ID: 1184043465

View in Genome Browser
Species Human (GRCh38)
Location 22:41957999-41958021
Sequence CTGCAGAGGGATAGCGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 287}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184043465_1184043480 19 Left 1184043465 22:41957999-41958021 CCCTCCACGCTATCCCTCTGCAG 0: 1
1: 0
2: 1
3: 17
4: 287
Right 1184043480 22:41958041-41958063 GGCCCCAGGTGCGCTGGCAGTGG 0: 1
1: 0
2: 1
3: 27
4: 306
1184043465_1184043485 25 Left 1184043465 22:41957999-41958021 CCCTCCACGCTATCCCTCTGCAG 0: 1
1: 0
2: 1
3: 17
4: 287
Right 1184043485 22:41958047-41958069 AGGTGCGCTGGCAGTGGAGGTGG 0: 1
1: 0
2: 9
3: 41
4: 414
1184043465_1184043474 5 Left 1184043465 22:41957999-41958021 CCCTCCACGCTATCCCTCTGCAG 0: 1
1: 0
2: 1
3: 17
4: 287
Right 1184043474 22:41958027-41958049 GCCCTCCCGACAGAGGCCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 234
1184043465_1184043486 26 Left 1184043465 22:41957999-41958021 CCCTCCACGCTATCCCTCTGCAG 0: 1
1: 0
2: 1
3: 17
4: 287
Right 1184043486 22:41958048-41958070 GGTGCGCTGGCAGTGGAGGTGGG 0: 1
1: 0
2: 1
3: 28
4: 309
1184043465_1184043483 22 Left 1184043465 22:41957999-41958021 CCCTCCACGCTATCCCTCTGCAG 0: 1
1: 0
2: 1
3: 17
4: 287
Right 1184043483 22:41958044-41958066 CCCAGGTGCGCTGGCAGTGGAGG 0: 1
1: 0
2: 1
3: 24
4: 387
1184043465_1184043479 13 Left 1184043465 22:41957999-41958021 CCCTCCACGCTATCCCTCTGCAG 0: 1
1: 0
2: 1
3: 17
4: 287
Right 1184043479 22:41958035-41958057 GACAGAGGCCCCAGGTGCGCTGG 0: 1
1: 0
2: 1
3: 17
4: 270
1184043465_1184043472 -2 Left 1184043465 22:41957999-41958021 CCCTCCACGCTATCCCTCTGCAG 0: 1
1: 0
2: 1
3: 17
4: 287
Right 1184043472 22:41958020-41958042 AGCCTGGGCCCTCCCGACAGAGG 0: 1
1: 0
2: 3
3: 29
4: 225
1184043465_1184043487 27 Left 1184043465 22:41957999-41958021 CCCTCCACGCTATCCCTCTGCAG 0: 1
1: 0
2: 1
3: 17
4: 287
Right 1184043487 22:41958049-41958071 GTGCGCTGGCAGTGGAGGTGGGG 0: 1
1: 0
2: 4
3: 48
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184043465 Original CRISPR CTGCAGAGGGATAGCGTGGA GGG (reversed) Intergenic
900097004 1:943885-943907 CTGCAGAGAGATGGCCTGGTGGG - Intronic
900159159 1:1215350-1215372 CTGGAGAGGGAGGGAGTGGAGGG + Intergenic
900547282 1:3236032-3236054 CTGGAAAGGGATAGCATGGCGGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
902700281 1:18167656-18167678 CAGCAGAAGGAAAGGGTGGACGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904260806 1:29286616-29286638 CTGGAGAGGGCTATAGTGGAGGG + Intronic
904382318 1:30119780-30119802 CTGGAGAGGAATAGCATGCAGGG + Intergenic
904443379 1:30547699-30547721 CTGTCGAGGGGTAGTGTGGAGGG + Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904913784 1:33954874-33954896 CTGGAGATGGATGGCGGGGATGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907636115 1:56136040-56136062 CTGCAGAGAGATTGGCTGGAGGG + Intergenic
908326426 1:63028262-63028284 CAGCACAGGGACAGTGTGGAGGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
911012376 1:93294627-93294649 GTGCAGTGGGAAAGTGTGGATGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915004647 1:152624441-152624463 GGGCAGAGGGGTAGAGTGGAGGG + Intergenic
915733663 1:158071255-158071277 AGGCAGAGGGAGAGCGAGGAGGG - Intronic
917646341 1:177032542-177032564 CTGCAGAGGGAGTGCATGAACGG - Exonic
918135066 1:181664737-181664759 CTGCAGAGGTATGGCGGGGGTGG + Intronic
919803815 1:201369037-201369059 AAGCAGAGGGCTAGCGAGGAAGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922751138 1:228070539-228070561 CTGTAGAGGGATAGTGTATAGGG + Intergenic
922751446 1:228071936-228071958 GTGTAGAGGGATAGTGTAGAAGG + Intergenic
922849145 1:228717521-228717543 CTGGAGAGGGATAGGTAGGATGG + Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063121797 10:3109803-3109825 CTGCAGAAGGACAGAGTGCAGGG + Intronic
1064075399 10:12264654-12264676 CTCCCGAGGGACAGCGTGGGAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064293389 10:14055408-14055430 CAGCATAGGGATAGAGTGCAGGG - Intronic
1065240233 10:23696244-23696266 CTGCAGAGGGCAGGCGAGGACGG + Intronic
1065655920 10:27949751-27949773 CTGGAGGGGGCAAGCGTGGATGG + Intronic
1065988638 10:30983413-30983435 CTGAAGAGGAATAGTGTGAAGGG + Intronic
1066303225 10:34115208-34115230 GTGCAGAGACACAGCGTGGAGGG + Intronic
1066369649 10:34809627-34809649 CTGCAGAGGGAGTGGCTGGAAGG + Intronic
1066806300 10:39258881-39258903 CTGCAAAGGGATATTTTGGAGGG - Intergenic
1066932595 10:41783141-41783163 CTGCAAAGGGATATTTTGGAGGG + Intergenic
1067160217 10:43819265-43819287 CTGGAGGCGGATAGGGTGGAGGG + Intergenic
1067758837 10:49027575-49027597 CTGCAGAGGGGTGGCATGCAGGG - Intronic
1068695676 10:59965833-59965855 TGGCAGAGGGTTAGAGTGGATGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069873555 10:71547825-71547847 CTGCAGAGGCATCAAGTGGACGG + Intronic
1070586049 10:77767115-77767137 TTGGAGAGGGATACAGTGGATGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073048823 10:100655087-100655109 CTGCAGAGAGAAAGAGGGGAGGG - Intergenic
1074756494 10:116627740-116627762 CTGCGGAGGGATAGCGTGTCAGG - Intronic
1075002467 10:118808698-118808720 CAGCAGAGGGGCAGGGTGGAGGG - Intergenic
1075551946 10:123399566-123399588 TTGCAGAGGGCTTGCCTGGAGGG - Intergenic
1076242896 10:128923253-128923275 CGCCCGAGGGATAGTGTGGAGGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1079126747 11:17722716-17722738 CTGCAAAGAGATAGCATAGAAGG + Intergenic
1079411397 11:20191175-20191197 CTGCAGAGGGGTGGCGGGGGAGG + Intergenic
1082149385 11:48715462-48715484 CTGCAGAGGGATATTTTGTAGGG - Intergenic
1084470171 11:69354855-69354877 CTGTAGAGGGATAGAGTAGAAGG + Intronic
1084477707 11:69398410-69398432 CTGAAGAGGGATCCCGAGGAGGG - Intergenic
1084641706 11:70430174-70430196 CTGCAGAGGGAGAGGAGGGAAGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085524515 11:77156637-77156659 CTGCAGAGGGAGGGAGTGGCAGG - Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088952391 11:114584887-114584909 CTGCAGAGGGATAGGTGGCAAGG - Intronic
1089185607 11:116612695-116612717 CTGCCATGGGAAAGCGTGGAAGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091112882 11:132987060-132987082 GTGAAGAGGGAGAGCGTGGATGG - Intronic
1091130963 11:133146971-133146993 CTGCAGAGGGGAAGCTTGCAGGG - Intronic
1091608641 12:1982299-1982321 CTGGAGATGGATAGCGGTGATGG - Intronic
1091663711 12:2403357-2403379 CTGCAGAGGGATGGCGTTGGAGG + Intronic
1091776720 12:3189469-3189491 CTACAGAGGGAGAGGGTGCAGGG + Intronic
1091919152 12:4290406-4290428 CTCCAGAGGAAAATCGTGGACGG + Intronic
1092405351 12:8218190-8218212 CTGCAGAGGGATGGGCTGGCAGG - Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092477157 12:8829011-8829033 CTGCTGGGGGATGGCGGGGAGGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094877125 12:34661624-34661646 CTGCAAAGGGATATTTTGGAGGG + Intergenic
1098178309 12:67817673-67817695 CTACAGAGGAATAGCCTGTAAGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1101410338 12:104462489-104462511 CTGCAAAGGGGTAGGGTGGGAGG - Intronic
1102216675 12:111166687-111166709 CTGCAGAGGCTAAACGTGGAAGG + Intronic
1102541212 12:113620620-113620642 CTGCAGTGAGATAGCGGTGATGG - Intergenic
1104970345 12:132528092-132528114 CTCCAGAGGGAAAGCGGGCACGG - Intronic
1105401627 13:20101170-20101192 CTGCAGATGGATAGTGGTGATGG + Intergenic
1105541753 13:21321857-21321879 CTGAAGATGGATGGTGTGGATGG + Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1117422979 14:55565850-55565872 CTGCAGAGGGGTAGAGAGCAAGG + Intronic
1121676784 14:95760039-95760061 TTGCAGAGGGATGGGGAGGAAGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126847073 15:52770163-52770185 CTGCAGTGGGAGAGACTGGAAGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128214134 15:65922679-65922701 CTGCAGAGGGAGAGACTAGAGGG + Intronic
1129351731 15:74959292-74959314 CTGCAGAGGGAGCGCGGGAAGGG - Intronic
1129660247 15:77549288-77549310 CTGCTGCGGGATACCGTGGAAGG - Intergenic
1129924494 15:79350786-79350808 CTGCTGAGGGAGAGCATGGCTGG + Intronic
1130025844 15:80269750-80269772 CAGCAGAGGGAGAGCTGGGATGG - Intergenic
1130302732 15:82692376-82692398 CTGCGGGGGGATTGCGGGGAGGG - Intronic
1131385942 15:92007501-92007523 CTGAATAGGGATAGTGTGGAAGG + Intronic
1132119350 15:99163279-99163301 ATGGAGAGGGATATAGTGGAAGG + Intronic
1133092753 16:3417337-3417359 CTGCAGAGGGTTGGGGTGGCAGG + Intronic
1133116372 16:3580048-3580070 CTCCAGAGGGAAAGGGTTGAAGG - Intergenic
1133222456 16:4324558-4324580 CTGCAGTGGCATAGAGGGGATGG + Intronic
1133467405 16:6041110-6041132 CTGCAGGGGGAGAGCAGGGAGGG - Intronic
1134761807 16:16721097-16721119 ATGCCGGGGGAGAGCGTGGATGG + Intergenic
1134984251 16:18638073-18638095 ATGCCGGGGGAGAGCGTGGATGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137596194 16:49725648-49725670 CTGCAGAGGGCCAGCAGGGAGGG + Intronic
1139370454 16:66465586-66465608 CTGGAGATGGATAGTGTTGATGG - Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1142348794 16:89570595-89570617 GTCCAGAGGGTTAGCGTGGTGGG + Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1144443819 17:15308461-15308483 CTGCAGATGGATGGCGGTGACGG - Intronic
1144590683 17:16521070-16521092 AGGCAGAGGGATGGGGTGGAGGG + Intergenic
1144625268 17:16841168-16841190 CGGCAGAGGGATGGGATGGAAGG - Intergenic
1144881161 17:18431553-18431575 CGGCAGAGGGATGGGATGGAAGG + Intergenic
1145151071 17:20512833-20512855 CGGCAGAGGGATGGGATGGAAGG - Intergenic
1146162424 17:30567089-30567111 CGGCAGAGGGATGGGATGGAGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147579423 17:41619867-41619889 CGGCAGAGGGATGGGATGGAAGG - Intronic
1147836753 17:43338319-43338341 CTGTGGAGGGATAGGGTTGAGGG + Intergenic
1149326079 17:55531062-55531084 CTTCAGAAGGATGGCTTGGAAGG - Intergenic
1149514912 17:57273720-57273742 CTGCAGAGGGGCCGCTTGGAGGG - Intronic
1151499231 17:74478250-74478272 CAGCAGAGGTATAGCCAGGAGGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152207046 17:78979867-78979889 CTGCAGAGGGATCCTGTGGCTGG - Exonic
1152288404 17:79425306-79425328 CTGCAGAGGGTTACTGCGGAGGG - Intronic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1157593113 18:48847998-48848020 CCGCAGAGGCACAGGGTGGATGG + Intronic
1159523394 18:69556235-69556257 CTGCAAGGGGCCAGCGTGGAGGG - Intronic
1160932638 19:1577938-1577960 CTGTAGAGGACGAGCGTGGAGGG + Exonic
1161585071 19:5101599-5101621 ATGCAAGGGGATAGCGGGGAGGG + Intronic
1162330169 19:10023259-10023281 CTGGAGATGGATAGCGGTGATGG + Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1164392049 19:27832482-27832504 ATGCAGAGGGATTGGGTGGTTGG - Intergenic
1165007223 19:32817210-32817232 CTGGAGATGGATAGCGATGATGG - Intronic
1165394958 19:35558915-35558937 CTGAAGAGGGATAGGGAGGTAGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166386044 19:42381919-42381941 CGGCAGAGGGCTGACGTGGAGGG - Intergenic
1167584870 19:50368651-50368673 CTGCAGACGGAAAGCGTGCGGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167955218 19:53058538-53058560 CTGCAGAGGGACCGCGGGGGCGG + Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168112542 19:54201627-54201649 CAGCAGAGGGATGGGGTGCAGGG + Intronic
1168204426 19:54839287-54839309 ATGAAGAGAGATAGGGTGGAGGG + Intronic
1168524024 19:57074535-57074557 CTGCAGGGGGAGAGAGTGGGCGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925810544 2:7695860-7695882 ATGCAGAGTAATAGAGTGGAAGG + Intergenic
927464015 2:23323690-23323712 CTGCAGAGGAACAGGGAGGAAGG + Intergenic
927576876 2:24207818-24207840 CTGCAAAGGGAGAGGGTGGATGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929937091 2:46300805-46300827 CAGTACAGGGCTAGCGTGGAAGG + Intronic
930341671 2:50123831-50123853 CTTCAGATGGATATTGTGGAAGG + Intronic
934576004 2:95402128-95402150 CTGCAGAGGGCAGGCGTGTAGGG - Intergenic
934638182 2:96009985-96010007 CTGCAGAGGGCAGGCGTGCAGGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940177156 2:150890992-150891014 CTGGAGAGGGATGGCGGTGATGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940854796 2:158721701-158721723 CTGGAGATGGATAGTGTTGATGG + Intergenic
942405121 2:175646181-175646203 CTTCAGAGGGAAAGCATCGAGGG + Intergenic
942898411 2:181086033-181086055 CTGTAGAGGAATAGAGAGGATGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
947815816 2:233035292-233035314 CTCCATAGGGAAGGCGTGGAGGG + Intergenic
947910529 2:233798122-233798144 CTGGAGAGGGCTGGTGTGGATGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1172884588 20:38222627-38222649 TTGCAGAGGGAGAGTGGGGATGG - Intronic
1174290940 20:49508065-49508087 CTGCAGAGAGATGGCATGGAAGG + Intronic
1175158224 20:56988547-56988569 CTGCAGAGGGACAGTGTGGGAGG - Intergenic
1175813544 20:61872013-61872035 CTGCAGAGGGAGGGCGAGGTGGG + Intronic
1175943159 20:62547176-62547198 CTGCTGAGGGTGAGGGTGGAGGG - Intergenic
1176975116 21:15312245-15312267 CAGGAGAGAGAGAGCGTGGAGGG - Intergenic
1178194978 21:30334350-30334372 CTGTAGAGGGATAGGATTGACGG - Intergenic
1180223648 21:46376082-46376104 CTGCAGACGGAGAGGGTAGAGGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181643832 22:24219736-24219758 CTGCGGAGGGATAGAGGGGCCGG + Exonic
1181765198 22:25086645-25086667 CTGCAGTGGGGTTGGGTGGATGG - Intronic
1182508655 22:30803193-30803215 CGGAAGAGGGATGGGGTGGACGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182823198 22:33237075-33237097 CTCCAGAGGGATATAGTGGAAGG - Intronic
1183410726 22:37653756-37653778 CTGCAGAGGGAAGGAGAGGATGG - Intronic
1183653551 22:39172262-39172284 CTGCAGTGGGAGATGGTGGATGG + Intergenic
1183751084 22:39720800-39720822 CTGCAGAGGGGTAGTGATGATGG + Intergenic
1184043465 22:41957999-41958021 CTGCAGAGGGATAGCGTGGAGGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184275258 22:43406223-43406245 GGACAGAGGGATAGCGAGGAGGG - Intergenic
1185022294 22:48384361-48384383 CTGCCGAGGGTTAGTGGGGATGG + Intergenic
1185377449 22:50488813-50488835 CTGCAGAGGGACAGGAGGGATGG - Intronic
1185377470 22:50488881-50488903 CTGCAGAGGGACAGGAGGGACGG - Intronic
1185377514 22:50489017-50489039 CTGCAGAGGGACAGGAGGGACGG - Intronic
953713823 3:45298448-45298470 CTGCAGGCTGATAGCGTTGAAGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954782759 3:53073173-53073195 CTGCAGAGAGAGAGCCTGGTGGG + Intronic
957626814 3:82663620-82663642 GTGCAGTGTGATAGCCTGGATGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959685863 3:109145534-109145556 CTGGAGATGGATAGCGGTGATGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961473887 3:127135294-127135316 CTGCAGAGGCACCGCGTGCATGG - Intergenic
963116410 3:141733778-141733800 CTGCAGAGGGGTGCCGGGGATGG + Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964952890 3:162318013-162318035 CTGCTGATGGATGGCGTGGGAGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967540775 3:190665139-190665161 CTGGAGAAGGATAGGGCGGATGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969651256 4:8469604-8469626 CTGGAGATGGAGAGCGGGGATGG + Intronic
969760767 4:9179781-9179803 CTGCAGAGGGATGGGCTGGCAGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
975378337 4:73670561-73670583 CTGTGGAGGGATAGGGTTGAGGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978363217 4:107952965-107952987 CTGCAGAGGAACTGAGTGGATGG + Exonic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984982721 4:185298625-185298647 ATGCAGAGAGACAGGGTGGAAGG - Intronic
988849154 5:35161361-35161383 TTGCAAAGGGATAGGTTGGATGG + Intronic
989165378 5:38428678-38428700 CTGCAGAGAGGCAGTGTGGAGGG - Intronic
989579351 5:43017509-43017531 GGGCAGAGGGATGGTGTGGAAGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
989779761 5:45249939-45249961 CTGCAGGGGGAAAGTGGGGATGG - Intergenic
989833483 5:45951693-45951715 CTGCAGAGGGAAAGTTGGGAGGG + Intergenic
989838861 5:46033381-46033403 CTGCAAAGGGATATTTTGGAGGG + Intergenic
990573243 5:57100175-57100197 CTGAAGAGGGATAGTGAGAATGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991870803 5:71107848-71107870 CTGGAGATGGATAGCGGTGATGG + Intergenic
992023977 5:72652777-72652799 CTGCAGAGGCATATCCAGGAGGG - Intergenic
992462532 5:76974938-76974960 CTGCAGAGGGATTGAGTACATGG - Intronic
994591389 5:101777601-101777623 CTGCAGAGAGATAGAATGGGGGG - Intergenic
998933776 5:147211894-147211916 TTGCATATGGATAGCTTGGATGG + Intergenic
1003410403 6:5856936-5856958 CTGAAGATGGATGGTGTGGATGG - Intergenic
1004532880 6:16470308-16470330 CTGCCGGGGGCTAGGGTGGAGGG + Intronic
1004878005 6:19975367-19975389 CTGCAGAGGGCTAGTGGGGAGGG - Intergenic
1005017796 6:21390603-21390625 CTGGAGAGTGATTGAGTGGAGGG - Intergenic
1005048843 6:21665833-21665855 CTCCAGAGGGACAGCGTGGGTGG + Intergenic
1005303987 6:24496090-24496112 CTTCAGAGGGAGAGCTTTGAAGG - Intronic
1005633854 6:27734638-27734660 CTGGAGATGGATAACGGGGATGG - Intergenic
1008408459 6:51145151-51145173 AGGCAGAGGGATAGATTGGATGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1013431945 6:110063455-110063477 CTCCAGGGGGATGGGGTGGAGGG + Intergenic
1017516889 6:155164541-155164563 CTGCCGAGGGCCAGCTTGGAGGG - Exonic
1017846949 6:158266890-158266912 CTGGAGATGGATAGCGATGATGG - Intronic
1017881899 6:158567877-158567899 CTGGAGAGGGATTGTGGGGAAGG + Intronic
1018762715 6:166905527-166905549 CTGAAGAGGGATAGGGGGGCTGG + Intronic
1019340447 7:506591-506613 CTGCAGGGGTCTAGCCTGGACGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019621443 7:1994395-1994417 CAGCACAGGGATTGCTTGGAAGG + Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019779239 7:2929857-2929879 CTGCAGGGGGAGAGGGTGGTGGG + Intronic
1021425508 7:20495526-20495548 CTGCACAGGGATACTGTGCACGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1023115148 7:36855240-36855262 CTGCAGAGGGCTAGGATGGAAGG + Exonic
1024934381 7:54698111-54698133 CTGCAGAGGCTTGGGGTGGACGG + Intergenic
1025522968 7:61764018-61764040 CTGCAAAGGGATATTCTGGAGGG - Intergenic
1025546721 7:62183045-62183067 CTGCAAAGGGATATTCTGGAGGG - Intergenic
1025574038 7:62612372-62612394 CTGCAAAGGGATATTTTGGAGGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026909203 7:74082979-74083001 GGGCAGAGGGATGACGTGGAAGG + Intronic
1027147333 7:75705101-75705123 CTGCCGATGGATAGCGGTGATGG - Intronic
1029290415 7:99498351-99498373 CTGGAGAAGGATAGAGGGGAAGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034087019 7:148330448-148330470 GAGCAGAGGGATGGAGTGGATGG + Intronic
1034225319 7:149476970-149476992 CTGAAGAGGGATGGTGGGGAGGG + Exonic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035970732 8:4245331-4245353 CTGCAGAGGGTTGGGGTGGGAGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1042430813 8:68704311-68704333 ATGCAGAGGGATGGCGTGGTGGG + Intronic
1043101672 8:76055037-76055059 CTGCAAAGAGATAATGTGGAAGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1049418983 8:142508541-142508563 CTGCTCAGGGAGAGGGTGGAAGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1052344626 9:27396865-27396887 ATGAAGAGGGTTAACGTGGATGG - Intronic
1055572498 9:77631837-77631859 CTGCAGCAGGAAAGCGTGGCTGG + Intronic
1056934194 9:90903355-90903377 CTGCAGAGGGACAGGTTTGAGGG - Intergenic
1060520068 9:124289319-124289341 CTGCAGAGGCAGAGCTTGGATGG - Intronic
1060732703 9:126048350-126048372 CTGCAGAGGCACAGAGGGGAGGG + Intergenic
1061237654 9:129351924-129351946 CTGCAGAAGGAAGGCGGGGAGGG - Intergenic
1062234958 9:135503346-135503368 ATGCAGAGGGGTGGCCTGGATGG + Intronic
1062401952 9:136376679-136376701 CACCAGAGGGATGGCTTGGATGG - Intronic
1203792915 EBV:161123-161145 CTCCAGCGGGATAGAGTGGACGG - Intergenic
1203387948 Un_KI270438v1:71988-72010 ATGGAGAGGAATAGAGTGGAAGG + Intergenic
1185691778 X:2161022-2161044 CTGCAGATGGATGGTGTTGATGG + Intergenic
1187393014 X:18897883-18897905 CTGCAGTGGGAGAGCTTTGAGGG + Intronic
1188254390 X:27942514-27942536 CTGGAGGGGGATGGCGAGGAAGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1192580777 X:72279119-72279141 CTGCTGAGGGGTAAAGTGGATGG - Intronic
1192800825 X:74463111-74463133 CTGCAGAGGGAGAGGATGGATGG + Intronic