ID: 1184047232

View in Genome Browser
Species Human (GRCh38)
Location 22:41979020-41979042
Sequence GTGGCTTGTTAGCATGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 3, 3: 5, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184047224_1184047232 10 Left 1184047224 22:41978987-41979009 CCTGCACACATTTACTGTACTTG 0: 1
1: 0
2: 2
3: 8
4: 162
Right 1184047232 22:41979020-41979042 GTGGCTTGTTAGCATGTGACTGG 0: 1
1: 0
2: 3
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184047232 Original CRISPR GTGGCTTGTTAGCATGTGAC TGG Intronic
906840996 1:49139123-49139145 GTGGCCTGGTAGGAGGTGACTGG - Intronic
908644115 1:66258641-66258663 GGGGGTTGTTAGCAAGTCACTGG - Intronic
910764246 1:90764931-90764953 GTGGATTGTGAGCATCTGATGGG - Intergenic
913215967 1:116620659-116620681 CTAACTTGCTAGCATGTGACTGG + Intronic
919189868 1:194202793-194202815 GTGGCTTGTTACACAGTGACAGG - Intergenic
919283077 1:195517654-195517676 GGGGCCTGGTAGCAGGTGACTGG + Intergenic
919341372 1:196311833-196311855 GTGGCTGTTTGGCATGTCACTGG - Intronic
924461626 1:244264946-244264968 ATGGCATGTGAGCATGTGAAGGG + Intergenic
1062819180 10:521445-521467 GAGACTTGTAAGCATGTGCCTGG - Intronic
1062839915 10:662097-662119 GTGGCTTCCTAGTATCTGACAGG + Intronic
1066698259 10:38097684-38097706 ATGGGTTGTTAGGATGTGGCAGG + Intronic
1066994255 10:42549478-42549500 ATGGGTTGTTAGGATGTGGCAGG - Intergenic
1075502771 10:122992222-122992244 GTGGCTTTCTAGCATCTGAAAGG + Exonic
1077957928 11:7040690-7040712 GTGGCTTGTTAGAATGTGGCTGG - Intronic
1084776253 11:71378565-71378587 GGGGCTTGGTAGGAAGTGACTGG + Intergenic
1086829570 11:91543508-91543530 GTGGCTTGTTGGGAGGTGAGGGG - Intergenic
1087641967 11:100764664-100764686 GGGGCTTGTAAGAATGTGAAAGG + Intronic
1089460159 11:118648340-118648362 GTGGGTTGTAAGGATGTGGCAGG + Intronic
1090273576 11:125404441-125404463 GTGGCTTGTTTACATGTGCTTGG + Intronic
1091117729 11:133030326-133030348 GGGGTTTGTGAGCATGTGGCAGG - Intronic
1091150950 11:133327249-133327271 GTGAGTTGTTAGCAGGTGAGGGG + Intronic
1091965517 12:4737768-4737790 GGGGTTTGTTATCATGGGACTGG + Intronic
1093484675 12:19640286-19640308 CTGGCTTGCTGGCATGTGGCTGG + Intronic
1096080350 12:48828551-48828573 GAAGCTTCTTAACATGTGACAGG + Exonic
1098113750 12:67152725-67152747 GGGGAGTGTTTGCATGTGACTGG + Intergenic
1101611636 12:106298020-106298042 TTGTCTTTTTAGTATGTGACAGG + Intronic
1105219702 13:18314138-18314160 CTAACTTGCTAGCATGTGACTGG + Intergenic
1105318964 13:19298641-19298663 GTTGCTTTTTGGCATTTGACTGG - Intergenic
1105725027 13:23154959-23154981 GTGGCTGGGTAGCAGGTGGCTGG + Intergenic
1106310582 13:28550488-28550510 GTGACATGTGAGCATGTGAGTGG + Intergenic
1107051121 13:36050960-36050982 ATGGCTTGTTGACATGTCACTGG - Intronic
1107480613 13:40782819-40782841 GTTGCCTGTGAGGATGTGACAGG + Intergenic
1115568213 14:34643265-34643287 GTGGCTTGTTTGTTTGAGACAGG + Intergenic
1129582678 15:76829665-76829687 GTACCTTTTTAGCATATGACTGG + Intronic
1130190400 15:81729835-81729857 GTGGTATGTTAGGATGTGTCGGG + Intergenic
1134467802 16:14494783-14494805 GTGGCTTGTTAGGATGGAAGAGG + Intronic
1136546001 16:30955066-30955088 GGCCCTTGTTAGCATCTGACAGG - Intronic
1138191846 16:55019743-55019765 GTGGGGTGTGAGTATGTGACTGG - Intergenic
1142703931 17:1682346-1682368 GTGGCTTCTCTGCATGGGACAGG - Intronic
1144930653 17:18856293-18856315 GTCACATGTTGGCATGTGACTGG - Intronic
1147213734 17:38887133-38887155 GAGGCTGGTTAGCATTTGATGGG - Intronic
1154226663 18:12511249-12511271 GTGGCCTGTTAGGAAGTGAGCGG + Intronic
1156278641 18:35610347-35610369 TTGGCTTGTTAGCAAGTGACTGG - Intronic
1158695400 18:59698535-59698557 GTGGCTTGTTCACAAGTGACCGG + Intergenic
1167321231 19:48798342-48798364 GAGGCTTGTTAGCAGCTGAGGGG - Intronic
1168402852 19:56095892-56095914 GTGTGGTGTTAGCATCTGACTGG - Intronic
1168542325 19:57223422-57223444 ATGGCTGGTTTGCATGTGACAGG + Intergenic
926921645 2:17946307-17946329 GTGGCTTCTGGGCATCTGACTGG - Intronic
929518276 2:42624115-42624137 GTTGCTTTTTAGGATGTTACTGG + Intronic
932403284 2:71496671-71496693 GTGGCTGGTTTGCATATGAAAGG + Intronic
938068087 2:128292601-128292623 GTGGCATGTGGGCATGTGAGTGG + Intronic
942045726 2:172098217-172098239 GTGAGTTGTTACCATGTGCCAGG + Intergenic
942214897 2:173709160-173709182 TTGCCTTCTTAGCAGGTGACAGG - Intergenic
946291705 2:218750276-218750298 GTGGCATGGTAGCATGTTAGTGG - Intronic
1169350534 20:4864626-4864648 GTGACTTGTTAGACTGGGACAGG + Intronic
1169923911 20:10763308-10763330 ATGCCTAGTTAGGATGTGACTGG + Intergenic
1174262595 20:49307400-49307422 GTCGTTTGTGGGCATGTGACAGG + Intergenic
1175597923 20:60250215-60250237 GTGGGCTCTTGGCATGTGACAGG + Intergenic
1184047232 22:41979020-41979042 GTGGCTTGTTAGCATGTGACTGG + Intronic
1184960943 22:47927989-47928011 GTGGCTTGTTACTATTTGTCAGG - Intergenic
950816620 3:15710464-15710486 ATGGATTGTGAGCATGTGACTGG - Intronic
951472056 3:23067243-23067265 GGGGCCTGGTAGAATGTGACTGG + Intergenic
955849377 3:63203662-63203684 GTGTCTAGGTAGCATGTGAGAGG - Intergenic
961078175 3:124001072-124001094 GTAGCTTGTAAGCATTTGAGGGG - Intergenic
961305342 3:125955700-125955722 GTAGCTTGTAAGCATTTGAGGGG + Intergenic
963326297 3:143866871-143866893 TTGACTTGTTAGCAAGTGCCTGG - Intergenic
969617957 4:8264820-8264842 GTGGCCAGGTAGCATGGGACGGG + Intergenic
971250233 4:24968309-24968331 GAGGCTTGTGAGAGTGTGACAGG + Intronic
972116325 4:35638883-35638905 GTGGCTTGTTTGTCAGTGACAGG + Intergenic
975812746 4:78186485-78186507 GAGGCTTATTAGCATTTGCCAGG + Intronic
976026938 4:80699303-80699325 GTGGCTTGTCAACATCTCACTGG + Intronic
982314984 4:154023094-154023116 GTGGCATGTTAACTTGTAACTGG - Intergenic
985967324 5:3347669-3347691 GGGGCTTGGTGGCATGTGACAGG - Intergenic
986025302 5:3844987-3845009 ATGGCTTGTTTGCAGGTCACTGG + Intergenic
986201599 5:5584317-5584339 GTTGCTTCTTAGCATATGGCTGG - Intergenic
988084244 5:26453816-26453838 TAGGCTTATTAGCATGTGAGAGG + Intergenic
995533368 5:113112308-113112330 GGGGCTTGTTGGGAGGTGACTGG + Intronic
998361077 5:141587828-141587850 ATGGCTTGTTAGCATTTGTTTGG - Intronic
999481109 5:151948917-151948939 GTTGCTTCTGAGCTTGTGACGGG + Intergenic
1003652004 6:7969426-7969448 GTGGCTGGGTAGCATGGGAGTGG - Intronic
1003780912 6:9425228-9425250 GTGGATTTTTAGCATGAGATAGG - Intergenic
1004808212 6:19227498-19227520 GTGGCTACTTCGAATGTGACTGG + Intergenic
1005506040 6:26469668-26469690 GTGGCTTGAAAGAATATGACTGG + Intronic
1012156939 6:95830990-95831012 GTGGCTTGGTGGCAGGTGATTGG - Intergenic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1017483333 6:154879935-154879957 GGGGCTTGTTAGGGTGTGTCAGG + Intronic
1018322561 6:162627476-162627498 GTGGCTTGTAAACAGGAGACTGG + Intronic
1019125061 6:169832880-169832902 GTGCCTTCTCAGGATGTGACAGG + Intergenic
1027695245 7:81402580-81402602 GTGGCTTGTTACAATACGACTGG + Intergenic
1027798836 7:82726363-82726385 GTGACATGTTAGGAAGTGACAGG + Intergenic
1029176483 7:98668339-98668361 GTGGTTGGTTTGCATGTGAAAGG + Intergenic
1030109594 7:106015525-106015547 GGGGCTTGGAAGCAAGTGACAGG - Intronic
1038222321 8:25622294-25622316 GTGACTTGGCATCATGTGACGGG + Intergenic
1041893957 8:62902569-62902591 TTGTCTTGTCAGAATGTGACAGG - Intronic
1042343988 8:67709176-67709198 GTGGCCTGCTAGCATGTGACAGG - Intronic
1045065382 8:98439396-98439418 GTGCCTGGCTAGCATGTCACAGG - Intronic
1047658016 8:127000067-127000089 GTGGCATGTTAGCATGTGCTGGG - Intergenic
1050026799 9:1343277-1343299 GTGTCTTGGAAGCATGTGGCAGG + Intergenic
1052423708 9:28276466-28276488 AGGGCATGTTAGCAAGTGACAGG - Intronic
1056853587 9:90105348-90105370 TTGGCTTGTTGGAATGTGAGTGG - Intergenic
1057094514 9:92293775-92293797 CTGGCTTGTTGGCAGGTGTCAGG - Intergenic
1057922609 9:99109741-99109763 GTGGTTTGATATCATGTGATTGG + Intronic
1058206473 9:102115114-102115136 CTGGCTTGTTGGTATCTGACTGG - Intergenic
1186715378 X:12245711-12245733 GTGGCTAGTTATCATGGGAGTGG + Intronic
1189862372 X:45286606-45286628 GTGGATTATTAGCATGAGAAAGG + Intergenic
1190875364 X:54456412-54456434 GTGACTTGTGGGCATCTGACAGG - Intronic
1193009198 X:76657148-76657170 TTGGTTTGTTTGCATATGACAGG + Intergenic
1194721471 X:97345268-97345290 GTGGCTTGTCAGCATGAAAGAGG + Intronic
1198306174 X:135385336-135385358 TTGGCTTATTAGCATTTGTCTGG - Intergenic
1200125594 X:153812738-153812760 GTGGCTCCTTACCATGTGCCTGG - Intronic
1201418171 Y:13769255-13769277 GTGGCCAGGTAGCATGTTACAGG + Intergenic