ID: 1184047243

View in Genome Browser
Species Human (GRCh38)
Location 22:41979107-41979129
Sequence GGGTGCTCATATGTGCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184047240_1184047243 7 Left 1184047240 22:41979077-41979099 CCAGCAGGCGCTGTGTACAGTGC 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1184047243 22:41979107-41979129 GGGTGCTCATATGTGCTTGTTGG 0: 1
1: 0
2: 0
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184047243 Original CRISPR GGGTGCTCATATGTGCTTGT TGG Intronic
900446465 1:2683546-2683568 GGATGCTCACCTGTGGTTGTGGG - Intronic
900447241 1:2687439-2687461 GGATGCTCACCTGTGGTTGTGGG - Intronic
900448733 1:2694865-2694887 GGATGCTCACCTGTGGTTGTGGG - Intronic
900452202 1:2755817-2755839 GGATGCTCACCTGTGGTTGTGGG - Intronic
900978563 1:6033219-6033241 GTGTGCGCATGTGTGCATGTGGG + Intronic
902734965 1:18394413-18394435 GGGTGCACATATGTGTTGGGGGG - Intergenic
903383315 1:22911322-22911344 GTGTGTTCATCTGTGCATGTAGG - Intronic
909347465 1:74608582-74608604 CAGTTCTCATATTTGCTTGTTGG - Intronic
915804747 1:158834160-158834182 GCATACTCATATGTGCTTATTGG + Intronic
921126703 1:212184330-212184352 GGGTACTGATCTGTGCATGTAGG + Intergenic
922799398 1:228358070-228358092 GGATGCCCATGTGTCCTTGTGGG + Intronic
923851481 1:237800887-237800909 GGGTGCTGGTATATGCATGTAGG - Intronic
1065650467 10:27883948-27883970 GAATGCTCATATGTGTATGTTGG - Intronic
1067759601 10:49034502-49034524 TGGTGATCACATGTGCTCGTTGG + Intronic
1069370014 10:67737950-67737972 GGGTACTGACATGTGCCTGTAGG - Intergenic
1070417040 10:76200530-76200552 GGATGGTCATATGGGTTTGTAGG + Intronic
1070550176 10:77484862-77484884 GGATGCTCACATTAGCTTGTGGG - Intronic
1073039083 10:100587215-100587237 GGATGTTCATCTCTGCTTGTGGG + Intergenic
1074869133 10:117563392-117563414 GGGTGTTCATGTGTGTCTGTGGG + Intergenic
1074869157 10:117563589-117563611 GGGTGTTCATGTGTGTCTGTGGG + Intergenic
1074869166 10:117563646-117563668 GGGTGTGCATGTGTGTTTGTGGG + Intergenic
1076038630 10:127223928-127223950 GGATGCTGAGCTGTGCTTGTGGG + Intronic
1077138138 11:1011746-1011768 GGGTGGCCACATGTGCTTGAGGG + Exonic
1078069264 11:8097595-8097617 GTGTGCACATATGTGCGTTTGGG + Intronic
1078108931 11:8376333-8376355 GTGTGTTCACATGTGCATGTTGG + Intergenic
1079133614 11:17763605-17763627 GGGTGTGTATATGTGCATGTGGG - Intronic
1084608712 11:70187213-70187235 GGGTGCTCACACGTGCTTGCTGG + Intronic
1090663256 11:128896583-128896605 GAGTGTGCATGTGTGCTTGTTGG + Intronic
1096603618 12:52748325-52748347 GTGTGCCCCTCTGTGCTTGTAGG - Intergenic
1097190640 12:57217800-57217822 CTGTGCTCATATGTGCTGGGTGG + Intronic
1097299293 12:58001121-58001143 GCTTGTTCATATGTGCTTTTGGG + Intergenic
1097623245 12:61967099-61967121 GGGTCCTGATCTTTGCTTGTGGG + Intronic
1102576514 12:113859272-113859294 GGCTGCCCATGTGTGCTAGTAGG + Intronic
1107414475 13:40188173-40188195 GGGTGCTTATATTTAATTGTGGG + Intergenic
1112525179 13:100139636-100139658 GAGTGTTCATAATTGCTTGTTGG + Intronic
1113693246 13:112326718-112326740 GTGTGCTCGTGTGTGCTGGTGGG - Intergenic
1119026227 14:71155104-71155126 GGAGGCTCAAATGTGCTTGAAGG - Intergenic
1126484217 15:49161340-49161362 AGGTGCTAATAAGTGCTAGTTGG + Intronic
1128513843 15:68329767-68329789 GGGGGCTCTTAGGTCCTTGTTGG - Intronic
1130974722 15:88764968-88764990 GGGTCTTCATTTGTGCTTGTTGG - Intergenic
1132353314 15:101154051-101154073 GGGTGCACAGGTGTGCATGTGGG - Intergenic
1133965574 16:10529229-10529251 TGGTCCTAATATGTGCTTCTTGG + Exonic
1134156036 16:11844155-11844177 GGATGCTCAGGTGTGCTTGCAGG - Intronic
1138978472 16:62237842-62237864 GAATTCTCATATGTGGTTGTTGG + Intergenic
1138985926 16:62328505-62328527 GTGTGTTCATTTGTGTTTGTGGG - Intergenic
1139947957 16:70654502-70654524 GGGTGCTCATGTGCTCTTGTCGG + Intronic
1141930546 16:87199540-87199562 GGGTGTTCTTTTGTTCTTGTGGG - Intronic
1141937744 16:87253034-87253056 TGGTGCACATATCTGCATGTAGG + Intronic
1142410605 16:89914277-89914299 GGGTGCACATTTGTGTGTGTGGG + Intronic
1147880861 17:43652432-43652454 GGGTGCTCATATGTGGGTTTGGG + Intronic
1149597229 17:57871466-57871488 GTGTGCTCATGTGTGATTCTGGG - Intronic
1150557550 17:66268034-66268056 GTGTGCTCATACATGCTTGAGGG + Intergenic
1153458065 18:5300328-5300350 GAGTGTTCATAATTGCTTGTTGG + Intergenic
1155938551 18:31779734-31779756 GGGTGCAGGTATGTGTTTGTGGG - Intergenic
1160618826 18:80155516-80155538 GGGAAATCCTATGTGCTTGTTGG + Intronic
1162260442 19:9529309-9529331 GAGTTCTCATATGTGCCTGAAGG + Exonic
1163325962 19:16603439-16603461 GAGTGCTCATGAGTGCTTGAGGG + Intronic
1163734801 19:18973099-18973121 GGGTGCTCTTATCTGCTTCTGGG - Intergenic
1164154957 19:22588238-22588260 GTGTGCACATATGTGTGTGTAGG - Intergenic
1165640046 19:37376779-37376801 GAGTACTCATATGTGCCTGCTGG - Intronic
925610207 2:5696201-5696223 GTGTGCTCAGAGGTGGTTGTTGG + Exonic
927659631 2:24981978-24982000 GGGAGCTCAGCTGTGGTTGTGGG - Intergenic
928633879 2:33222460-33222482 GTGTGCACACATGTGCTTGCAGG + Intronic
932735911 2:74254517-74254539 AGGTGCTCAAATGTGCTGGCTGG + Intronic
934158209 2:89222806-89222828 GTCTGCTCATCAGTGCTTGTAGG - Intergenic
934785492 2:97002344-97002366 TGGTGCTCATAGGGGCTTGTGGG - Intronic
939273736 2:139972043-139972065 TGGTGCTTGTATATGCTTGTTGG - Intergenic
942330198 2:174815617-174815639 GAGTGTTCATAATTGCTTGTTGG + Intronic
943243548 2:185418511-185418533 TGGTGCTAATATTTGCTTCTAGG + Intergenic
1172993518 20:39053044-39053066 GGGTGAGCATGTGTGCTTGGGGG + Intergenic
1174457371 20:50659225-50659247 TGGTGGACACATGTGCTTGTTGG + Intronic
1175325683 20:58126855-58126877 GGCTGCACATGTGTGCTTGATGG + Intergenic
1175706759 20:61184505-61184527 GGGTGCTCCTCTGTGTGTGTCGG + Intergenic
1178689366 21:34738564-34738586 AGGTGCTCATATGTGGTTCCTGG - Intergenic
1179343317 21:40532924-40532946 ATGTGCGCATATGTGCTTTTGGG + Intronic
1179999433 21:44988415-44988437 GTGTGCACATGTGTGCATGTGGG + Intergenic
1180636682 22:17267427-17267449 GGGTGCTAATATCGGCTTCTTGG + Intergenic
1181136005 22:20766790-20766812 AGGTGCTCATAAGTGTTTGGGGG - Intronic
1181631491 22:24153938-24153960 GTGTGTTCATCTGTGCTGGTAGG + Intronic
1182049188 22:27300066-27300088 GAGTGCTCATATATGCTTTCTGG - Intergenic
1182096204 22:27627659-27627681 GAGTGCTCATGATTGCTTGTTGG + Intergenic
1182455037 22:30444876-30444898 GGGTGCTCAAATGTGAATTTCGG + Intergenic
1184047243 22:41979107-41979129 GGGTGCTCATATGTGCTTGTTGG + Intronic
952230585 3:31425430-31425452 GGGCTCTCTTATGTGCTTGAAGG - Intergenic
955360350 3:58268866-58268888 GGGTGATCAGATGTGGTTCTTGG + Intronic
956599741 3:71008136-71008158 AGGTACTCTTATGTGCTTGGGGG - Intronic
957939499 3:86987903-86987925 AGGTGCACATTTGTGCTTATCGG + Intronic
960368289 3:116802174-116802196 GTTTGCTCATGTGTTCTTGTTGG - Intronic
960824676 3:121770453-121770475 GGGTGCTTGTATGTGCTTCAGGG + Exonic
962408147 3:135117837-135117859 GGGTGCTCAGTTGTGCAGGTTGG + Intronic
962661644 3:137606936-137606958 GTGTGCTCCAATGTGCTTTTGGG - Intergenic
967651973 3:191996905-191996927 TAGTGCTCACATTTGCTTGTAGG - Intergenic
968522726 4:1041351-1041373 CGGTGCACATGTGTGCATGTAGG + Intergenic
972501178 4:39679508-39679530 GCATGCTCATAATTGCTTGTTGG + Intergenic
974107901 4:57491551-57491573 GTGTGCTCACATCTGCTGGTAGG - Intergenic
978283433 4:107045168-107045190 GTGTGCTCGTATGTGCATTTTGG - Intronic
979663671 4:123287357-123287379 GTGTGCTCATGTGTTCATGTAGG - Intronic
980788422 4:137585336-137585358 GTGTGTGCATATATGCTTGTGGG - Intergenic
981183150 4:141769372-141769394 CGGAGCTCATATGGGCTTTTGGG - Intergenic
982980385 4:162126830-162126852 GGGTGTGCATGTGTGCATGTGGG + Intronic
986830403 5:11571241-11571263 GTCTGCTCATATGTGACTGTTGG + Intronic
987758512 5:22127748-22127770 GGTTGCTCTCATGTGTTTGTAGG + Intronic
991749270 5:69781888-69781910 GGTTGCTCTCATGTGTTTGTAGG + Intergenic
991800851 5:70361695-70361717 GGTTGCTCTCATGTGTTTGTAGG + Intergenic
991827749 5:70648346-70648368 GGTTGCTCTCATGTGTTTGTAGG - Intergenic
991893213 5:71361146-71361168 GGTTGCTCTCATGTGTTTGTAGG + Intergenic
995971346 5:117974781-117974803 TGGTGCTGATATCTGCTTGGAGG + Intergenic
997235726 5:132271049-132271071 GGGTGCTCATCTGGGCTGGCAGG - Exonic
997354042 5:133250992-133251014 GGGTGCTCATCTTTCCTTGAGGG - Intronic
1002125690 5:177042320-177042342 AGGTGATCACATGTGCTTTTTGG + Intronic
1004292088 6:14376740-14376762 GGCTGCTCAGTTGTGCTTGCTGG - Intergenic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1016667755 6:146662526-146662548 GAGTGTTCATAATTGCTTGTTGG + Intronic
1023372979 7:39530454-39530476 GTGTGCACATATGTGTGTGTAGG - Intergenic
1024713528 7:52045922-52045944 GGGTGCTCATATGTTGCTGGAGG + Intergenic
1027451614 7:78337924-78337946 AGGTGCTCATAAGTACTTCTTGG - Intronic
1033353140 7:140578510-140578532 ATTTGCTCATATGTGCCTGTAGG + Intronic
1036236841 8:7046224-7046246 GTTTGCTAATTTGTGCTTGTTGG + Intergenic
1036660041 8:10701997-10702019 GTGTACTCACATGTGCGTGTGGG + Intronic
1037504941 8:19520123-19520145 GTGTGCTCATATCTTTTTGTAGG - Intronic
1039419215 8:37421476-37421498 GGCTGCTCATTTCTGCCTGTGGG + Intergenic
1043178621 8:77054508-77054530 GTGTGCACATGTGTGCATGTGGG - Intergenic
1045561662 8:103270174-103270196 GGATGCTCATTTTTGCTGGTAGG - Intergenic
1050795331 9:9532768-9532790 GGGTGCTAATGTGTACTTCTGGG - Intronic
1062344268 9:136107612-136107634 GTGTGCACGTATGTGCGTGTGGG - Intergenic
1191171206 X:57448921-57448943 GGATACTCATATGCACTTGTAGG - Intronic
1191889287 X:65924755-65924777 GGCTGCCCAAATGTGCCTGTAGG + Intergenic
1193819499 X:86145043-86145065 GGGTGCTCATCTGTGATTTTAGG - Intergenic