ID: 1184051544

View in Genome Browser
Species Human (GRCh38)
Location 22:42009161-42009183
Sequence ATCCCAGCACAAGGCCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 2, 1: 4, 2: 13, 3: 40, 4: 373}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184051544 Original CRISPR ATCCCAGCACAAGGCCAAGG TGG (reversed) Intronic
900013003 1:132312-132334 TTCCCAGCACATGGCCAGCGAGG + Intergenic
900043069 1:488299-488321 TTCCCAGCACATGGCCAGCGAGG + Intergenic
900064505 1:723296-723318 TTCCCAGCACATGGCCAGCGAGG + Intergenic
900197320 1:1383091-1383113 ATCCCAGCACAGGCCAAAGTGGG + Intergenic
901359800 1:8687373-8687395 AGCCCACCATGAGGCCAAGGAGG + Intronic
901948421 1:12722077-12722099 ATCCCAGCACGAGGCCAAGGTGG + Intronic
902834919 1:19040833-19040855 CTCCCAGCTCAGGGCCAAGAGGG - Intergenic
903146041 1:21372572-21372594 ATCAACGCACAAGGCCATGGAGG + Intergenic
904582202 1:31552716-31552738 GTCCGAGCCCAAGGGCAAGGTGG + Intergenic
904715049 1:32461394-32461416 ATCCCAGCACTAGGAGAACGAGG - Intergenic
904820950 1:33243862-33243884 ATCCCAGCACTTTGCAAAGGAGG - Intergenic
904929340 1:34073931-34073953 ATCACGGCATAAGGCAAAGGGGG + Intronic
904963946 1:34357176-34357198 ATCCCAGCAGAAGGCAAAATTGG - Intergenic
905744499 1:40402985-40403007 ATGCAAGCACAAGGGCAGGGTGG + Intronic
906136674 1:43505053-43505075 ATCTCAGCACTAGGCTGAGGCGG - Intergenic
907332663 1:53681408-53681430 CTCCCAGGACAATGCCAAGTAGG + Intronic
910289058 1:85582181-85582203 ATCCCAGCTCCTTGCCAAGGAGG - Exonic
911010934 1:93280091-93280113 ATCATAGCAGAAGGCAAAGGAGG + Intergenic
911750052 1:101486226-101486248 AGGCCAGCACAATACCAAGGAGG + Intergenic
912010638 1:104957396-104957418 ATCCCAGCACTTTGCCGAGGCGG + Intergenic
912086497 1:106013075-106013097 ATCACAGTAGAAGGCAAAGGGGG + Intergenic
914230037 1:145757337-145757359 ATCCCAGCAGAAACCCAAGGTGG + Intronic
914806408 1:150995288-150995310 AGCCCTGCACAAGGCCAGGAGGG - Exonic
916272267 1:162956065-162956087 ATCCCAGCACAATGCTAAAATGG - Intergenic
916574773 1:166057702-166057724 AACACAGCACAATTCCAAGGAGG + Intronic
916842604 1:168615283-168615305 ATCCCAGTACATGGGCAAGAAGG + Intergenic
917205029 1:172563011-172563033 ATCACAGCAGAAGGGCAAAGGGG - Intronic
918010105 1:180578552-180578574 TTCACAGCACAAGACAAAGGGGG - Intergenic
918107125 1:181424904-181424926 AGCCCAGCGCAAGGGCAGGGTGG - Intronic
918473930 1:184903619-184903641 ATCATAGCAGAAGGCAAAGGGGG - Intronic
918772279 1:188576746-188576768 ATCCCAGGACAAGGACAGAGTGG - Intergenic
920724357 1:208419945-208419967 AAGCCATCACAAGGGCAAGGGGG - Intergenic
922099402 1:222469310-222469332 TTCCCAGCACATGGCCAGTGAGG + Intergenic
922261438 1:223948805-223948827 TTCCCAGCACATGGCCAGTGAGG + Intergenic
922293175 1:224225898-224225920 ATCCCAGCACTAGGCCAAGGCGG - Intergenic
922735636 1:227976938-227976960 TTCCCAGCACATGGCCAGTGAGG - Intergenic
923338728 1:232990763-232990785 AACCCAGCACACGGCCAAGCAGG - Intronic
923541358 1:234890521-234890543 ATCCCAGCACATGACTGAGGTGG - Intergenic
923904585 1:238369743-238369765 ATCACGGCAGAAGGCAAAGGAGG + Intergenic
924064578 1:240208407-240208429 ATCCCAGCACCAGGTAGAGGGGG - Exonic
1063154041 10:3361990-3362012 ATCACAGCAGAAGGTGAAGGAGG - Intergenic
1063515778 10:6693665-6693687 ATCATAGCAGAAGACCAAGGGGG - Intergenic
1064652800 10:17526310-17526332 ATCACGGCAGAAGGCAAAGGAGG - Intergenic
1065570554 10:27067552-27067574 ATCACAGCAGAAGGCAAAGAGGG + Intronic
1066540711 10:36443962-36443984 ATCACGGCAGAAGGCAAAGGAGG - Intergenic
1066733873 10:38454570-38454592 TTCCCAGCACATGGCCAGTGAGG - Intergenic
1067456252 10:46421268-46421290 GTCCCTGCACAGGGCCGAGGAGG + Intergenic
1067529823 10:47061983-47062005 CCCCCAGCACAAGGCCAGGGTGG - Intergenic
1067630947 10:47963371-47963393 GTCCCTGCACAGGGCCGAGGAGG - Intergenic
1068244278 10:54343377-54343399 ATCACAGCAAAAGGGAAAGGGGG - Intronic
1069094887 10:64248297-64248319 ATCACGGCAGAAGGCAAAGGAGG + Intergenic
1069380903 10:67842525-67842547 ATCACAGCAGAAGGTGAAGGGGG - Intergenic
1070343005 10:75514708-75514730 CTCCTAGCAGAAGGCGAAGGAGG - Intronic
1070711895 10:78689065-78689087 AGCCCAGCACCAGGCAGAGGTGG - Intergenic
1072211895 10:93253885-93253907 ATCTCAGCACTAGGCCGAGGTGG - Intergenic
1074052523 10:109893134-109893156 AGCCTAGCACAAGGCTAAGCAGG - Intronic
1074417168 10:113276995-113277017 ATCAGGGCACAAGGCGAAGGAGG - Intergenic
1074576577 10:114675474-114675496 ATCACGGCAGAAGGCGAAGGAGG - Intronic
1076336124 10:129707449-129707471 AACACAGCACACGGCCATGGAGG + Intronic
1076969340 11:124516-124538 TTCCCAGCACATGGCCAGCGAGG + Intergenic
1077882493 11:6362546-6362568 ATCACAGCTCAGGGCCAAGCAGG + Intergenic
1078097757 11:8311070-8311092 GTCTCAGCACAGGGCCTAGGAGG + Intergenic
1079250225 11:18781565-18781587 ATCCCAGCACCAGGCCGAGGCGG - Intronic
1081122477 11:39284548-39284570 ATCACTGCAGAAGGCAAAGGAGG + Intergenic
1082959635 11:58906183-58906205 ATCTCAGCCCAAAACCAAGGAGG + Intronic
1083515221 11:63251202-63251224 ATCACAGCAGAAGGTGAAGGAGG + Intronic
1083670483 11:64297296-64297318 AGCCCAGCACAAGGGCAGGCAGG - Intronic
1084594338 11:70108035-70108057 ACACCAGCACTAGGCCCAGGAGG + Intronic
1084763652 11:71293521-71293543 ATCGCAGAAGAAGGCAAAGGGGG + Intergenic
1085172081 11:74457930-74457952 ATCACGGCAGAAGGCAAAGGAGG - Intronic
1085241804 11:75062689-75062711 ATCACTGCAGAAGGCCAAGAGGG - Intergenic
1086445669 11:86868046-86868068 ATTCAAGCCAAAGGCCAAGGAGG + Intronic
1086520766 11:87665553-87665575 ATCACGGCAGAAGGCAAAGGGGG + Intergenic
1087571624 11:99934635-99934657 ATCCCAGCACAAGGCCATGGTGG + Intronic
1088028672 11:105219400-105219422 ATCACGGCAGAAGGCAAAGGGGG + Intergenic
1088182711 11:107130040-107130062 AACCCAGCACTAGGCCAAGCTGG - Intergenic
1089367179 11:117928115-117928137 CTCCCAGCATATTGCCAAGGAGG + Intronic
1089841848 11:121425488-121425510 ATCACGGCAGAAGGCAAAGGGGG + Intergenic
1090925509 11:131246655-131246677 AGCCCAGGAGAAGGCCATGGTGG + Intergenic
1091208570 11:133836989-133837011 ATCCAAGCACTAAGCCAAGCAGG - Intergenic
1092481167 12:8860293-8860315 ATCCCAGCTTGAGGCCAAGTCGG - Intronic
1092529954 12:9335879-9335901 GTCCCAGGACAAGGGCAAGAAGG - Intergenic
1093749685 12:22783851-22783873 CTCCCAGCCCAGGGCCAATGTGG - Intergenic
1095388749 12:41680102-41680124 ATCCCAGCAGAAGGCGAAGTGGG - Intergenic
1096185646 12:49578855-49578877 ATCCCAGAACAAAGGCAAGATGG + Intronic
1096557782 12:52414067-52414089 AGCCCTGCAGAAGGCCAAGCAGG - Intergenic
1096572441 12:52531358-52531380 TGCCCAGCCCAAGGCCAAGCTGG - Intergenic
1096574860 12:52546392-52546414 CGCCCTGCACCAGGCCAAGGAGG - Exonic
1096578265 12:52568275-52568297 CGCCCTGCACCAGGCCAAGGAGG - Exonic
1096581381 12:52587737-52587759 CGCCCTGCACCAGGCCAAGGAGG - Exonic
1096614317 12:52823122-52823144 GGCCCTGCACCAGGCCAAGGAGG - Exonic
1096953351 12:55499476-55499498 ATCATAGCAGAAGGCCAAGGGGG - Intergenic
1097982324 12:65747034-65747056 TTGCCAGCACAAGGCAAAGAGGG + Intergenic
1098526332 12:71491113-71491135 ATCATAGCAGAAGGCAAAGGAGG - Intronic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1101714890 12:107302118-107302140 AGCCAAGCCCAAGGCCAAGATGG - Intergenic
1102073965 12:110045338-110045360 ATCCCAGTGAGAGGCCAAGGCGG + Intronic
1102146125 12:110656305-110656327 AGCCCATCACAAAGCCCAGGAGG - Intronic
1102436752 12:112930178-112930200 ATCATAGCAGAAGGCAAAGGGGG - Intronic
1102964052 12:117112656-117112678 ATCCCAGCGCTTTGCCAAGGTGG - Intergenic
1103128219 12:118443292-118443314 AGCACTGCAGAAGGCCAAGGTGG - Intergenic
1103136262 12:118510463-118510485 ATCATGGCAGAAGGCCAAGGAGG + Intergenic
1103772386 12:123338298-123338320 ATCCCAGCACTTGGGCAAGCAGG + Intronic
1104343412 12:127973384-127973406 ATCATGGCAGAAGGCCAAGGAGG - Intergenic
1105874454 13:24540432-24540454 GTCCCAGCACTGGGCCAAGCAGG + Intergenic
1106489675 13:30208327-30208349 ATACCAGCACAAAGCCGGGGAGG + Exonic
1106578294 13:30996422-30996444 ATCATAGCAGAAGGCAAAGGGGG - Intergenic
1107230861 13:38108658-38108680 ATCAAGGCACAAGGCAAAGGGGG + Intergenic
1109650215 13:65314247-65314269 AGCCTAGCAAAAGGCCATGGAGG - Intergenic
1109905077 13:68830050-68830072 ATCACGGCAGAAGGCAAAGGAGG - Intergenic
1110642570 13:77842500-77842522 ATCACGGCAGAAGGCGAAGGGGG - Intergenic
1111172283 13:84543129-84543151 ATCATTGCAGAAGGCCAAGGAGG + Intergenic
1111805176 13:93031655-93031677 ATCATAGCAGAAGGCAAAGGAGG - Intergenic
1111858211 13:93667678-93667700 ATCCCAGCACAAGGCCAAGGTGG - Intronic
1114659888 14:24337390-24337412 ATCCCAGAGTCAGGCCAAGGAGG - Exonic
1114876521 14:26726477-26726499 ATCACAGCAAAAGGCAAAGGAGG - Intergenic
1116233919 14:42253624-42253646 ATCCCAGAACAAGGAGGAGGAGG + Intergenic
1117077261 14:52117010-52117032 ATCCCAGCAGAATGGCAAGTTGG - Intergenic
1117367980 14:55050480-55050502 ATCCCAGCACTTTGCCGAGGAGG + Intergenic
1117569554 14:57032957-57032979 ATCCCAGTGGGAGGCCAAGGCGG - Intergenic
1118935500 14:70284244-70284266 ATCCCAGTACAGGGCTAAGGTGG - Intergenic
1119190237 14:72676731-72676753 ATCACGGCAGAAGGCAAAGGAGG - Intronic
1119439592 14:74619392-74619414 GACCCAGCTCAAAGCCAAGGTGG - Intergenic
1120072687 14:80121641-80121663 ATCATAGCAGAAGGCAAAGGGGG - Intergenic
1120437201 14:84496030-84496052 ATCATAGCAGAAGGCAAAGGGGG - Intergenic
1120947714 14:90013501-90013523 ATCATAGCAGAAGGCAAAGGAGG - Intronic
1121680712 14:95790710-95790732 ATCATAGCAGAAGGCAAAGGGGG + Intergenic
1121681072 14:95793066-95793088 ATCACAGCAGAAGGCAAAGGGGG - Intergenic
1121820769 14:96964312-96964334 CTCCCAGCACACAGCCGAGGGGG - Intergenic
1121846034 14:97173230-97173252 ATCCCACCCCCAGGCCCAGGAGG + Intergenic
1122058269 14:99119676-99119698 CACCCAGCACCAGGCAAAGGTGG + Intergenic
1122360165 14:101154495-101154517 ATCACAGCAGAAGGTGAAGGAGG - Intergenic
1123064374 14:105609219-105609241 ATCACGGCAGAAGGCGAAGGGGG - Intergenic
1123073676 14:105654857-105654879 ATCACGGCAGAAGGCGAAGGGGG - Intergenic
1123093611 14:105753627-105753649 ATCACAGCAGAAGGCGAAGGGGG - Intergenic
1123913891 15:25000893-25000915 ATCCCAGCACGAGGCCGAGGTGG + Intergenic
1126079580 15:44946380-44946402 ATCACAGCAGAAGGCTAAGGAGG + Intergenic
1126399661 15:48256557-48256579 ATCATAGCAGAAGGCAAAGGAGG + Intronic
1127619348 15:60718044-60718066 ATCCCAGTGCGAGGCCAAGGTGG - Intronic
1127806868 15:62529339-62529361 ATACCAACACAAGGCCAAGGTGG - Intronic
1128037264 15:64537842-64537864 ATCCCAGCACTTTGCAAAGGAGG + Intronic
1128244177 15:66121629-66121651 ACCACAGGACAAGGCCAGGGTGG + Intronic
1129518295 15:76170383-76170405 ATCCCAGCACTGAGCCAAAGAGG - Intronic
1131550137 15:93350175-93350197 ATCCAAGGAGGAGGCCAAGGCGG + Intergenic
1132295079 15:100728806-100728828 TTCCCAGCACAAGCCCTACGTGG + Intergenic
1132410114 15:101571172-101571194 CTGACAGCTCAAGGCCAAGGTGG + Intergenic
1133677306 16:8086635-8086657 ATCCCAGCACAAGGCCTCGTGGG + Intergenic
1134368509 16:13601940-13601962 ATCACGGCACAAGGCAAAAGAGG + Intergenic
1135415332 16:22264516-22264538 ATCCCAACACAAAGCCACTGGGG - Intronic
1136023352 16:27454236-27454258 ATCACAGCAGAAGGCTAAGGGGG + Intergenic
1136370735 16:29834419-29834441 ATCCCAGCACTTTGCCAAGGTGG + Intronic
1139742413 16:69046570-69046592 ATCCCAGCACTTTGGCAAGGAGG - Intronic
1139925320 16:70482818-70482840 CTTCCTGCACAAGGACAAGGTGG + Exonic
1140084320 16:71780239-71780261 ATCCCAGCACGAGGCCAAAACGG - Intronic
1140131654 16:72167150-72167172 ACCCCTGCACAAGGCCGAGGGGG + Intronic
1140850644 16:78932010-78932032 ATCACGGCAGAAGGCCAATGTGG - Intronic
1141603428 16:85139642-85139664 GTCCCACCACCTGGCCAAGGGGG - Intergenic
1141935100 16:87233215-87233237 TTGCCAGCACTATGCCAAGGAGG + Intronic
1141954394 16:87360809-87360831 AACTCAGCCCAAGGCCAAGAGGG + Intronic
1142451333 16:90174606-90174628 TTCCCAGCACATGGCCAGCGAGG - Intergenic
1143582349 17:7834591-7834613 ATCCCAGCCCAAGGGGAACGGGG - Intergenic
1143689122 17:8545912-8545934 CACCCAGCACAAGGACAAGGCGG + Intronic
1143913190 17:10269090-10269112 ATCCCAGTAGGAGGCCAAAGTGG - Intergenic
1147238455 17:39074766-39074788 AGCCCAGCACTGGGCCAGGGCGG - Intronic
1147881476 17:43656866-43656888 CTCCCAGCCCCAGGCCAATGGGG - Intronic
1148282245 17:46357585-46357607 GTCCCAGCAGAAGGCTGAGGTGG - Intronic
1148304463 17:46575510-46575532 GTCCCAGCAGAAGGCTGAGGTGG - Intronic
1149303712 17:55328680-55328702 ATCCTAGCAGAAGGTGAAGGAGG + Intergenic
1150571947 17:66394293-66394315 CACCCAGCACTAGCCCAAGGTGG + Intronic
1150649771 17:67002158-67002180 ATCATAGCAGAAGGCAAAGGAGG + Intronic
1150942884 17:69712516-69712538 ATCCAAGCATCAAGCCAAGGAGG + Intergenic
1151148948 17:72067139-72067161 ATCACAGCAGAAGGCAAATGAGG + Intergenic
1151468178 17:74301261-74301283 AACCCAGCACCAGCCCAGGGAGG + Intronic
1152389509 17:79994269-79994291 ATCCCAGCTCAGGGCCGGGGGGG + Intronic
1153715522 18:7843927-7843949 ATCCCAGCAGCAGCCCCAGGTGG - Intronic
1153970065 18:10217919-10217941 ATGCCAGCACAATGCCAGAGGGG - Intergenic
1153984000 18:10336836-10336858 AACCCAGCACAAGGGAATGGCGG - Intergenic
1155808353 18:30200826-30200848 ATCATGGCAGAAGGCCAAGGGGG + Intergenic
1156274289 18:35567987-35568009 ATCCCAGATCAAGGCCCAGCAGG + Intergenic
1156719913 18:40057602-40057624 ATCACTGCAGAAGGCAAAGGAGG - Intergenic
1157240893 18:46008557-46008579 ATCCCAGCACTTTGCCGAGGTGG - Intronic
1157247403 18:46066775-46066797 ATCCCAGCACTTTGCCCAGGCGG + Intronic
1157520032 18:48339151-48339173 ATCTCCGGACAAGTCCAAGGTGG + Intronic
1158106466 18:53890341-53890363 ATCACGGCATAAGGCAAAGGAGG + Intergenic
1159763148 18:72453722-72453744 ATCATAGCAGAAGGCAAAGGGGG - Intergenic
1160646145 19:194442-194464 TTCCCAGCACATGGCCAGCGAGG + Intergenic
1160886814 19:1353992-1354014 ATCCCAGCAGGAGGCCGAGGCGG - Intergenic
1161944729 19:7428503-7428525 ATCTCTTCAGAAGGCCAAGGTGG - Intronic
1164103362 19:22079491-22079513 ATCATGGCACAAGGCAAAGGAGG + Intronic
1165594580 19:37001553-37001575 ATCCCAGCATGAGGCTAAGGCGG - Intergenic
1165619391 19:37232318-37232340 ATCCCAGCACTTTGCGAAGGTGG - Intronic
1165935975 19:39389361-39389383 ATCCCAGCAGCACGCGAAGGTGG - Exonic
1166183223 19:41123115-41123137 ATCCCACCACATGGCCCATGAGG + Intronic
1166193342 19:41190515-41190537 CTTCCAGAACAAGGCAAAGGAGG + Intergenic
1166958617 19:46484034-46484056 ATCCCAGCACTTTGCAAAGGAGG + Intronic
1167700049 19:51037877-51037899 ATCCCAGCACTAGGCCGAGGTGG + Intergenic
1167754346 19:51402338-51402360 GACCCAGCACCAGGCCATGGGGG + Intergenic
1168205174 19:54845182-54845204 AGCCCTGCAGGAGGCCAAGGCGG + Intronic
924966178 2:78353-78375 ATCACAGCAGAAGGCAAAAGAGG + Intergenic
926357397 2:12053898-12053920 ATCATAGCAGAAGGCAAAGGAGG + Intergenic
926862334 2:17322192-17322214 ATCATAGCAGAAGGCAAAGGAGG - Intergenic
929167049 2:38893122-38893144 AACAAAGCACAAGGCCTAGGTGG - Intronic
929325960 2:40610998-40611020 GTCACAGCAGAAGGCAAAGGTGG + Intronic
931112010 2:59120956-59120978 ATCAGAGCAGAAGGCAAAGGGGG - Intergenic
931988859 2:67769094-67769116 GTCTCAGGACAAGGCCAGGGGGG + Intergenic
932359861 2:71095434-71095456 ATCCCAGCACTAGGCCGAGGTGG + Intergenic
932506910 2:72242976-72242998 ATCCCAACACTAGGAAAAGGAGG - Intronic
932685664 2:73867295-73867317 ATCCCAGCAGGAGGCCAAGGCGG + Intronic
933832068 2:86219060-86219082 ATCACAGAGCAAGGCCCAGGAGG + Intronic
933893411 2:86790490-86790512 CTCCCAAAACAAGCCCAAGGCGG - Exonic
937672934 2:124558095-124558117 TTCCCAACACAAGAGCAAGGGGG - Intronic
937673466 2:124563761-124563783 ATCTAAGAACAAGGACAAGGTGG - Intronic
937860688 2:126706650-126706672 TTCCCAGCCCACGCCCAAGGGGG + Intergenic
938343799 2:130552365-130552387 ATCTCAGCAGGAGGCCCAGGTGG - Intergenic
938346034 2:130568357-130568379 ATCTCAGCAGGAGGCCCAGGTGG + Intergenic
938797138 2:134727183-134727205 ATCCCAGGAAAAGGCAATGGTGG + Intergenic
938985911 2:136576020-136576042 ATCACAGCAGAAGGAGAAGGAGG + Intergenic
940374866 2:152946376-152946398 ATCATAGCAGAAGGCGAAGGGGG - Intergenic
941648542 2:168067959-168067981 ATCACAGCAGAAGGCGCAGGAGG + Intronic
948418006 2:237830935-237830957 ATCCCAGCAAAAATCCAAGTAGG - Intronic
1169216328 20:3796615-3796637 ATCCCAGCAGGAGGCCCGGGAGG - Exonic
1170399984 20:15971469-15971491 ATCACAGCAGAAGGCAAGGGAGG - Intronic
1170729507 20:18961038-18961060 ATCCAAGCAGAAGCCAAAGGAGG + Intergenic
1171515269 20:25726989-25727011 ATCATGGCAGAAGGCCAAGGGGG + Intergenic
1172658478 20:36550614-36550636 GTCCCAGATCAGGGCCAAGGGGG + Exonic
1175691979 20:61072105-61072127 ATCACGGCAAAAGGCAAAGGAGG - Intergenic
1176279362 20:64291774-64291796 TTCCCAGCACATGGCCAGTGAGG - Intergenic
1177825134 21:26074501-26074523 ATTCCAGCACTAGGCCGAGGCGG + Intronic
1178029403 21:28506856-28506878 ATCACGGCAGAAGGCAAAGGGGG + Intergenic
1178847041 21:36182579-36182601 ATCCCAGCACTTGGCTGAGGCGG + Intronic
1179484289 21:41699791-41699813 CTCCCAGCACAAAGCCATGTTGG - Intergenic
1179602979 21:42493281-42493303 ACCCCAGCACATGTCCAGGGCGG + Intronic
1179809400 21:43860807-43860829 AGCCCTGCCCAAGGCCCAGGGGG - Intergenic
1180564494 22:16651303-16651325 AACCCAACACCAGGCCATGGGGG + Intergenic
1180743144 22:18067631-18067653 ATGCGAGCAGAAGGCCAATGTGG - Intergenic
1180875963 22:19175383-19175405 AGCCCAGCGCCAGGCCAAGAAGG - Intergenic
1180991993 22:19942287-19942309 ATCCCAGCCCAAGGACCAAGTGG - Intronic
1181025440 22:20124839-20124861 ATCAGGGCACAAGGCCCAGGGGG - Intronic
1181431573 22:22884814-22884836 TGACCAGCAGAAGGCCAAGGTGG + Intronic
1183952200 22:41358179-41358201 GTCCCAGCACAAGGCAGAGCTGG + Exonic
1184051544 22:42009161-42009183 ATCCCAGCACAAGGCCAAGGTGG - Intronic
1184478678 22:44735171-44735193 GCCCCAGCCCAAGGCCCAGGCGG - Intronic
1185293129 22:50037450-50037472 ATCCCAGCACTAGGCCGAGGCGG - Intronic
949892361 3:8742987-8743009 ATCATAGCAGAAGGCAAAGGGGG + Intronic
950344722 3:12282634-12282656 ATCCCAGCACTAGGCCAAGGTGG - Intergenic
951584783 3:24204026-24204048 AGCCCACCACAAGCTCAAGGAGG + Intronic
954210823 3:49096110-49096132 AACCCAGAACAAGGCCAGGGAGG + Intronic
954760408 3:52869760-52869782 GTCCCATCACAAGTCAAAGGTGG + Intronic
954926015 3:54235392-54235414 ATCACAGCAGAAGGCAAAGGGGG + Intronic
956181319 3:66520431-66520453 GTCCCAGCACAAGGACCAGGAGG - Intergenic
956546754 3:70411762-70411784 ATCATAGCAGAAGGCAAAGGAGG - Intergenic
957457609 3:80472628-80472650 CTCCCATCACAGGGCCTAGGAGG + Intergenic
957502276 3:81072622-81072644 ATCACAGCTGAAGGCAAAGGAGG + Intergenic
957867977 3:86049685-86049707 ATCATAGCAGAAGGCAAAGGGGG + Intronic
958029603 3:88091813-88091835 ATCACAGCAGAAGGCGAAGGAGG - Intronic
958818174 3:98941256-98941278 GTCCCAGCACAAAGACAGGGAGG - Intergenic
959408127 3:105986776-105986798 ATCCCAGCACTAGGCCGAGGTGG + Intergenic
959562277 3:107796249-107796271 ATACCAGAAAAAGGCCAAGTCGG - Intronic
960519429 3:118638043-118638065 ATTCCAGCAAAAGGCGGAGGGGG - Intergenic
961435377 3:126912907-126912929 TTCCCTGCAGAAGGCCGAGGGGG + Intronic
962865760 3:139447043-139447065 ATCATTGCACAAGGCAAAGGGGG - Intergenic
964685139 3:159387051-159387073 ACACCAGCACAGGGCCAAAGTGG + Intronic
965597118 3:170420247-170420269 ATTCCAGCAGAAAACCAAGGGGG - Intronic
965812878 3:172610003-172610025 ATCACAGCAGAAGGTGAAGGAGG - Intergenic
966091779 3:176146798-176146820 ATCACAGAAGAAGGCAAAGGAGG + Intergenic
966257164 3:177930217-177930239 ATCTCAGCAGAAGCCCAAGGTGG + Intergenic
966938395 3:184729660-184729682 CTCTCAGCTCAAGGACAAGGAGG + Intergenic
967458656 3:189720231-189720253 ATCAAAGAACCAGGCCAAGGAGG + Intronic
967686327 3:192420640-192420662 CTCACAGCAGAAGGCGAAGGGGG - Intronic
967690747 3:192470857-192470879 GCCGCAGCACAAGCCCAAGGAGG - Intronic
967877182 3:194275521-194275543 ATCGCAACAAAAAGCCAAGGGGG + Intergenic
967919715 3:194605480-194605502 ATCACGGCAGAAGGCAAAGGAGG + Intronic
968371536 3:198225084-198225106 TTCCCAGCACATGGCCAGCGAGG - Intergenic
968451904 4:679827-679849 ACCCCAGCACAGGGCCAGGCAGG - Intronic
968877845 4:3283549-3283571 ATCCCAGCAGAAGGCACAGGTGG + Intergenic
969301255 4:6298830-6298852 GGCCCACCAGAAGGCCAAGGAGG - Intronic
969526660 4:7707324-7707346 CTCCCAGCTCCTGGCCAAGGAGG + Intronic
969595056 4:8144036-8144058 TTCCCAGGTCAATGCCAAGGAGG + Intronic
971258927 4:25038764-25038786 AGCCCAGCCCAAGGACAAGTTGG + Intergenic
971467828 4:26983411-26983433 ATACCAGCTGAAGGCCAAGTTGG + Intronic
974027025 4:56742203-56742225 ATCATAGCAGAAGGCAAAGGAGG + Intergenic
974045270 4:56893105-56893127 ATCATAGCAGAAGGCCAATGAGG + Intergenic
975474218 4:74804309-74804331 ATCACAGCAAAAGGCAAAGGAGG + Intergenic
975849226 4:78554445-78554467 ATCTCAGCTCAAGGCAAAGGTGG + Exonic
977032847 4:91908655-91908677 ATCCCAGCACTAGGTCGAGGAGG + Intergenic
977051876 4:92138362-92138384 ATCATGGCAGAAGGCCAAGGAGG + Intergenic
978572711 4:110156437-110156459 ATCCCAGCAGAAGTCAAGGGTGG + Intronic
979260221 4:118637559-118637581 TTCCCAGCACATGGCCAGTGTGG - Intergenic
981426001 4:144603810-144603832 ATCATAGCAGAAGGCAAAGGGGG - Intergenic
982240868 4:153298062-153298084 ATCCCACCCCAGGGACAAGGGGG + Intronic
984160992 4:176251812-176251834 ATCCCAGCATTAGGCGGAGGCGG + Intronic
984436284 4:179714059-179714081 ATCATAGCAGAAGGCAAAGGGGG - Intergenic
984631449 4:182065430-182065452 GTCACGGCAGAAGGCCAAGGGGG + Intergenic
984663879 4:182404854-182404876 AGCTGAGGACAAGGCCAAGGTGG + Intronic
985174805 4:187189438-187189460 AGCCCATTAGAAGGCCAAGGTGG - Intergenic
985897796 5:2759510-2759532 ATCACAGCAGAAGGCAATGGGGG - Intergenic
986203006 5:5596299-5596321 ATCACAGCAGAAGGCAAAGAGGG - Intergenic
986975586 5:13389496-13389518 ATCACAGCAGAAGGCAAAGGGGG + Intergenic
987114612 5:14716247-14716269 ATCCCAGCACTTTGCCGAGGAGG + Intronic
988635242 5:32976792-32976814 ATCACAGCAGAAGGTGAAGGAGG - Intergenic
988705680 5:33724022-33724044 ATCCCAGAACAAGCACAAGCTGG + Intronic
988777575 5:34490891-34490913 AGCCCAGCATAGGGCCCAGGAGG - Intergenic
989407914 5:41082407-41082429 ATCACAGCAGAAGGAGAAGGAGG - Intergenic
991212079 5:64117551-64117573 ATCACAGCAGAAGGCGAATGAGG - Intergenic
993330967 5:86599387-86599409 ATCATAGCAGAAGGCAAAGGAGG - Intergenic
993610404 5:90046580-90046602 CTCCCAGCATGAGGCCAAGACGG + Intergenic
996837056 5:127804943-127804965 ATCCCAGCACAAGGAGCATGAGG - Intergenic
997596660 5:135111662-135111684 ATCCCAGCACATTGCCAGGAGGG - Intronic
998398878 5:141837292-141837314 ATCCCATCCCAAAGTCAAGGTGG - Intergenic
999044099 5:148448954-148448976 ATCCCAGCCCTAGTCCAAAGTGG + Intergenic
999248472 5:150167688-150167710 AACCCAGCCCTAGGCAAAGGCGG + Intronic
1001454774 5:171852291-171852313 ATCCCATCAGGAGGCCCAGGGGG + Intergenic
1001489462 5:172145307-172145329 ATCCCAGGACAAGGGTAAGAAGG + Intronic
1001790092 5:174448716-174448738 ATTTAAGCACAAGGCAAAGGGGG - Intergenic
1001951719 5:175821028-175821050 ATCCCAGGACAACCCCCAGGAGG - Intronic
1002730774 5:181330630-181330652 TTCCCAGCACATGGCCAGCGAGG - Intergenic
1002753757 6:143474-143496 TTCCCAGCACATGGCCAGTGAGG + Intergenic
1003302579 6:4897808-4897830 ATCCAGGCATGAGGCCAAGGCGG + Intronic
1003756652 6:9128509-9128531 ATCCTAGCAGAAGGTGAAGGGGG - Intergenic
1003918303 6:10807809-10807831 ATCCCAGCACTATGCATAGGAGG + Intronic
1004963690 6:20822492-20822514 ATCACAGCACCAGGCCAGAGTGG + Intronic
1006500682 6:34457100-34457122 AGCCAAGCATTAGGCCAAGGAGG - Intergenic
1006744236 6:36330316-36330338 AGGCCAGCAGGAGGCCAAGGGGG - Exonic
1006899613 6:37491396-37491418 AGCCCAGCACCAGGCCCCGGGGG - Intronic
1007177387 6:39906311-39906333 ATCCCAGCTCCAGGCCTGGGTGG + Exonic
1007276224 6:40676098-40676120 AGCCCAGCACCTGGCCCAGGTGG - Intergenic
1008613842 6:53207492-53207514 ATTCAAGCACAAGGCCCAGATGG + Intergenic
1010865859 6:80975968-80975990 ATTACAGCAAAAGGCAAAGGGGG - Intergenic
1011172122 6:84516837-84516859 ATTACAGCAGAAGGCAAAGGGGG - Intergenic
1013323627 6:109021687-109021709 ATCCCAGTAGGAGGCCAAGGCGG - Intronic
1014154357 6:118093596-118093618 ATCACAGCAGAAGGCAAAGGAGG - Intronic
1014343396 6:120236000-120236022 ATCACAGCAGAAGGCAAAGGGGG + Intergenic
1016606436 6:145934217-145934239 ATCCCAGCACGAGGCTGAGAGGG + Intronic
1017671245 6:156771396-156771418 CTCACTGCTCAAGGCCAAGGAGG - Intergenic
1018211982 6:161490940-161490962 ATCACAGCAGAAGGCAAAAGGGG - Intronic
1019201591 6:170320836-170320858 ATCCCCACAAAAGTCCAAGGGGG + Intronic
1020120135 7:5498505-5498527 ATCCCAGCACTTTGCCAGGGAGG - Intronic
1020239508 7:6382240-6382262 ATCCCAGCAAGAGGCCAAGGCGG - Intronic
1020869191 7:13606629-13606651 ATCATGGCACAAGGCAAAGGAGG - Intergenic
1022025931 7:26447922-26447944 CTCTCAGAACAAGGGCAAGGGGG - Intergenic
1022044107 7:26609740-26609762 AAGCCAGCAGAAGACCAAGGAGG - Intergenic
1022595282 7:31707669-31707691 ATCCAAGCACCAGTCCAAGTGGG + Exonic
1022717047 7:32908040-32908062 AGCCCAGCACAAGGGCTTGGAGG - Intergenic
1023401939 7:39797160-39797182 TTCCCAGCACATGGCCAGCGAGG - Intergenic
1023866176 7:44239408-44239430 AGCCCACCACAAGGGCAGGGAGG - Intronic
1023966372 7:44965022-44965044 GCCCCAGATCAAGGCCAAGGTGG - Exonic
1024093211 7:45964728-45964750 ATGCCAGCACCACCCCAAGGAGG - Intergenic
1024654545 7:51439563-51439585 ATCATGGCACAAGGCAAAGGGGG - Intergenic
1025051516 7:55737994-55738016 TTCCCAGCACATGGCCAGTGAGG + Intergenic
1025071576 7:55904212-55904234 ATCCCAGCACCAGGCCGAGGCGG + Intronic
1025128479 7:56363661-56363683 TTCCCAGCACATGGCCAGTGAGG + Intergenic
1026178307 7:68016911-68016933 ATCACAGCACACAGCCCAGGAGG - Intergenic
1026569255 7:71515053-71515075 ATCACAGCAAAAGGTGAAGGAGG - Intronic
1026688498 7:72532987-72533009 ATCTCAGTGGAAGGCCAAGGAGG - Intergenic
1026723732 7:72854878-72854900 ATCTCAGTGGAAGGCCAAGGAGG - Intergenic
1026866151 7:73825212-73825234 CACCCAGCACCAGGCCGAGGGGG + Intronic
1027271302 7:76520588-76520610 ATCCCAGCGGGAGACCAAGGTGG - Intergenic
1027321066 7:77010523-77010545 ATCCCAGCGGGAGACCAAGGTGG - Intergenic
1027498122 7:78913400-78913422 ATCACGGCAGAAGGCAAAGGGGG - Intronic
1028667914 7:93367995-93368017 CTCACAGCAGAAGGCAAAGGGGG - Intergenic
1030111845 7:106033489-106033511 ATGCCAGCACTTTGCCAAGGTGG + Exonic
1030292949 7:107890357-107890379 AGCCCAGCACAAGGCCTGGGTGG + Intergenic
1031346528 7:120673759-120673781 ATGCCATCACTAGGCCATGGAGG - Intronic
1032052451 7:128657552-128657574 TTCCCAGCACATGGCCAGTGAGG - Intergenic
1032515286 7:132502211-132502233 AGGCCAGCCCAAGTCCAAGGGGG + Intronic
1032587435 7:133160178-133160200 ATGCCAGAAAAAGGCAAAGGCGG - Intergenic
1033786988 7:144743854-144743876 ATCCTGGCAGAAGGCAAAGGAGG - Intronic
1035291335 7:157841081-157841103 CTCCCAGCACAGGGCAGAGGCGG + Intronic
1035398426 7:158549957-158549979 ACCCCAGGACGAGGGCAAGGGGG - Intronic
1035864863 8:3071001-3071023 ATCATGGCAGAAGGCCAAGGGGG + Intronic
1036567562 8:9950558-9950580 ATCCCAGAAGAAGGCCCTGGTGG - Intergenic
1037406196 8:18545369-18545391 AAACCATCACAAGGCCAAGCTGG - Intronic
1038021815 8:23557488-23557510 ATCACAGCAGGAGGCCCAGGAGG - Intronic
1039304034 8:36241741-36241763 ATCATAGCAGAAGGCAAAGGAGG + Intergenic
1039584372 8:38693663-38693685 ATCATAGCAGAAGGCAAAGGAGG - Intergenic
1039923149 8:41907011-41907033 ATCCCAGCCCAGGGCCCAGTGGG + Intergenic
1039929772 8:41974324-41974346 ATCCTAGCACTTTGCCAAGGTGG - Intronic
1040514468 8:48123479-48123501 ACCCCAGCCCAGGGCCTAGGGGG - Intergenic
1041315956 8:56562778-56562800 ATCACAGCAGAAGGCCAAGAGGG - Intergenic
1041682076 8:60604184-60604206 ATCATGGCACAAGGCAAAGGGGG - Intronic
1041765121 8:61411311-61411333 TTCACAGCACAGGGCCAGGGTGG - Intronic
1042042707 8:64610200-64610222 AACTCAGCACAAAGCTAAGGTGG - Intronic
1042412853 8:68484105-68484127 ATCATGGCACAAGGCCAAGCAGG + Intronic
1043160516 8:76840889-76840911 CTCCCAGCACCAGGCCACGCTGG - Intronic
1049553939 8:143273115-143273137 GTCCCAGCGCAGGGCAAAGGTGG + Intronic
1050120556 9:2303062-2303084 ATCACGGCAGAAGGCAAAGGAGG + Intergenic
1051668569 9:19488239-19488261 ATCCCAGAACAAGGGGAAGCTGG - Intergenic
1053517579 9:38744155-38744177 ATTCCAACACATGGCCAAGACGG + Intergenic
1055179562 9:73367656-73367678 ATCATGGCACAAGGCAAAGGAGG + Intergenic
1056658621 9:88528854-88528876 TTCCCAACACAAGGACAAGTGGG + Intergenic
1056847852 9:90056063-90056085 TTCCAAGAGCAAGGCCAAGGTGG - Intergenic
1058307601 9:103463146-103463168 ATCACAGCAGAAGGCAAAGAAGG + Intergenic
1058453583 9:105119026-105119048 CCCCAAGCACAAGGACAAGGGGG + Intergenic
1058892847 9:109375522-109375544 ACCCCAGGACAAGGCCAAGATGG + Intronic
1059443251 9:114322864-114322886 ATGGCTGCCCAAGGCCAAGGTGG - Intergenic
1059444443 9:114329635-114329657 ATGGCTGCCCAAGGCCAAGGTGG - Intergenic
1059994458 9:119895026-119895048 ACCCTAGCACAAGTCCAAGCAGG + Intergenic
1061671102 9:132188600-132188622 CGCCCAGCACAGGGCCGAGGTGG + Intronic
1061862375 9:133474690-133474712 ATCCCAACACGAGGCCAAGGCGG - Intronic
1062347313 9:136120959-136120981 ACCCAAGCCAAAGGCCAAGGAGG + Intergenic
1062406227 9:136397883-136397905 AGCCCTGCACAGGCCCAAGGAGG + Intronic
1062547880 9:137071785-137071807 AACCCAGCACGAGGCCGAGGCGG + Intergenic
1062755182 9:138283137-138283159 TTCCCAGCACATGGCCAGCGAGG - Intergenic
1203579093 Un_KI270745v1:27309-27331 TTCCCAGCACATGGCCAGCGAGG - Intergenic
1185820565 X:3199005-3199027 ATCACAGCAGAAGGTGAAGGAGG - Intergenic
1186203526 X:7177761-7177783 ATCCCAGCACTTTGCCGAGGTGG - Intergenic
1186697770 X:12055477-12055499 ATCACGGCAGAAGGCAAAGGGGG - Intergenic
1187081862 X:15998484-15998506 ATCACGGCAGAAGGCAAAGGGGG + Intergenic
1187091212 X:16098752-16098774 ATCATGGCACAAGGCCAAGCTGG - Intergenic
1187140102 X:16585292-16585314 ATCAAAGAACAAGGACAAGGGGG - Intergenic
1188090554 X:25959303-25959325 ATCCCAGCTGAAGGCAAATGAGG - Intergenic
1188137281 X:26505122-26505144 ATCCCAGCACCAGGTAGAGGGGG - Intergenic
1189324640 X:40105224-40105246 ATCCCAGCGCAAGCCGAAAGCGG + Intronic
1189570731 X:42293277-42293299 ATCATAGCAGAAGGCAAAGGGGG - Intergenic
1189656501 X:43250451-43250473 ATCACAGCAAAAGGTAAAGGAGG + Intergenic
1189988122 X:46571736-46571758 ATCCCAGCACAAGGCCGAAGTGG + Intergenic
1190295234 X:49022691-49022713 ATCCCAACAAAAGGCTGAGGTGG - Intergenic
1192295457 X:69842872-69842894 ATCATAGCAGAAGGCAAAGGTGG - Intronic
1194273966 X:91857124-91857146 ATCATGGCACAAGGCAAAGGAGG + Intronic
1194329390 X:92562098-92562120 ATCATAGCAAAAGGCAAAGGGGG + Intronic
1194401190 X:93439661-93439683 CTGCCACCACCAGGCCAAGGAGG + Intergenic
1195525780 X:105888690-105888712 ATCACGGCAGAAGGCAAAGGAGG + Intronic
1195649582 X:107271197-107271219 ATCCCAGCACTTGGCCAAGGCGG - Intergenic
1195898150 X:109769635-109769657 ATCCCAGCACTATGGCAGGGAGG + Intergenic
1197970526 X:132110477-132110499 ATCCCAGCAGAAGGCAAAAGGGG - Intronic
1198461455 X:136866592-136866614 TAGCCAGCTCAAGGCCAAGGTGG - Intronic
1199003171 X:142663932-142663954 ATTACAGCAGAAGGCTAAGGAGG - Intergenic
1200591203 Y:5078541-5078563 ATCATGGCACAAGGCAAAGGAGG + Intronic
1200638089 Y:5681288-5681310 ATCATAGCAAAAGGCAAAGGGGG + Intronic
1201651115 Y:16288178-16288200 ATCCCAGCAGGAGGCTTAGGAGG + Intergenic
1202381706 Y:24279929-24279951 TTCCCAGCACATGGCCAGTGAGG - Intergenic
1202489079 Y:25390197-25390219 TTCCCAGCACATGGCCAGTGAGG + Intergenic