ID: 1184053522

View in Genome Browser
Species Human (GRCh38)
Location 22:42027228-42027250
Sequence CTAAAATTGAAGTCAGGATA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184053516_1184053522 7 Left 1184053516 22:42027198-42027220 CCTTGAAGACTCACCAAGCAAAG 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1184053522 22:42027228-42027250 CTAAAATTGAAGTCAGGATAAGG 0: 1
1: 0
2: 1
3: 18
4: 228
1184053515_1184053522 23 Left 1184053515 22:42027182-42027204 CCTTCTAAGATGTAAACCTTGAA 0: 1
1: 0
2: 3
3: 13
4: 210
Right 1184053522 22:42027228-42027250 CTAAAATTGAAGTCAGGATAAGG 0: 1
1: 0
2: 1
3: 18
4: 228
1184053518_1184053522 -6 Left 1184053518 22:42027211-42027233 CCAAGCAAAGAGGTACCCTAAAA 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1184053522 22:42027228-42027250 CTAAAATTGAAGTCAGGATAAGG 0: 1
1: 0
2: 1
3: 18
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184053522 Original CRISPR CTAAAATTGAAGTCAGGATA AGG Exonic
902314264 1:15606037-15606059 CTTAATTTTAAGTCAGGATGGGG - Intergenic
905027430 1:34860381-34860403 ATAAAATTGATGTCTGTATAGGG - Intergenic
907886091 1:58593551-58593573 CTAAAATTGAATTTAGGCAAGGG + Intergenic
908144899 1:61230513-61230535 CTAAAATTGAAGGAAACATAGGG - Intronic
908679464 1:66643807-66643829 CTTAAATTGAAGCCTGCATATGG + Intronic
909232528 1:73108110-73108132 CTTAAATGGAAGTTATGATATGG + Intergenic
909421708 1:75474134-75474156 CTAAGATTCAAGGCAGGAGATGG + Intronic
909779597 1:79526391-79526413 TTTAACTTGAAATCAGGATATGG + Intergenic
910150394 1:84135990-84136012 ATAAAATTCTAGCCAGGATAAGG + Intronic
910156306 1:84224243-84224265 CTAAAATTGATGCCAGTGTATGG - Intronic
910334633 1:86113346-86113368 ACAAAATTGAAGTAAGCATAGGG - Intronic
910916081 1:92290956-92290978 TTAAAATTGAAGTAGGAATAGGG - Intronic
911456640 1:98132638-98132660 CTAAAATAGAAGTATAGATAGGG - Intergenic
912048969 1:105499132-105499154 CTCTTATTGAAGTCAGGACAAGG - Intergenic
916200712 1:162268767-162268789 CTAAAAAAGAAGTCAGTAGAAGG + Intronic
917258957 1:173147153-173147175 CAAAAATAGAATTCAGAATATGG - Intergenic
921661570 1:217808888-217808910 ATATTATTGAAGTAAGGATAAGG + Intronic
921800575 1:219398530-219398552 CCAAAATAGAATTCAGAATATGG - Intergenic
923359631 1:233198244-233198266 CTAATATGGAAGACAGGATTTGG + Intronic
924048067 1:240052723-240052745 GCAAGATTGAAGTCAGGGTATGG + Intronic
1063857341 10:10269984-10270006 AGAAAATTGAAATTAGGATAAGG + Intergenic
1064732625 10:18348426-18348448 CTAAATTTGAACTCAGAAAAAGG + Intronic
1065284999 10:24179248-24179270 TTAAAATTGAAGACAAGATTTGG - Intronic
1067023727 10:42825831-42825853 CTAAGATTGAATACAAGATAGGG - Intronic
1067400048 10:45964088-45964110 CTGACATTGAATTCAGGAAACGG - Intergenic
1068614057 10:59092328-59092350 CTAAAATTGGAGTCTGATTAGGG - Intergenic
1069392813 10:67954324-67954346 CTCAAATTGAAATCAGCAGAAGG + Intronic
1070019835 10:72573974-72573996 AGAAATTTTAAGTCAGGATAAGG - Intronic
1071820147 10:89271601-89271623 TTAATATTGATTTCAGGATATGG - Intronic
1071877510 10:89857459-89857481 ATAAAGTAGAAGTCAGGATAAGG + Intergenic
1071882048 10:89910368-89910390 CAGAAATAGAATTCAGGATACGG - Intergenic
1072402724 10:95122045-95122067 CTAAAAAGGCAGTCTGGATAAGG + Intergenic
1074843791 10:117379139-117379161 CTAAAATTGGATTCACGTTAAGG + Intergenic
1076576087 10:131469359-131469381 ATAAAATTGAAAACAGGAAATGG - Intergenic
1077432116 11:2520870-2520892 CTAAAGCCGAAGGCAGGATAGGG - Intronic
1080019276 11:27543207-27543229 CTAAAATTCAAGTAAGGGTGGGG + Intergenic
1080439435 11:32277645-32277667 CTAAAATGTAATTCAGTATAAGG + Intergenic
1080824267 11:35834738-35834760 TTAAAATTAAAGTCAGATTATGG - Intergenic
1081343814 11:41957888-41957910 CAGAAATAGAATTCAGGATATGG + Intergenic
1086103249 11:83123565-83123587 TGAAAATTGAAGGGAGGATAAGG + Intergenic
1086868457 11:92008665-92008687 CTAATATTGAAACCAGGAAAGGG - Intergenic
1090390734 11:126385714-126385736 TTAAAAGTGAATTCAGGACAGGG + Intronic
1090556601 11:127883196-127883218 GTAAAATTCAAGGCAGGATGTGG - Intergenic
1093490858 12:19701954-19701976 CAGAAATTGAATTCAGAATATGG + Intronic
1093890443 12:24513639-24513661 CTATAATTAAAGTCAGAATGGGG - Intergenic
1093985990 12:25534052-25534074 CTAAACTTGAAGCCAAGGTAAGG + Intronic
1094167846 12:27460875-27460897 TTGAAATTGATGTCAGGACATGG - Intergenic
1094303953 12:28997011-28997033 CTTAAATTGAACAGAGGATAAGG + Intergenic
1094518128 12:31154665-31154687 AAAAAATTGAATTCAGGGTAAGG + Intergenic
1094604284 12:31937165-31937187 CCCAAAATCAAGTCAGGATAAGG - Intergenic
1094693716 12:32795722-32795744 CTAAGATGGAAGTGAGGAAAAGG + Intronic
1097351611 12:58555246-58555268 CTAGAATTGGAGACAGGGTAGGG + Intronic
1097618707 12:61914174-61914196 GTAGAATTTCAGTCAGGATAAGG + Intronic
1099286939 12:80724900-80724922 ATTAAATTGAAGTCATGATATGG + Intergenic
1099749763 12:86757854-86757876 TTAAAATTGAGGTGAGGCTATGG - Intronic
1100029500 12:90168636-90168658 CTACAATTGAAGACAAGATTTGG + Intergenic
1101945196 12:109131155-109131177 CTAAGCTTGAGGTCAGGAGAAGG + Intronic
1106530015 13:30582047-30582069 CTAAAAGTGAACTCAGCATCAGG + Intronic
1107185907 13:37519796-37519818 CTAAAATTGCAGTGAGAATCAGG - Intergenic
1107283128 13:38758747-38758769 CTAAAATTAAAGTTAAAATAAGG - Intronic
1108775732 13:53762605-53762627 CCAAAATAGAATTCAGAATATGG + Intergenic
1108795461 13:54024495-54024517 CCGAAATAGAATTCAGGATATGG + Intergenic
1110675708 13:78240997-78241019 CTAAAAGTGAAGACAGGTCAAGG + Intergenic
1111042384 13:82766562-82766584 CTAAAATTCAAGACAAGATTTGG - Intergenic
1111417095 13:87962045-87962067 ATTAAATTGAAGTCAAGTTATGG + Intergenic
1111941621 13:94614423-94614445 CAAAAATGGAAGCCTGGATAAGG - Intronic
1113526268 13:110980274-110980296 CTAAAATTGAGGTGATGAGAGGG + Intergenic
1115779536 14:36754158-36754180 GTAACATTTAAGTCAGGAGATGG + Intronic
1119635402 14:76269331-76269353 CTAAAGCTGAAGTCAGGAGTGGG + Intergenic
1119763762 14:77174855-77174877 GAAAGACTGAAGTCAGGATAGGG + Intronic
1120144740 14:80967583-80967605 CTAAAATGTAAGTCAGGTCAGGG - Intronic
1120244591 14:81992134-81992156 CTAATTCTGAAGTCAGGATAGGG + Intergenic
1120822243 14:88922692-88922714 CTGAAGGTGAAGTCAGGAAAGGG - Intergenic
1121981203 14:98456046-98456068 CAAAAATTGAAAGCAGGATTTGG - Intergenic
1122535080 14:102456307-102456329 CTAAAGTTCAGGGCAGGATAAGG - Intronic
1125425353 15:39543185-39543207 CTAAAATAGAACTTAGGAGATGG + Intergenic
1125860955 15:42999491-42999513 CTAAAATGGACGTAAGGACAGGG + Intronic
1128744442 15:70103634-70103656 CTGAAATGGGAGTCGGGATAGGG - Intergenic
1129588651 15:76894517-76894539 CTAAATCTAAAGTCAGCATAAGG + Intronic
1131244845 15:90782030-90782052 CTGAAATGGAAGTAAGGCTAAGG - Intronic
1131775537 15:95793724-95793746 CTTAAATTGTTGGCAGGATATGG - Intergenic
1138878974 16:60987630-60987652 CCAAAATTGAAGTAAGGAGAGGG + Intergenic
1145188336 17:20815763-20815785 ATCAATTAGAAGTCAGGATATGG + Intergenic
1146372227 17:32272330-32272352 CTACAAATGAAGTCAGGCCAAGG - Intronic
1146548243 17:33757540-33757562 CTTAAATTGAAGTAAGGAGCTGG - Intronic
1146592121 17:34136496-34136518 CAAGAGTTGAAGTCAGCATAAGG - Intronic
1146633482 17:34487256-34487278 CTGAAATGGAAGTGAGGAGAGGG - Intergenic
1146911000 17:36648469-36648491 CTCCAATTGAAGTCAGCCTATGG + Intergenic
1148405280 17:47408324-47408346 CTAAATTTAAAGGCAGGAAATGG - Intronic
1149361400 17:55899346-55899368 CTAAGCAGGAAGTCAGGATAGGG - Intergenic
1150074118 17:62178219-62178241 AGAAAATGGAAGTGAGGATAGGG + Intergenic
1150078569 17:62215908-62215930 ATCAATTAGAAGTCAGGATATGG - Intergenic
1154079046 18:11236104-11236126 CTAATATTGAAGTATGGAGATGG - Intergenic
1158843383 18:61413017-61413039 CAAAAAATGAAGTCAGGAGACGG + Intronic
1159345286 18:67194373-67194395 ATAAAACTGAAGTCAAGGTAGGG + Intergenic
1159522891 18:69548480-69548502 CAAAATTGTAAGTCAGGATATGG - Intronic
1162625884 19:11884670-11884692 GTGAAATTGACGTCAGGAGAAGG - Intergenic
926865418 2:17351886-17351908 GTAAAATTGAAGTGAGGAAAAGG + Intergenic
927420635 2:22926865-22926887 CTAAAATCAAGGTCAGGGTAGGG + Intergenic
928581862 2:32716425-32716447 CTAAAAATGAACTCAGAATTGGG - Intronic
928713191 2:34030534-34030556 CTAAAAGTGAATACAGGATTTGG + Intergenic
928965659 2:36972327-36972349 CTAAATTTGAAGTCTGGTAATGG + Intronic
930447033 2:51486994-51487016 GTAAAAGTGAAGTTAGGTTAGGG - Intergenic
931309859 2:61067389-61067411 CTAAAATGGAATTCAGGGCAAGG - Intronic
931329038 2:61260570-61260592 ATCAAATTGAAGTCAAGATATGG + Intronic
931629979 2:64289974-64289996 CTGAAAGTCAAGTCAGGATATGG - Intergenic
933128809 2:78646775-78646797 CTAAAATTGAAGTGAGTACAGGG + Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
936812158 2:116414591-116414613 CAAAAATAGAATTCAGAATATGG + Intergenic
939274975 2:139989415-139989437 CAAAAATAGAATTCAGAATATGG - Intergenic
939588934 2:144039686-144039708 CTCAAACAGAAGTCAGGAAAAGG - Intronic
939603729 2:144226469-144226491 CTAAATTTGAACTCAGAATTGGG - Intronic
941093549 2:161208621-161208643 CTTATGTTGAAGTCAGGATGTGG + Intronic
941501132 2:166278196-166278218 CTAAACTTAAAGTCACAATAAGG + Exonic
942506274 2:176644852-176644874 GTAAAAATGAAATAAGGATAAGG - Intergenic
943295887 2:186138218-186138240 TCAAAATTGAGGTCAGGATTAGG - Intergenic
943997909 2:194795706-194795728 TTAAAACTGCAGTCAGTATATGG + Intergenic
944024557 2:195147743-195147765 AGAAAAGTGAAGTCAGTATACGG + Intergenic
945165656 2:206940856-206940878 CTGAAATTGAACTGAAGATAAGG - Intronic
945618213 2:212100211-212100233 CTATAATTGAGGCCAGGATAAGG - Intronic
945663324 2:212712632-212712654 CTGAAGTTGAAGAAAGGATAAGG + Intergenic
946896648 2:224330832-224330854 CAAAAATTGAATTCAGCACAGGG - Intergenic
947139838 2:227010518-227010540 AAAAAATTGAAGGCAGGTTAGGG + Intronic
1169298831 20:4424364-4424386 CTAAATTTGGAGGCAGGGTAGGG - Intergenic
1170296139 20:14828402-14828424 CTAAAAGTGAAGTGAGAATCAGG - Intronic
1174514998 20:51084961-51084983 TTAAAATTTAATTCAGAATATGG - Intergenic
1177627720 21:23685443-23685465 CAAAAGTTAAAGTCAGGAAATGG - Intergenic
1178451583 21:32706320-32706342 TAAAAATTGAAGAGAGGATAAGG + Intronic
1182259083 22:29059962-29059984 CTAAAGTTGAAGACAGAATGTGG - Intronic
1184053522 22:42027228-42027250 CTAAAATTGAAGTCAGGATAAGG + Exonic
949367593 3:3300024-3300046 ATAAATTGGAAGTCAGCATAAGG + Intergenic
949742917 3:7257048-7257070 TTAAAATTGGAGGCAGGAAATGG - Intronic
951763577 3:26171746-26171768 ATAAAATAGAAGTGAGGATTGGG - Intergenic
952361623 3:32635974-32635996 TTAAAATGGAAGTCAGGATGGGG + Intergenic
954350154 3:50036619-50036641 CTAACATTGAAGACATGCTATGG - Intronic
957311889 3:78530770-78530792 CTAAAATTTAAGATAGGATTTGG + Intergenic
957891637 3:86366280-86366302 CTATAACTGAAGTCAGGGGATGG + Intergenic
958044060 3:88262306-88262328 CTAAAATTAAAATGAGAATAAGG - Intergenic
958148373 3:89657400-89657422 CTGAAATAGAATTCAGAATATGG - Intergenic
958788948 3:98629450-98629472 CTACAATTGGAGTCACCATATGG + Intergenic
958888164 3:99752502-99752524 CAGATATAGAAGTCAGGATAGGG - Intronic
959210902 3:103379165-103379187 ACAAAATTTAAGTCAGGGTATGG - Intergenic
959329113 3:104979541-104979563 CTAAAATTGAGATCAAGACAAGG + Intergenic
959603632 3:108218607-108218629 TCAAAATTAAAGTCAGGTTATGG - Exonic
959642219 3:108654528-108654550 CTATAATTAAAGCCAGGAAATGG - Intronic
963617137 3:147555521-147555543 CTAATATAGAAGCCAGGATAAGG - Intergenic
963827759 3:149972148-149972170 CTAAAATTGAAGTCATTGTTGGG - Intronic
964996474 3:162888505-162888527 CATAAATTGAAGTAAGCATAGGG - Intergenic
965435140 3:168640969-168640991 CAAAAATTGCAGTCAGAAAAGGG + Intergenic
969827040 4:9765742-9765764 CTAAAATTGAAGTGTTGCTAGGG - Intergenic
970638492 4:18036916-18036938 CTAAAATTGAAGTGAAGAATTGG - Intergenic
970969124 4:21961055-21961077 CAAAAGCTGAAGACAGGATAAGG + Intergenic
971833141 4:31724812-31724834 CTAAGAATGAAGTCAACATATGG + Intergenic
972269956 4:37501733-37501755 CAGAAATAGAATTCAGGATATGG - Intronic
974390986 4:61267791-61267813 CTCAAATTGGAGTTAGGGTATGG + Intronic
975123602 4:70756699-70756721 CTAAAATTGAAGGAAAAATAGGG + Intronic
976461606 4:85319280-85319302 TTAAAATTGAACTCAGGGGAAGG - Intergenic
978337495 4:107685403-107685425 CTAAAATTAAAGTAAGTAAAAGG + Intronic
978952780 4:114581508-114581530 CAAAAATAGAATTCAGAATATGG - Intergenic
979077679 4:116294755-116294777 CTAAAATTGATAACAGAATAAGG - Intergenic
980257509 4:130401873-130401895 CTGAAATAGAATTCAGAATATGG - Intergenic
982586127 4:157242205-157242227 CTAAAAAGGCAGTCAGGTTAAGG + Intronic
982593317 4:157344892-157344914 CTAAAATAGAATTCAGAATTTGG + Intronic
986167814 5:5291116-5291138 GTAAAAATGATGTCATGATATGG - Intronic
986696093 5:10355560-10355582 GTAAAATTATAATCAGGATAAGG + Intronic
987159868 5:15131530-15131552 CAGAAATTGAATTCAGAATATGG - Intergenic
987606404 5:20141525-20141547 GTAAAAGTGAGGTCAGGAGAAGG + Intronic
987801260 5:22699808-22699830 CTAAAATTTAATTCAAAATAGGG + Intronic
988063346 5:26202674-26202696 CAAAAATTGCAATCAGGATCTGG + Intergenic
991161154 5:63504879-63504901 CAGAAATAGAACTCAGGATATGG - Intergenic
992999003 5:82361236-82361258 GTAAAACTGAGTTCAGGATATGG - Intronic
993311592 5:86338913-86338935 CAAAAATAGAATTCAGAATATGG + Intergenic
994407116 5:99359083-99359105 AAAAAATTGAAATCAGGATTTGG + Intergenic
994520603 5:100829450-100829472 CTAAAATAGAATTCAGGCAAAGG - Intronic
994642947 5:102433241-102433263 CTGAAATAGAATTCAGAATATGG - Intronic
995089388 5:108154883-108154905 CAAAAAATGAAGTCAAGAAACGG + Intronic
995132544 5:108645823-108645845 TTAAAAAGCAAGTCAGGATAAGG - Intergenic
995241310 5:109887624-109887646 CTAGATTTGAAGTCAGGAGAAGG + Intergenic
995648543 5:114341591-114341613 ATAAAAAAAAAGTCAGGATATGG + Intergenic
996033767 5:118735189-118735211 CTCAAGGTGAAGTCAGGATTTGG + Intergenic
996168342 5:120255358-120255380 CTAAAAGTGAAGAAAGGATGTGG - Intergenic
996926660 5:128834923-128834945 TTAGAATTCAAGTCTGGATATGG + Intronic
998507151 5:142681282-142681304 CTAAATTTGAAGTCAAGATTGGG - Intronic
999033729 5:148322925-148322947 CTGAAATTGAAGTCTAGATTTGG + Intronic
999130476 5:149279146-149279168 CTAAAGTTGAAGTGGGGACATGG + Intronic
1002951393 6:1815840-1815862 CAAGAATTGACATCAGGATAAGG - Intronic
1004104737 6:12655697-12655719 ATAAAATAGAAGTCAGGATGTGG + Intergenic
1004745337 6:18503387-18503409 GGAAAATTGAAATCAGGATGTGG + Intergenic
1007459455 6:42007379-42007401 GTCCAATTGAAGTCAGGACAAGG + Intronic
1007962429 6:45972374-45972396 CTAACAAAGAAGACAGGATATGG - Intronic
1009469062 6:64009704-64009726 ACAAAATTGAATTCAGAATACGG - Intronic
1009915534 6:69990888-69990910 CTAAAATAGAAGTCAGAAAAAGG - Intronic
1010131309 6:72497050-72497072 CTAAAATTGGAGGCAGAAGAAGG - Intergenic
1011370029 6:86627019-86627041 CTAAAATTGAAGTCACACTCTGG - Intergenic
1011564751 6:88663073-88663095 CTAAAATCAAAGTATGGATAAGG - Intronic
1012880272 6:104779052-104779074 GTAAAGTTGGAGACAGGATAAGG + Intronic
1013373296 6:109489259-109489281 CTAGAATTTATTTCAGGATATGG - Intergenic
1013395097 6:109728267-109728289 CTAAAAGTGAATTCAGAAGAAGG + Intronic
1013403597 6:109822179-109822201 TTACTATAGAAGTCAGGATAAGG + Intronic
1015747106 6:136521898-136521920 TATAAATTGAAGTCAGGAAAGGG - Intronic
1018410686 6:163543942-163543964 GTAAAATTAAAGTCAGTATCTGG - Intronic
1018987975 6:168652213-168652235 CTAAAATTGATGGCAGTAAATGG + Intronic
1019033022 6:169029881-169029903 CTAAAATAGAAGACAAGATGGGG - Intergenic
1020882779 7:13783277-13783299 AAAAATTTGAAATCAGGATATGG + Intergenic
1021006739 7:15405543-15405565 CTAGAATTGAAGCAAGGGTAGGG - Intronic
1021387101 7:20044771-20044793 ATAAAATAGAAGTAAGGGTATGG + Intergenic
1023464584 7:40440081-40440103 CTATAATTGAAGTCATCACATGG - Intronic
1026877470 7:73887723-73887745 CTAAGATTGGAGTCAGGTCAGGG + Intergenic
1028253225 7:88559717-88559739 ATAAAATTCAAGTCAAGATTTGG - Intergenic
1028338693 7:89691284-89691306 ATAAAATTGAAGTCATTAAAAGG - Intergenic
1028938376 7:96490929-96490951 ATAAAACTGAATTCAGGATTAGG + Intronic
1031133108 7:117856030-117856052 ATAATATTGAAATCAAGATAGGG + Intronic
1034206531 7:149320748-149320770 CCAAAATACAAGTCAGGAGAGGG + Intergenic
1037658760 8:20909397-20909419 TCAAAATTGAAGATAGGATAGGG - Intergenic
1041594020 8:59624735-59624757 CTAAACTGGAAGACAGGATGAGG - Intergenic
1042624751 8:70745532-70745554 CTAAAAAGAAACTCAGGATAGGG - Intronic
1045170158 8:99656888-99656910 TGAAAATTGAATGCAGGATAGGG - Intronic
1047271283 8:123361659-123361681 ACAAAATTGAAATCATGATAAGG + Intronic
1048002530 8:130390945-130390967 CCAAAATTGAAAGCAGGATCTGG + Intronic
1048131459 8:131702266-131702288 CTAAAACTAAAGTCATGATTTGG + Intergenic
1048518765 8:135135110-135135132 CTCAAAGTGAAGTTTGGATAGGG - Intergenic
1048727382 8:137401472-137401494 CAAAAATCGAATTCAGGATACGG + Intergenic
1049911627 9:274379-274401 CTGAAGTTGAAGTCAAGAGATGG - Intronic
1050309469 9:4338545-4338567 CCAAACTTGAAGTCAAGATGTGG + Intronic
1052028561 9:23602408-23602430 TTAAAAATGAAGTTAGCATAAGG - Intergenic
1052114538 9:24634341-24634363 CTAAGACTGAAGTCAGCACAAGG - Intergenic
1052139150 9:24956360-24956382 CGAAAATAGAAGACAGGAAAAGG - Intergenic
1053455758 9:38232144-38232166 CTAAGCTTGAAGGCAGGGTAAGG - Intergenic
1057281908 9:93719316-93719338 CTAAAATTGAAGACACCAAAAGG + Intergenic
1059027568 9:110651886-110651908 TTAAATATGAAGTCAGAATAAGG + Intergenic
1187658056 X:21503556-21503578 ATAAAATTGAAGTAAGAACATGG - Intronic
1188471962 X:30550967-30550989 CTGAAATTGAAATCACGTTATGG - Intergenic
1189856070 X:45226347-45226369 GCAAAATTGAACTCAGTATAAGG - Intergenic
1191722662 X:64247730-64247752 CAAAAATAGAATTCAGAATATGG - Intergenic
1193299172 X:79868522-79868544 CAAAAATAGAATTCAGAATATGG + Intergenic
1193428852 X:81375132-81375154 CTAAAGATGAAGTCAGAAAACGG - Intergenic
1193851544 X:86543495-86543517 TAAAAATAGAATTCAGGATATGG + Intronic
1193864440 X:86713132-86713154 TTATAATTGAAATCAGGAGACGG + Intronic
1195203610 X:102573285-102573307 CTAGACTTGAAGTCAGCACAAGG + Intergenic
1195241605 X:102958616-102958638 CAAAAATAGAATTCAGAATATGG - Intergenic
1196356882 X:114805423-114805445 TTAAAATTGAAGTCAGGAAATGG - Intronic
1198215894 X:134554515-134554537 CTAAAATTAAAAACAGGATCTGG - Intergenic
1198681331 X:139185782-139185804 CCAAAACTAAAGTCAGGATCTGG + Intronic
1198685747 X:139226466-139226488 TTAAAATAGAAGTCACGGTATGG + Intergenic
1199525104 X:148783464-148783486 CTAAAATACAAGTCAGGAAAAGG - Intronic
1201379302 Y:13356055-13356077 CTAAAATTTAAGACAATATAAGG + Intronic
1201729784 Y:17191345-17191367 CTATTCTTGAAGCCAGGATAGGG - Intergenic
1202578127 Y:26349336-26349358 CTAGATTTGAAGTCAAGACAGGG - Intergenic