGAGTAAACACATTGAGGAAGG + Intergenic
1027228482 7:76259583-76259605 TAAAAAAAAAAAAAAGAGGAGGG + Intronic
1027394133 7:77735972-77735994 TATAGTAACCATAATGAGGAAGG + Intronic
1027412522 7:77936121-77936143 TAATGTAAAAAAAAAGAGGTGGG - Intronic
1027583646 7:80028933-80028955 AAGAGAAAACAAAGAAAGGAAGG - Intergenic
1027651824 7:80878079-80878101 TAGAATAAAAAAAATGAGGCCGG + Intronic
1028319637 7:89442966-89442988 TACAGTAACCAAAAAAAGCATGG + Intergenic
1028371311 7:90095510-90095532 AACAGAAAACAAAAAGGGGATGG + Intergenic
1028702963 7:93804428-93804450 TATAGTAACCAAAAACAGGATGG + Intronic
1028944746 7:96564634-96564656 TAGAGGAACCAAAAGGTGGAAGG + Intronic
1030160173 7:106499724-106499746 GAAAGTAAACAAAAAGACAAGGG + Intergenic
1030291203 7:107873996-107874018 TAGATTAAGCAAAAAGGAGAAGG + Intergenic
1030300728 7:107971785-107971807 TGGAATAGAGAAAAAGAGGAAGG + Intronic
1030327912 7:108240973-108240995 TAGAATAAACAAAGACAAGAAGG - Intronic
1030723407 7:112897028-112897050 TAGTGCACACATAAAGAGGAAGG + Intronic
1030770409 7:113468232-113468254 TAGAGGAAAAGAAAAAAGGAGGG - Intergenic
1030839799 7:114334620-114334642 GAGATTAAAAAAAAAGAAGAAGG + Intronic
1030881398 7:114884738-114884760 TAGAAAAAAAAAAAAAAGGAAGG + Intergenic
1030897696 7:115082250-115082272 TAGGAGAAACAAAAAGAGAATGG + Intergenic
1031070185 7:117153442-117153464 TAGAGTAAAAAAGAAGAGGAGGG + Intronic
1031533763 7:122909081-122909103 TATACTAATCTAAAAGAGGAAGG + Intergenic
1031582946 7:123499608-123499630 AAGAGGAAACAAAGAAAGGAGGG + Intronic
1031731335 7:125304690-125304712 GAGATTAAAGAAAAAGAAGATGG - Intergenic
1031956741 7:127950209-127950231 TAGAGGAAAAAAAAAGGGGGAGG - Intronic
1032568079 7:132969136-132969158 CACAGTAAAAAAAAAAAGGATGG - Intronic
1032941053 7:136792434-136792456 AAGAGGAAAAAAAGAGAGGAGGG + Intergenic
1033075733 7:138248693-138248715 AAGAGAAAAAAAGAAGAGGAGGG + Intergenic
1033118678 7:138648192-138648214 TGGAGTCAGCAAAAACAGGACGG + Intronic
1033280168 7:140000934-140000956 TAGAGTGAACAAGAAGATGAAGG - Intronic
1033845748 7:145429676-145429698 TAGTGTAAAAAAGAAAAGGAAGG + Intergenic
1034221056 7:149446553-149446575 TAGATTAAAAAAAAACTGGATGG - Intronic
1036550992 8:9814768-9814790 AAGAGAAAAGGAAAAGAGGAAGG - Intergenic
1037193610 8:16158621-16158643 TAGAGAAAAAAAAAAGAAGCAGG - Intronic
1037405229 8:18535454-18535476 AAGAGAAAACCAAAAGAGAAGGG + Exonic
1037481049 8:19306029-19306051 AAGAGAAAATAAAAATAGGACGG + Intergenic
1037903575 8:22702571-22702593 CAAAGTTAACATAAAGAGGAGGG - Intergenic
1037970638 8:23169279-23169301 TCGAGTGAACTAATAGAGGAAGG - Intergenic
1038186206 8:25277427-25277449 AACAGTAAAAAAAAAGAGGAAGG + Intronic
1038989347 8:32849256-32849278 TACAGTAATCAAAAAAAGTATGG - Intergenic
1039110510 8:34036376-34036398 TATAATAAAAAAAAAAAGGAAGG - Intergenic
1039182054 8:34878032-34878054 TAAAACAAACAAAAACAGGAAGG + Intergenic
1039593079 8:38767180-38767202 TTGAGAAAACAAAACTAGGAAGG + Intronic
1040364022 8:46695569-46695591 TAGAGTAAAGAGGAAGGGGATGG + Intergenic
1040483740 8:47851115-47851137 CAGAGTAAACATAAAGAAGTTGG - Intronic
1041033502 8:53762616-53762638 AAGAATAAACAAATAGATGATGG + Intronic
1041131424 8:54706261-54706283 AAAAGTAAACAAAAGGAGGTTGG - Intergenic
1041560315 8:59210244-59210266 TACAGTAACCAAAAATAGTATGG - Intergenic
1042199053 8:66262048-66262070 AACAGAAAACAAAAAGAGCAGGG + Intergenic
1042659106 8:71134220-71134242 CTGAGTAACCAAACAGAGGATGG + Intergenic
1042898235 8:73694514-73694536 TAGAGTAAAATTACAGAGGAGGG + Intronic
1043045257 8:75314999-75315021 GAGTGAAAGCAAAAAGAGGATGG + Intergenic
1043126730 8:76405774-76405796 TAGAGAGAAAAAAAAGGGGAGGG - Intergenic
1043310889 8:78858466-78858488 AAAAGTAAACAATAAAAGGATGG + Intergenic
1043587162 8:81782628-81782650 TAGACCAAAAAAAAGGAGGAGGG - Intergenic
1043722282 8:83559762-83559784 GAGAGAAAAGAAAAAAAGGAAGG - Intergenic
1044083994 8:87921155-87921177 CAGATAGAACAAAAAGAGGAAGG + Intergenic
1044152432 8:88798034-88798056 AAGAAGAAAGAAAAAGAGGAAGG - Intergenic
1044454097 8:92371845-92371867 TAGTGTAAAAAAAGAGAGAAAGG + Intergenic
1046191596 8:110802495-110802517 TATAGTAAAACAAAAAAGGATGG - Intergenic
1046361540 8:113164944-113164966 TAGAATAAACCAATGGAGGAAGG - Intronic
1046403172 8:113734610-113734632 TAAAGGAGAAAAAAAGAGGAGGG + Intergenic
1046971560 8:120229070-120229092 AAAAGAAAAAAAAAAGAGGAGGG - Intronic
1047116667 8:121849814-121849836 TACAGTAAACAAAAGGTAGATGG - Intergenic
1047857990 8:128933471-128933493 TCCAGTAAACAAAAAAAGGTAGG - Intergenic
1048630435 8:136236458-136236480 GAGAGTGAAGAGAAAGAGGAGGG - Intergenic
1048729546 8:137423042-137423064 TAGGGTAAAAGATAAGAGGATGG + Intergenic
1050102305 9:2131682-2131704 TAGAAAAAACAAAATGAGGCCGG + Intronic
1050399505 9:5236531-5236553 TAGCTTATATAAAAAGAGGAAGG - Intergenic
1050596180 9:7206583-7206605 TAAAGAAAAGAAAAAGAGGCTGG - Intergenic
1051051435 9:12936977-12936999 TATAATACACAGAAAGAGGATGG - Intergenic
1051317356 9:15855677-15855699 TATAGTAAAATAAAAGAGAAGGG - Intronic
1051475474 9:17503448-17503470 TAGAGGAACCAAAAAGGGTATGG - Exonic
1051918719 9:22238329-22238351 AAAAGGAAACAAAAAGAGGGGGG - Intergenic
1053228357 9:36382114-36382136 TAGAATCAACAAGGAGAGGAGGG - Intronic
1053608291 9:39682056-39682078 TAGAGTAAACAAAAATGGGTAGG - Intergenic
1053866131 9:42438416-42438438 TAGAGTAAACAAAAATGGGTGGG - Intergenic
1054245240 9:62660353-62660375 TAGAGTAAACAAAAATGGGTGGG + Intergenic
1054559368 9:66694884-66694906 TAGAGTAAACAAAAATGGGTGGG + Intergenic
1055203489 9:73696940-73696962 AAGAGGAGAGAAAAAGAGGAAGG + Intergenic
1056699978 9:88894857-88894879 TATAGTAACCAAAAACAGCATGG - Intergenic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1057465472 9:95310365-95310387 AAGAGAAAAAAAAAAAAGGAGGG + Intronic
1057477688 9:95417212-95417234 CAAAATAAACACAAAGAGGATGG + Intergenic
1058675680 9:107398280-107398302 TTGACTATACAAAAACAGGATGG + Intergenic
1059072036 9:111147907-111147929 TTGCATAAACAAAAAGAGGATGG + Intergenic
1059185015 9:112260322-112260344 TAAAGAAAACAAAAATAGAAGGG + Intronic
1059372569 9:113854597-113854619 GAGAGAAAAAAAAAAGAAGAGGG + Intergenic
1059602613 9:115796588-115796610 GAAAGAAAACAAAAAAAGGAAGG + Intergenic
1059869500 9:118556133-118556155 TAGAGTAGAGAAGAAGAGTAAGG + Intergenic
1060683363 9:125585527-125585549 TAGAGCAGCCAAAAAGAGAATGG + Intronic
1061114742 9:128602511-128602533 TTGAGTAAAGAACAAGAGGAAGG - Intronic
1061463514 9:130759510-130759532 TAAAGTAAACATAAACAGCAAGG + Intronic
1185812028 X:3119368-3119390 TAGAAGAAACAAAAATAGGCTGG - Intergenic
1185855246 X:3528268-3528290 AAGAGAAAAAAAAAAAAGGACGG + Intergenic
1185975088 X:4711224-4711246 TTGAGTAAAGAAATGGAGGAGGG + Intergenic
1186318590 X:8398964-8398986 TATAAGAAGCAAAAAGAGGACGG - Intergenic
1186556152 X:10560978-10561000 TACAGTAACCAAAAACAGCAGGG + Intronic
1186640906 X:11454387-11454409 CAGAGTAAAGAAAAAGAGAAAGG + Intronic
1186665609 X:11713824-11713846 TTGAGTAAACTAAGAGAGGAGGG - Intergenic
1186829122 X:13372995-13373017 TGGAGTAAACAAAAACAGCCCGG - Intergenic
1187048095 X:15668284-15668306 TAGAGTAAAGAAGAAGACAAGGG - Intergenic
1187269212 X:17764857-17764879 TAGAGTGGTAAAAAAGAGGATGG - Intergenic
1187946652 X:24432694-24432716 AAGCGTAAACAAAAAGACAATGG + Intergenic
1188091639 X:25971592-25971614 TTGAGTAAACAAAAAAATTAAGG + Intergenic
1188119299 X:26285125-26285147 AATAGAAAGCAAAAAGAGGAAGG - Intergenic
1188472261 X:30553942-30553964 AAGAGGAAAAAAGAAGAGGAAGG + Intergenic
1188558533 X:31440489-31440511 AAGAGGAGACAAAAAGAGCATGG + Intronic
1188747262 X:33861497-33861519 GAGAGAGAACATAAAGAGGAGGG + Intergenic
1188906369 X:35796976-35796998 TAGAGTACACAGAAATCGGAGGG + Intergenic
1189439874 X:41025752-41025774 TAAAGTAAAAAAAAAAAGCAAGG - Intergenic
1189933811 X:46043513-46043535 TAGAGCAAAAAGGAAGAGGAAGG + Intergenic
1190734315 X:53245729-53245751 TAGAATAAGCAAAAAGAGCAAGG + Intronic
1190914421 X:54799989-54800011 TAGAGAAAACAAAACAATGAAGG + Intergenic
1192836010 X:74800407-74800429 TAAAGTAAATAAAAATAGGATGG - Intronic
1192935394 X:75853463-75853485 TACAGTAACCAAAAACAGCATGG - Intergenic
1193126206 X:77873060-77873082 AAGAGTATACAAAAATAGCAGGG - Intronic
1193396939 X:80996042-80996064 TAGAGTAACCAAAAACAGCATGG + Intergenic
1194732767 X:97474988-97475010 TAGATTAAACCAAAAGTGGAGGG - Intronic
1194940947 X:100009472-100009494 TAGGGAAAATAAAAAGATGAGGG - Intergenic
1195040204 X:101007165-101007187 TAGAGTAAACCAGAAGAGTTAGG + Intergenic
1195134167 X:101887096-101887118 TGGGGCAAACAAAAAGAGGCTGG - Intronic
1195268462 X:103207091-103207113 AATAGTAACCAAAAAGAGGTGGG - Intergenic
1195786977 X:108536313-108536335 TTCAGTTAACAAAAATAGGAAGG - Intronic
1196063492 X:111437121-111437143 TAGACTAAAAAAAAAGAGCCAGG + Intergenic
1197562517 X:128041009-128041031 TAGCGTACACAAAGAGAGGAGGG - Intergenic
1197607672 X:128604464-128604486 TGGGGTAAACAAAATGATGAGGG - Intergenic
1197877117 X:131122198-131122220 AAGAGAAAACAAAGAGAGGGAGG - Intergenic
1198086470 X:133287190-133287212 TCGAGAAAAAAAAAAAAGGACGG + Intergenic
1198161995 X:134017224-134017246 GAGAGAAAAGAAAAAGAGGCTGG - Intergenic
1198756466 X:139987554-139987576 TGGACTAAACAGAAAGAGAAAGG - Intergenic
1199104326 X:143844436-143844458 TAGCTAAAATAAAAAGAGGAAGG - Intergenic
1199292207 X:146117762-146117784 TACAGTAACCAAAAAAAGTATGG + Intergenic
1199704886 X:150415509-150415531 TTGCATAAGCAAAAAGAGGAAGG + Intronic
1199934255 X:152555753-152555775 TATAGAAAATAAAATGAGGAGGG + Intergenic
1199986379 X:152954950-152954972 TAGATTAAAAAAAAGGTGGAGGG + Intronic
1200381240 X:155839235-155839257 TATAGTAACCAAAAACAGCATGG + Intergenic
1200494021 Y:3859083-3859105 AAGAGTCAACAGACAGAGGAAGG + Intergenic
1200725187 Y:6661221-6661243 GAGAGAAAAAAAAAACAGGATGG - Intergenic
1201269277 Y:12238919-12238941 TAGAAGAAACAAAAATAGGCTGG + Intergenic
1201517686 Y:14835574-14835596 GAGAGAAAAGAAAGAGAGGAAGG + Intronic
1201697401 Y:16841015-16841037 TAGAGTAAAGAAGGAGAGAAAGG + Intergenic
1201701460 Y:16886852-16886874 TTGAGTAAAGAAATGGAGGAAGG - Intergenic
1201724176 Y:17135510-17135532 GAGAGTAAAAAGAGAGAGGAAGG + Intergenic