ID: 1184056556

View in Genome Browser
Species Human (GRCh38)
Location 22:42054903-42054925
Sequence ATCAATTAGCTATAGATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1053
Summary {0: 1, 1: 1, 2: 25, 3: 174, 4: 852}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184056553_1184056556 20 Left 1184056553 22:42054860-42054882 CCTGGGCAACAGAGTGAGACCTG 0: 98
1: 1493
2: 12861
3: 55199
4: 126867
Right 1184056556 22:42054903-42054925 ATCAATTAGCTATAGATGTATGG 0: 1
1: 1
2: 25
3: 174
4: 852
1184056555_1184056556 1 Left 1184056555 22:42054879-42054901 CCTGGTGTCTAAAAAAGAAAAAA No data
Right 1184056556 22:42054903-42054925 ATCAATTAGCTATAGATGTATGG 0: 1
1: 1
2: 25
3: 174
4: 852
1184056552_1184056556 24 Left 1184056552 22:42054856-42054878 CCAGCCTGGGCAACAGAGTGAGA 0: 21776
1: 73212
2: 167026
3: 221294
4: 302558
Right 1184056556 22:42054903-42054925 ATCAATTAGCTATAGATGTATGG 0: 1
1: 1
2: 25
3: 174
4: 852

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184056556 Original CRISPR ATCAATTAGCTATAGATGTA TGG Intronic
902656417 1:17872084-17872106 ATCAATTAGCCATAAATGTAAGG + Intergenic
903588334 1:24435100-24435122 ATCAACTGACCATAGATGTATGG - Intronic
904537818 1:31212145-31212167 ATCAATTGACAATAGATGTATGG - Intronic
905327259 1:37163210-37163232 ATCAGTTGGCCATAGATGTATGG + Intergenic
905593085 1:39181749-39181771 ATCAATTTACCATAAATGTAAGG - Intronic
906756250 1:48318961-48318983 ATCAGTTGACTATAAATGTATGG - Intronic
906896895 1:49784323-49784345 ATCAATTGACCATAAATGTAAGG - Intronic
907088591 1:51702941-51702963 ATCAGTTAGTTGTAGATGTGTGG + Intronic
907342231 1:53743628-53743650 ATCAGTTGGCCATAGATGTATGG - Intergenic
908074531 1:60501122-60501144 ATCAATTGGCTGTAGATGTGTGG - Intergenic
908397150 1:63736082-63736104 ATCAGTTCACTGTAGATGTATGG + Intergenic
908625525 1:66036616-66036638 ATCAATTGACTATTGATGTGTGG + Intronic
908942367 1:69451053-69451075 ATCAATTAGATGTAGATTTAGGG - Intergenic
909298199 1:73978606-73978628 ATCAATTGACTGTAGATATATGG + Intergenic
909381320 1:75002085-75002107 ATTAATTGGCCATAGATCTATGG + Intergenic
909437609 1:75661181-75661203 ATAAGTTAGCTATAAATGTGTGG - Intergenic
909571864 1:77122171-77122193 ATCAATGTGCTATAGCTGAAAGG - Intronic
910242874 1:85106727-85106749 ATCAGTTGGCCAAAGATGTATGG - Intronic
910347094 1:86251913-86251935 ATCAAATAACCATACATGTAAGG - Intergenic
910502759 1:87911921-87911943 ATCAATTGGCCATAAATGTAAGG + Intergenic
910795922 1:91097417-91097439 ATCAATTCCCCATAAATGTAAGG + Intergenic
910951192 1:92649980-92650002 ACCAACTGGCCATAGATGTATGG + Intronic
911239041 1:95445068-95445090 ATGAATTGGCTATAAATGTGTGG + Intergenic
911465524 1:98248053-98248075 ATCAATTGGCTGTAAATGTGTGG + Intergenic
911815609 1:102345859-102345881 ATCAATTAGCCATATATTCATGG - Intergenic
911831121 1:102552483-102552505 ATCAAATGGCTGTAGATGTGTGG - Intergenic
911937416 1:103995946-103995968 ATCAGTTGGCTGTAAATGTATGG + Intergenic
912320862 1:108711826-108711848 ATCAATTATCTATATATGCGTGG + Intergenic
912773120 1:112483323-112483345 ATCAGTTGACTATAGATGCATGG - Intronic
913179302 1:116304848-116304870 ATCAATTGACCATAAATGTAAGG + Intergenic
913301950 1:117380665-117380687 ATCAGTTGGCTATAGATGTATGG + Intronic
914439127 1:147687780-147687802 ATCAATTGACTATAAATGCATGG - Intergenic
915199818 1:154219215-154219237 ATCAGTTGGCAATATATGTAAGG + Intronic
915257950 1:154649695-154649717 ATCAGTTAACCATACATGTAAGG + Intergenic
915609006 1:156975861-156975883 ATCAATTGACCATAGATGTATGG + Intronic
915688461 1:157661759-157661781 ATGAATTTGCTATAAATGTGTGG + Intergenic
915772303 1:158440235-158440257 ATCAATTAACCACAGATGTCTGG - Intergenic
915967345 1:160322304-160322326 ATGAGTTAGCTATAGATTTGTGG - Intronic
916339573 1:163714772-163714794 ATCAATAGACTATAGTTGTATGG + Intergenic
916374607 1:164138756-164138778 ATCAATTAGCTATATATGCGTGG - Intergenic
916914583 1:169392441-169392463 GTCAGTTGGCCATAGATGTATGG - Intronic
917257409 1:173130564-173130586 ATCAGATAGCTGTAGATGTGTGG + Intergenic
917351169 1:174079460-174079482 ATGAATTGGCTATAAATGTATGG - Intergenic
917607942 1:176654352-176654374 ATCAGTTGGCTATAGATATAAGG + Intronic
917714950 1:177725412-177725434 ATCAGATAGCTATAGGTGTGTGG - Intergenic
917746073 1:178008696-178008718 ATCAGTTAACTATATTTGTATGG - Intergenic
917945305 1:179963635-179963657 ATCAACTGGTTATAGGTGTATGG + Intronic
918358360 1:183728368-183728390 ATAAATTGGCTATATATGTATGG - Intronic
918554207 1:185779644-185779666 ATCAGATGGCTATAGATGTGTGG + Intronic
920520842 1:206624419-206624441 ATCAATTATCCATAAATGTGAGG + Intergenic
920602405 1:207341551-207341573 ATCAGTTAGCTATAAATATGTGG + Intronic
921113251 1:212060319-212060341 ATCAATTGGCTGTAAATATATGG - Intronic
921310379 1:213836541-213836563 ATCAATTAGAAAGTGATGTAAGG - Intergenic
921455171 1:215362557-215362579 ATCAATTGGCCATAAATGCATGG + Intergenic
921709674 1:218361213-218361235 ATGAATGAGATAGAGATGTAAGG - Intronic
921809998 1:219501884-219501906 ATAAATTACCTCTAGATGTAGGG + Intergenic
922065890 1:222142573-222142595 ATAAGTTTGCTGTAGATGTATGG - Intergenic
922602595 1:226868423-226868445 ATCAATTGGCCATAGATGGATGG - Intergenic
923444570 1:234056957-234056979 ATCAGTTAACCATAGATGTATGG + Intronic
923855822 1:237844320-237844342 ATCAGATAGCTATAAGTGTACGG - Intergenic
924407818 1:243770103-243770125 ACCAATTAGCCATATATGTATGG + Intronic
924445976 1:244131676-244131698 ATCAGTTGGCTATAAATGCATGG + Intergenic
924762803 1:247005279-247005301 ATTAATTTGCTGTAGATGTATGG - Intronic
924898141 1:248364789-248364811 ATCAATTGACTATAAATGTGTGG - Intergenic
924908003 1:248477509-248477531 ATCAGTTAACTACAGATGAAAGG + Intergenic
1063761138 10:9078344-9078366 ATTGAAGAGCTATAGATGTAAGG + Intergenic
1063893613 10:10655565-10655587 ATCAATTAGTTGTAGATATGCGG - Intergenic
1064168709 10:13009610-13009632 ATCAGTTATCTATATATTTATGG - Intronic
1064775204 10:18769327-18769349 ATCATTTGACTATATATGTAAGG + Intergenic
1065091660 10:22241194-22241216 ATACATTGGCCATAGATGTAGGG - Intergenic
1066095196 10:32065613-32065635 ATCAGTTGGCTATAAATGTGTGG + Intergenic
1066115984 10:32240525-32240547 ATCAATTGACCATAGATGCATGG + Intergenic
1066134564 10:32431560-32431582 ATCAATTGACCATAGATGTGTGG + Intergenic
1066674082 10:37870311-37870333 ATCAGTTGACCATAGATGTATGG + Intergenic
1067197712 10:44136732-44136754 ATCAATTAGCCATCAATGCAGGG - Intergenic
1067244604 10:44527791-44527813 ATCAATTAGCCATAGAGGTATGG + Intergenic
1067959361 10:50830953-50830975 ATCAATTGGCCATAAATGTGTGG - Intronic
1068182776 10:53544155-53544177 ATCAATTGACTATAAATGCATGG + Intergenic
1068442177 10:57071796-57071818 TTCAATTATCTAGAGATTTATGG - Intergenic
1068503320 10:57867683-57867705 ATCTACAAGCTTTAGATGTAAGG + Intergenic
1068640579 10:59401006-59401028 ATCAGTTGGCTATAAATATATGG + Intergenic
1068709670 10:60120156-60120178 ATCAGTTCACTGTAGATGTATGG - Intronic
1069076962 10:64047994-64048016 ATAAATTTGCTATAAATGCATGG - Intergenic
1069215775 10:65818025-65818047 ATCAATTGACAATATATGTATGG + Intergenic
1069293900 10:66819185-66819207 ATCAATTGACCAAAGATGTATGG - Intronic
1069358863 10:67619310-67619332 ATCAGTTGGCTGTAAATGTATGG - Intronic
1069378070 10:67814202-67814224 ATCAATTGACTGTAAATGTAAGG - Intronic
1069616337 10:69808763-69808785 ACAAATTAGCTGTTGATGTAAGG + Intronic
1069751989 10:70750692-70750714 ATCACCTGGCCATAGATGTATGG - Intronic
1069803388 10:71098610-71098632 ATCAATTGACCATAGATGTATGG - Intergenic
1069804835 10:71114934-71114956 ATCAATTATCCATATATGTGTGG - Intergenic
1070014633 10:72513839-72513861 TTCAATTAACCATAGATGTGTGG + Intronic
1070058754 10:72960486-72960508 ATCATTTAACCATATATGTAGGG + Intergenic
1070244096 10:74713742-74713764 ATCAATTGACCATAGATGTATGG + Intergenic
1070346181 10:75544273-75544295 ACCAATTAACAATAAATGTAGGG - Intronic
1070995323 10:80774116-80774138 ATCAGTTGACTATAGATGTATGG + Intergenic
1071053791 10:81484925-81484947 ATGAAATAGATATAGATATATGG + Intergenic
1071110892 10:82154369-82154391 ATCAATTGACTATAAATGTGTGG + Intronic
1071355838 10:84793302-84793324 ATCAATTGACCATAAATGTATGG + Intergenic
1071744236 10:88397928-88397950 ATCAATTTACTATAGATATATGG - Intronic
1072059298 10:91793942-91793964 ATGAGTTCACTATAGATGTATGG - Intergenic
1072154428 10:92711636-92711658 ATCAATTAACTATAGACATATGG + Intergenic
1072363620 10:94685690-94685712 ATCAATTGATTATAGATGTGTGG + Intronic
1072373416 10:94789641-94789663 ATCAAATGGCTGTAGATGTGTGG + Intronic
1072384207 10:94907221-94907243 ATCAATTGACTATAGATGTGTGG + Intergenic
1072401191 10:95103038-95103060 ATCAATTGGCTATACATGTGAGG - Intergenic
1072771873 10:98147706-98147728 ATAAATTGGCTGTAAATGTATGG + Intronic
1073012023 10:100368113-100368135 ATCAATTGGCCATAGATGTATGG - Intergenic
1074288219 10:112118521-112118543 ATCAATTAACTGTAGCTGCATGG + Intergenic
1074444422 10:113507603-113507625 ATCAATTCACCAGAGATGTATGG + Intergenic
1074624724 10:115169120-115169142 ATCAATTGGCCATAGATGTGTGG + Intronic
1074631116 10:115255806-115255828 ATAAATTAGGTATTGATGGAAGG - Intronic
1074757917 10:116640316-116640338 ATCAGCTAGCTGTAGATGTATGG + Intronic
1074797142 10:116958568-116958590 ATCCATTGGCTCTAGATGTGTGG - Intronic
1074846328 10:117401917-117401939 ATCAATTGGCCATAAATGTGAGG + Intergenic
1074913184 10:117930791-117930813 ACCAATATGCTATATATGTAGGG - Intergenic
1075272686 10:121066627-121066649 ATCAATTGACTACAGATATATGG + Intergenic
1076984891 11:228471-228493 ATCAGTTGGCCATAGGTGTATGG - Intronic
1077447592 11:2605583-2605605 ATCAATTGACCATAGATATATGG + Intronic
1077656223 11:4021488-4021510 ATCAATTGGCTATACATATGTGG + Intronic
1077748161 11:4932325-4932347 ATCCATTAGTTATACATGAATGG - Intronic
1077865767 11:6220173-6220195 ATCTATTATCTATGGATGAAGGG + Intronic
1077971066 11:7191013-7191035 ATAAATTGACTATAGATATATGG - Intergenic
1078124632 11:8548405-8548427 ATAAATTGGCTGTAAATGTATGG + Intronic
1078361491 11:10672046-10672068 ATCAATTAACTATAAATGTAAGG - Intronic
1079706280 11:23623516-23623538 ATCAATTGCCTGTAGATGTGTGG + Intergenic
1079745206 11:24118602-24118624 ATCAATTGACTATATATGTGAGG - Intergenic
1079826906 11:25207422-25207444 ATCAGTTGGCTGTAGATATATGG - Intergenic
1079971873 11:27044731-27044753 ATCAGATGGTTATAGATGTATGG + Intronic
1080877234 11:36287908-36287930 ATCATTTAACTGTAAATGTATGG + Intronic
1080998039 11:37628880-37628902 ATCATTTGGCTATAAATGTATGG + Intergenic
1081062782 11:38501718-38501740 ATCAGTTAGCTATAGATATGTGG + Intergenic
1081126638 11:39331103-39331125 ATCAGATAGTTGTAGATGTATGG - Intergenic
1081407857 11:42718641-42718663 ATGAGTTCACTATAGATGTATGG - Intergenic
1081422578 11:42888583-42888605 ATGAATTCACTGTAGATGTATGG - Intergenic
1081531744 11:43965793-43965815 AACAATTGACTATAGATGTATGG - Intergenic
1081551552 11:44117608-44117630 ATCAACTGGCCATAGATATATGG + Intronic
1082111162 11:48276046-48276068 ATCAATTCACTCTAGATGTATGG + Intergenic
1082619916 11:55407496-55407518 ATCAGATGGTTATAGATGTATGG + Intergenic
1082860033 11:57846812-57846834 ATCAATTGGCTGTAAATATATGG - Intergenic
1083500342 11:63100746-63100768 ATCAGTTCACTGTAGATGTAGGG - Intronic
1083857923 11:65402404-65402426 ATCAATTGGCTGTACATGTGTGG + Intronic
1083914608 11:65732848-65732870 ATCAATTTGCCATAAATGTATGG - Intergenic
1084127497 11:67109618-67109640 AGGAATGAGGTATAGATGTAGGG + Intergenic
1085072278 11:73557860-73557882 ATTAATTGGCCAGAGATGTATGG - Intronic
1085365036 11:75933201-75933223 ATGAGTTAACTGTAGATGTATGG - Intronic
1085398942 11:76224027-76224049 GTCAATTGGCCATAGATGTATGG + Intergenic
1085485203 11:76857812-76857834 ATCAATTGACCATAAATGTAAGG + Intergenic
1086207765 11:84280672-84280694 AACAGTTATTTATAGATGTATGG - Intronic
1086829756 11:91545894-91545916 ATCAATTGGCCATAGATATGTGG - Intergenic
1086883733 11:92179757-92179779 ATCAATTGATCATAGATGTAGGG - Intergenic
1088021007 11:105119480-105119502 ATGAGTTCACTATAGATGTATGG - Intergenic
1088154651 11:106788700-106788722 TTGAGTTAACTATAGATGTATGG + Intronic
1088490636 11:110384082-110384104 ATCAGATAGCTGTAGATGTGTGG + Intergenic
1089154733 11:116392647-116392669 ATCAATTGGCCATAAATGTCGGG - Intergenic
1090109833 11:123895253-123895275 ATCAGTTAGCTATACATACATGG - Intergenic
1090130787 11:124139966-124139988 ACAAAATAGGTATAGATGTAAGG - Intronic
1090217868 11:124986154-124986176 ATCAATTGACTATAAATGTGAGG + Intronic
1090589756 11:128252769-128252791 ATCAGTTGGCTATAGAGATATGG - Intergenic
1091040485 11:132275334-132275356 ATCAATTGACTTTATATGTATGG + Intronic
1091300388 11:134503636-134503658 ATAAATGAGCGATTGATGTAGGG + Intergenic
1091964686 12:4728655-4728677 ATCAATTGGTGATAAATGTAAGG + Intronic
1092178605 12:6428655-6428677 ATTAATTGACAATAGATGTATGG - Intergenic
1092329710 12:7572825-7572847 ATGAAGTAGCCATAGATGTTGGG - Intergenic
1092667371 12:10817460-10817482 ATCAATTAGTCATAGATATATGG - Intergenic
1092742355 12:11642013-11642035 ATCAATAGGATATAGATGGATGG - Intergenic
1092803466 12:12195987-12196009 AGCAATTGGCTATAGATGCATGG + Intronic
1093531542 12:20170668-20170690 ATGAATTCACTGTAGATGTATGG + Intergenic
1093674551 12:21921868-21921890 ATAACTTCACTATAGATGTATGG + Intronic
1093676797 12:21950904-21950926 ATCAGTTGACTATATATGTATGG - Intergenic
1093727459 12:22531477-22531499 ATCAGTTGGACATAGATGTAAGG - Intronic
1093848369 12:24003990-24004012 ATCAATTGACTGTAAATGTAAGG - Intergenic
1093902863 12:24655693-24655715 ATGAGTTAACTGTAGATGTATGG + Intergenic
1095574943 12:43726238-43726260 ATCAAGTAGCTGTAGGTGTGTGG - Intergenic
1095713716 12:45318421-45318443 ATCAAATAGTTGTAGATGTGTGG + Intronic
1095781096 12:46060671-46060693 ATCAATTGGCCATAGTTGTATGG - Intergenic
1096015531 12:48270443-48270465 ATCAATTGACTATATTTGTATGG + Intergenic
1096484009 12:51964759-51964781 ATCAGTTAATCATAGATGTATGG + Intronic
1096849739 12:54427962-54427984 ATCATCTAGCTATTGATGCAGGG + Intergenic
1096953916 12:55505992-55506014 ATCAGATAGTTGTAGATGTATGG + Intergenic
1097431218 12:59509912-59509934 ATTAATTCACTGTAGATGTATGG - Intergenic
1097498075 12:60368022-60368044 ATCAATTAGCTGTAAATATGTGG - Intergenic
1098224316 12:68306106-68306128 ATCAGATAGCTGTAGGTGTATGG - Intronic
1098510731 12:71311213-71311235 ATCAGATAGTTATAGATGTGTGG + Intronic
1098566007 12:71936745-71936767 ATCAATTCCCTCTACATGTAAGG + Intergenic
1098691472 12:73494475-73494497 ATCAATTGACTATAGATGTCTGG - Intergenic
1098713916 12:73804180-73804202 ATCAATTGGCTATAGATATTTGG + Intergenic
1099235261 12:80075972-80075994 ATCAGATAGCTGTAGATATATGG + Intergenic
1099383543 12:81985553-81985575 ATCAGATAGCTGTAGATGTGTGG + Intergenic
1099547464 12:84002834-84002856 ATGAATTCACTGTAGATGTATGG + Intergenic
1099835507 12:87906322-87906344 ATCAGATAGCTATAGGTGTGTGG - Intergenic
1099882634 12:88485793-88485815 ATGAGTTTACTATAGATGTATGG - Intergenic
1100123031 12:91391335-91391357 ATGAATTCACTATAGATGTATGG + Intergenic
1100466802 12:94853340-94853362 ATCATTTAGCTTTAGCTGCAGGG - Intergenic
1101057219 12:100930479-100930501 ATGAATTTACTATAGATGTATGG + Intronic
1101069228 12:101055962-101055984 ATCAATGGGCCATATATGTATGG + Intronic
1101091269 12:101288348-101288370 ATTATTTAGTTATAGATGCATGG + Intronic
1101424075 12:104573553-104573575 ATCAGATAGTTGTAGATGTATGG - Intronic
1101469145 12:104978611-104978633 ATCAATTAACTATATATGTGTGG + Intergenic
1101636287 12:106544969-106544991 ATCATTTGGCTATAAATGTATGG - Intronic
1101847407 12:108373609-108373631 ATCACATAGCTATAAATGCATGG + Intergenic
1101917276 12:108905492-108905514 ATCAGTTGACTATAAATGTATGG + Intergenic
1101951878 12:109183078-109183100 ATCAGTTCACTGTAGATGTATGG + Intronic
1102033236 12:109755773-109755795 ATCAATTGACCATAAATGTAAGG + Intronic
1102449685 12:113031961-113031983 ATCAACTAACTATAAATGTGAGG - Intergenic
1104347603 12:128015549-128015571 CTAAATTAGCTATAGATTAAAGG + Intergenic
1104677717 12:130725426-130725448 ATCAGATGGCTATAGGTGTATGG - Intergenic
1105460754 13:20583925-20583947 ATCATTTAACCATATATGTAAGG + Intronic
1105478579 13:20751455-20751477 ATCAGTTGGCTATAGATATGTGG + Intronic
1105515237 13:21083801-21083823 ATCAATTGGCAATAGATGTATGG - Intergenic
1105565563 13:21544005-21544027 ATCAATTGGCTGTAGATACATGG - Intronic
1105643362 13:22289162-22289184 ATCAATTAGTCATAGAGGTATGG + Intergenic
1105757104 13:23476525-23476547 GTCAATTGGCTATACATGCATGG + Intergenic
1106198829 13:27519064-27519086 ATCAATTACCCATAAATGGATGG - Intergenic
1106990646 13:35415531-35415553 ATCAGATAGTTGTAGATGTATGG + Intronic
1107007091 13:35625114-35625136 ATCATTTAGCTTTATATTTATGG - Intronic
1107131594 13:36902300-36902322 ATCAATTGGCCACAGATGTTCGG + Intronic
1107289378 13:38835245-38835267 ATCAGATAGTTGTAGATGTATGG + Intronic
1107523649 13:41208052-41208074 ATAAGTTCACTATAGATGTATGG + Intergenic
1107721733 13:43256004-43256026 ATCAGTTGGCTATAAATGCATGG - Intronic
1108488865 13:50958388-50958410 ATCAGATAGCTATAGGTGTGTGG + Intronic
1108547552 13:51511015-51511037 ATCAGATAGTTATAGATGTGTGG + Intergenic
1108635507 13:52330744-52330766 ATCAGTTGGCTGTAAATGTATGG - Intergenic
1108652299 13:52492492-52492514 ATCAGTTGGCTGTAAATGTATGG + Intergenic
1108878770 13:55082826-55082848 ATGAGTTAACTGTAGATGTATGG + Intergenic
1109043778 13:57379564-57379586 ATCAATTGGCTTTAAATGTTTGG + Intergenic
1109200365 13:59423822-59423844 ATCAATTGACTATATATGTGTGG - Intergenic
1109439900 13:62356454-62356476 ATCAATTAAATATAAATTTATGG + Intergenic
1109680930 13:65750999-65751021 ATCAAATAGTTATAGGTGTGTGG + Intergenic
1109925448 13:69131800-69131822 ATCTATTGGCTATATTTGTATGG - Intergenic
1109950225 13:69492148-69492170 ATCAGTTGGCTATAAATGCATGG - Intergenic
1110012772 13:70358897-70358919 ATTAGTTAGCTATAAATGCATGG - Intergenic
1110078563 13:71281685-71281707 ATGAGTTAGCTGTAGATGTATGG + Intergenic
1110081042 13:71312758-71312780 ATCAAATATATATAGAAGTACGG - Intergenic
1110381591 13:74857703-74857725 ATCAGATAGCTGTAGATGTGTGG + Intergenic
1110432858 13:75445399-75445421 ATGAATTAGCTATAGACCTTGGG + Intronic
1110625957 13:77656085-77656107 ATGAATTAGCTGTAAATGTATGG + Intergenic
1111112411 13:83731072-83731094 GTCAATTAGGTATAAATCTATGG + Intergenic
1111285085 13:86080121-86080143 ACCAATTAGATATAAAGGTAGGG + Intergenic
1111561938 13:89963165-89963187 ATCAATTAACCATAGAAGCAAGG + Intergenic
1111573751 13:90122088-90122110 CTCAAGAAGCTATAAATGTAAGG + Intergenic
1111782264 13:92742879-92742901 ATCAGATAGTTGTAGATGTATGG + Intronic
1111885499 13:94015796-94015818 ATCAATTGGCCATAAATGTGTGG + Intronic
1112455500 13:99558119-99558141 ATCAATTGACCATAGATGTATGG + Intronic
1112667578 13:101594275-101594297 GTCAATTGGCTATAAATGTATGG - Intronic
1112826853 13:103401386-103401408 ATCAGATAGCTGTAGATGTGTGG - Intergenic
1113243822 13:108371502-108371524 ATGAATTCACTATAAATGTATGG + Intergenic
1113694708 13:112336132-112336154 GTCAATTAGCCATAGAAGTCTGG - Intergenic
1114382534 14:22222842-22222864 ATAAATTGGCTATAGATTTATGG - Intergenic
1114745175 14:25138584-25138606 ATCAGATAGTTGTAGATGTATGG - Intergenic
1114858992 14:26491744-26491766 ATCAATTGGCTATAGTTATGTGG + Intronic
1114914043 14:27239817-27239839 ATCAGATAGTTATAGATGTGTGG - Intergenic
1114942194 14:27626849-27626871 ATCAATTGGCTATATTTATATGG - Intergenic
1114943558 14:27649011-27649033 ATCAGATGGTTATAGATGTATGG + Intergenic
1114944749 14:27665876-27665898 ATCAAATAGCTGTAGGTGTGTGG + Intergenic
1114964700 14:27942720-27942742 ATCAGATGGCTATAGATGTATGG - Intergenic
1115390572 14:32850354-32850376 ATGAGTTTACTATAGATGTATGG + Intergenic
1115419502 14:33177798-33177820 ATCAATTGACCATAGATGTATGG + Intronic
1115765772 14:36621884-36621906 ATCAATTGACTATATATGTGTGG + Intergenic
1116227191 14:42167358-42167380 ATCAGTTAGTTGTAGATGTGTGG + Intergenic
1116481580 14:45397622-45397644 ATAAGTTCACTATAGATGTATGG - Intergenic
1116496700 14:45569376-45569398 ATCAGATGGCTATAGATGCATGG - Intergenic
1116563700 14:46417522-46417544 ATCAGTTGACTATAGATGTGTGG - Intergenic
1116744240 14:48796439-48796461 ATAAACTAGGTATTGATGTAAGG + Intergenic
1117199910 14:53379260-53379282 ATCAATTGACCATAAATGTAAGG - Intergenic
1117298745 14:54402847-54402869 ATCAGATGGTTATAGATGTATGG + Intronic
1117300970 14:54427397-54427419 ATAAATTAGCTGTAGATATCAGG - Exonic
1117652605 14:57922425-57922447 ATCAATTAGTAGTAGTTGTATGG - Intronic
1117677985 14:58174165-58174187 CCCAATTGGCCATAGATGTATGG + Intronic
1118263701 14:64272664-64272686 ATGAGTTAACTGTAGATGTATGG + Intronic
1118274123 14:64370576-64370598 ATCAATTGACCATAAATGTATGG - Intergenic
1118521817 14:66594510-66594532 ATCAATTGGCGATAAATGTGTGG - Intronic
1119006673 14:70937431-70937453 ATCAGATAGCTGTAGATGTGCGG + Intronic
1119152865 14:72380009-72380031 ATCAGTTGGCTATAGATATGTGG - Intronic
1119707580 14:76794097-76794119 ATCAATTGACCATAGATGTATGG - Intronic
1120097701 14:80407609-80407631 ATCAATTGGCCATAAATATAAGG - Intergenic
1120687316 14:87553096-87553118 ATCAATTGACTGTAGATGCATGG - Intergenic
1120709325 14:87776756-87776778 ATCAGATAGCTGTAGATGTGTGG + Intergenic
1121074225 14:91054034-91054056 ATCAGTTGACTATAGATGTATGG - Intronic
1121167570 14:91821313-91821335 ATCAATTGACTATAAATGTAAGG - Intronic
1121186585 14:91977529-91977551 ATCAATTGACCATAAATGTATGG + Intronic
1121377215 14:93423557-93423579 ATGAATTCACTGTAGATGTATGG - Intronic
1122385831 14:101347015-101347037 ATCAATTGGCTATATATGTCTGG - Intergenic
1123663108 15:22583168-22583190 ATCAGTTGTCTATGGATGTATGG - Intergenic
1123953073 15:25303430-25303452 ATCAATTGATCATAGATGTATGG + Intergenic
1124044599 15:26137367-26137389 ATCCATTAGCTTTAGAATTAAGG - Intergenic
1124316910 15:28677471-28677493 ATCAGTTGTCTATGGATGTATGG - Intergenic
1124421140 15:29523729-29523751 ATCAATTGACTATAAATGTATGG - Intronic
1124566542 15:30820033-30820055 ATCAGTTGTCTGTAGATGTACGG + Intergenic
1124593408 15:31073302-31073324 ATCAATTTGCCATAGGTGTATGG + Intronic
1125034912 15:35112190-35112212 ATTAAGTAGCCACAGATGTATGG - Intergenic
1125693682 15:41617455-41617477 ATCAATTGTCTATATATGTTTGG - Intergenic
1126126979 15:45303529-45303551 ATCAATTGTCCATAGATGTATGG + Intergenic
1126513190 15:49503118-49503140 ATCAGATAGTTATAGATGTGTGG - Intronic
1127105300 15:55607504-55607526 ATCAATTGGCCATAGATATGTGG + Intergenic
1127133101 15:55888793-55888815 ATGAATTCACTGTAGATGTATGG - Intronic
1127218595 15:56851843-56851865 ATCAATTGGCCATAGATGTATGG - Intronic
1127283753 15:57514898-57514920 AGCAGTTGGCTATACATGTAGGG + Intronic
1128102276 15:65012363-65012385 ATCAATTGACCATAAATGTATGG + Intronic
1128198578 15:65783790-65783812 ATCATTTATTTATATATGTATGG - Intronic
1128592707 15:68915949-68915971 ATCAATTGGCCATAGATGTGTGG - Intronic
1128807644 15:70543769-70543791 ATCAGTTGACCATAGATGTATGG - Intergenic
1128866347 15:71117510-71117532 ATGAATGAGCTATAAATGTGGGG - Intronic
1128899324 15:71405488-71405510 ATCAATTGTCCATAAATGTAAGG + Intronic
1128966470 15:72063091-72063113 ATGAATTCACTATAGATGTATGG - Intronic
1129655476 15:77521852-77521874 ATCAGTTACCTACAGAGGTAGGG + Intergenic
1130758589 15:86793331-86793353 ATCAATTGACCATAGATGTATGG - Intronic
1131004240 15:88963583-88963605 ATCAGTTGGCTATAGATATGTGG + Intergenic
1131452704 15:92559027-92559049 ATCAATTGGCCATAGATGTATGG - Intergenic
1131706948 15:95006966-95006988 ATCAGTTAGCTATTTAAGTAAGG + Intergenic
1132167565 15:99610640-99610662 ATCAATTGGCCATAAATGCATGG - Intronic
1133843646 16:9434142-9434164 ATCAGTTGGCTATAAATATATGG - Intergenic
1134651878 16:15915844-15915866 ATCAATTGACTATAGATGTATGG + Intergenic
1134654060 16:15933562-15933584 AACAATTGACCATAGATGTATGG - Intergenic
1135774818 16:25247943-25247965 ATTATTTAGCTATACATGTGTGG - Intronic
1136388545 16:29946412-29946434 ATCAATTAACCATATATGTGAGG + Intronic
1137228968 16:46543719-46543741 ATCAATTGATCATAGATGTATGG - Intergenic
1137465206 16:48701851-48701873 ATCAAATGGCTGTAGATGTGTGG + Intergenic
1137477573 16:48823381-48823403 ATCAATTGTCCATAGATGTGTGG + Intergenic
1137504325 16:49039098-49039120 ATCAACTAACTATAGATGTATGG + Intergenic
1137824012 16:51474160-51474182 ATCAATTGACCATAGATGTATGG + Intergenic
1138308263 16:55998990-55999012 ATTAGTTGGCTATAGATGTGTGG + Intergenic
1138908656 16:61369178-61369200 ATCAATTTGGGATAGAGGTAGGG - Intergenic
1139002002 16:62522697-62522719 GTCAATTAACTATAAATGTGTGG - Intergenic
1139059683 16:63233855-63233877 ATAAGTTCACTATAGATGTATGG + Intergenic
1139141948 16:64275948-64275970 ATCAGTTGGCTATAGATATGTGG - Intergenic
1139173581 16:64660883-64660905 ATCAATTAATTATAAATGCATGG + Intergenic
1139617131 16:68103840-68103862 ATCAATTGGCCATAGATATTCGG + Intronic
1139807679 16:69582655-69582677 ATTAATTGGGCATAGATGTATGG + Intronic
1140097621 16:71888570-71888592 ATCAATTGGTTATAAATGCATGG + Intronic
1140421160 16:74820199-74820221 ATCAGTTGGCTATAGATACATGG + Intergenic
1140668800 16:77253794-77253816 ATCAATTAGCCATAAATATATGG + Intronic
1142526553 17:546047-546069 ATCAGTTAACCATAGATGTGTGG - Intronic
1143726928 17:8854540-8854562 ATCAATTAGCCATATCTGTGTGG - Intronic
1144350628 17:14392170-14392192 ATCAGTTTGCTATAGATGTGTGG - Intergenic
1146099465 17:29965727-29965749 ATCAATTGGTCATAGATGTATGG + Intronic
1148098418 17:45071110-45071132 ATCAATTAACTCTTGAAGTATGG - Intronic
1148164028 17:45469766-45469788 ATCAGTTACTTATACATGTATGG - Intronic
1148406186 17:47418846-47418868 ATCAATTGATCATAGATGTATGG + Intronic
1148994257 17:51694954-51694976 ATCAGTTAGCCATGGGTGTATGG + Intronic
1149502187 17:57161882-57161904 ATCAATTGACAATAGATGTGTGG + Intergenic
1149507689 17:57209066-57209088 ATCAATTGATTATATATGTATGG - Intergenic
1150169931 17:62982759-62982781 ATCAGTTGGCTGTAGATATATGG + Intergenic
1150195784 17:63297410-63297432 AGCAATTGGCTATAGATGTATGG - Intronic
1150395258 17:64816420-64816442 ATCAGTTACTTATACATGTATGG - Intergenic
1150900019 17:69263525-69263547 ATCAGATGGCTATAGATGTGTGG + Intronic
1150946368 17:69750706-69750728 ATCAGATAGTTATAGATGTGTGG + Intergenic
1151284811 17:73102722-73102744 ATCAGATAGTTATAGATGTGTGG + Intergenic
1153236120 18:2990019-2990041 ATCAATTGGCCATAAATGTTTGG - Intronic
1153391865 18:4571279-4571301 ATTAGTTAGCTACAGATATACGG + Intergenic
1154237611 18:12620501-12620523 ATCAGTTGATTATAGATGTATGG - Intronic
1155355821 18:24952996-24953018 ATCAATTCGCTATAAAGGCATGG + Intergenic
1155807029 18:30184228-30184250 ATCAATTAACTGTATATGTGTGG - Intergenic
1155861909 18:30911730-30911752 ATCAATTGTCCATAGATGCATGG - Intergenic
1155923820 18:31632827-31632849 ATCAATTATTAATAGGTGTAGGG - Intronic
1156552915 18:38037099-38037121 ATCATCTAGAGATAGATGTAGGG - Intergenic
1156697736 18:39787702-39787724 AACAATTAGCTATAATTCTAAGG + Intergenic
1156865484 18:41884724-41884746 ATCATTTAGGTATATATGTTAGG + Intergenic
1156960312 18:43020705-43020727 ATCAATTGGCTATAAATTTGTGG - Intronic
1157077931 18:44487354-44487376 ATGAGTTAGCTATAGCTGCATGG - Intergenic
1157235162 18:45958514-45958536 ATCAATTTGCCATATATGTAAGG - Intronic
1157767986 18:50316696-50316718 ATCAATTGACCGTAGATGTATGG - Intergenic
1157798123 18:50594450-50594472 ATCAATTGACTGTAAATGTATGG - Intronic
1157886794 18:51376121-51376143 ATGAGTTAACTGTAGATGTATGG - Intergenic
1157903891 18:51548560-51548582 ATCAATTGGCCATAGATGTATGG + Intergenic
1158130143 18:54143661-54143683 ATCAGTTAGCTGTAAATGCATGG + Intergenic
1158365145 18:56725952-56725974 ATCAAATAGTTGTAGATGTGTGG + Intronic
1158646447 18:59252559-59252581 ATCAATTGGCCACAGATGTTTGG + Intergenic
1158772605 18:60538504-60538526 ATCAATTAACTATACATGTAAGG - Intergenic
1158951745 18:62501530-62501552 GTCAACTAGCTATAGGTATATGG - Intergenic
1159120760 18:64167181-64167203 ATAAATCAGCTATTGTTGTAAGG + Intergenic
1159339243 18:67113470-67113492 ATGAGTTAACTGTAGATGTATGG + Intergenic
1159474815 18:68907104-68907126 ATCAATTATCCATATAGGTATGG + Intronic
1159556613 18:69952448-69952470 ATCAATTGTTCATAGATGTATGG - Intronic
1159568127 18:70079516-70079538 ATCAATTACTGATGGATGTATGG - Intronic
1159738123 18:72129603-72129625 ATAAATTGGTCATAGATGTATGG + Intergenic
1159742656 18:72192067-72192089 ATCAGATAGCTGTAGATATATGG + Intergenic
1160127382 18:76189055-76189077 ATCAATTGGCTATAGATGCATGG + Intergenic
1161603398 19:5199651-5199673 GTCCATTAGCCATAGATGTGTGG + Intronic
1164148251 19:22526389-22526411 AACAATTAGCCATATATTTAAGG + Intronic
1164277866 19:23737588-23737610 ATCAATTAGCTGTAAATACATGG - Intergenic
1164569024 19:29355838-29355860 ATCAATTGACCATAAATGTATGG - Intergenic
1164569510 19:29362070-29362092 ATTAATTAACTGTACATGTATGG - Intergenic
1165218588 19:34295960-34295982 ATCAGTTGACTGTAGATGTATGG + Intronic
1165280164 19:34790148-34790170 ATCAATTGGCTCTAAATGTGTGG + Intergenic
1165284050 19:34824222-34824244 ATCAGTTAACTATATTTGTATGG - Intergenic
1165581375 19:36867781-36867803 ATCTATTAGTCATAGATGTTTGG + Intronic
1165581444 19:36868409-36868431 ATCTATTAGTCATAGATGTTTGG + Intronic
1165822847 19:38687472-38687494 ATCAATTGACAATAGATGTATGG - Intronic
1166239886 19:41483014-41483036 ATCAGTTGGCTATAAATGTGTGG - Intergenic
1166250677 19:41568583-41568605 ATCAGTTAGCTAGAGATGCATGG + Intronic
1166582191 19:43911156-43911178 ATCCATTAACCATACATGTATGG - Intergenic
1166598020 19:44068311-44068333 ATCAAGTGGCCTTAGATGTATGG - Intergenic
1168449558 19:56454523-56454545 ATGAATTCACTGTAGATGTATGG - Intronic
1168562022 19:57392582-57392604 ATCAGTTGGCTATAGATATGTGG + Intronic
924994518 2:345642-345664 ATCATTTGGCCATAGATGTTTGG + Intergenic
926005174 2:9367823-9367845 ATATATTAGCTCCAGATGTAAGG - Intronic
926122217 2:10248989-10249011 ATCAATTGACCATAAATGTAAGG + Intergenic
926164138 2:10507635-10507657 AATAATTAGATATAGATTTAGGG + Intergenic
926164322 2:10509775-10509797 AGCAATTAACCATAAATGTAAGG - Intergenic
926241388 2:11089616-11089638 ATCTATTGACCATAGATGTATGG - Intergenic
926380540 2:12283645-12283667 ATCAATTGGCCATAGATGTTTGG - Intergenic
926546492 2:14247424-14247446 ATCACATGGTTATAGATGTATGG - Intergenic
926576035 2:14582958-14582980 ATTAATTGGCCATATATGTACGG - Intergenic
926650654 2:15340517-15340539 AGAAATTAACTATAGATGTTAGG + Intronic
926768260 2:16343730-16343752 AGCAGTCAGCTATAGATGCATGG - Intergenic
926869944 2:17404895-17404917 ATCAGTTAGCTGTACATATATGG - Intergenic
927043741 2:19255957-19255979 ATCAGTTAGCTAAAGAGGTGTGG - Intergenic
927358574 2:22204845-22204867 ATCAGTTAGCCATAGATATGTGG - Intergenic
928343634 2:30469509-30469531 ATCAGTTGGCCATAGATGTATGG + Intronic
928384657 2:30856518-30856540 ATTAATTCACTGTAGATGTATGG - Intergenic
928488000 2:31752153-31752175 ATCAGATAGCTGTAGATGTGTGG - Intergenic
928704694 2:33935639-33935661 ATCAGTTGGCTATAGTTATAGGG + Intergenic
928754692 2:34510085-34510107 ATCAGATAGCTGTAGATGTGTGG - Intergenic
928878508 2:36069812-36069834 TTCAGTTGGCTATAGATGTATGG - Intergenic
928940270 2:36720334-36720356 ATCAGTTAACTATAAATGTGTGG - Intronic
929495160 2:42434811-42434833 ATCAATTGACCATAGATGTGTGG - Intergenic
929709769 2:44254912-44254934 ATCAATTGACCATAGATGTATGG - Intergenic
930749614 2:54920978-54921000 TTCAATTAGATATAGAAGGAAGG + Intronic
930803991 2:55471796-55471818 ATCAATTGGCCATAGATGTATGG - Intergenic
930882084 2:56282213-56282235 ATCAATTGGCCATATATGTGTGG + Intronic
930977687 2:57483937-57483959 AGCAATTGACTATAAATGTATGG + Intergenic
930985709 2:57585333-57585355 ATCAGTTGACTATAGATATATGG + Intergenic
931641902 2:64388391-64388413 ATCAATAAACCATATATGTATGG + Intergenic
931736939 2:65204077-65204099 ATGAGTTAACTGTAGATGTATGG - Intergenic
931825964 2:66001354-66001376 AACATTAAGCTAAAGATGTATGG - Intergenic
931917480 2:66973344-66973366 ATAAATTGGCCATAGATTTATGG - Intergenic
932015509 2:68022997-68023019 ATGAGTTCACTATAGATGTATGG + Intergenic
932328425 2:70880779-70880801 ATCAAATAGTTGTAGATGTGTGG - Intergenic
932465326 2:71919150-71919172 ATCAATAAGCCATATATGTGAGG - Intergenic
932499046 2:72165256-72165278 ATCAATTAATTGTAGATGTATGG - Intergenic
932513669 2:72322683-72322705 ATCAGATGGTTATAGATGTATGG - Intronic
932600507 2:73121430-73121452 ATCAATTGGTCATAAATGTAAGG - Intronic
932636505 2:73393731-73393753 ATCAGTTAGCCATAGATATATGG + Intronic
932640799 2:73443995-73444017 ATCAATTAGGTTTAGAGGCAGGG - Intronic
932908270 2:75778077-75778099 ATCAGATGGTTATAGATGTATGG - Intergenic
932942098 2:76179036-76179058 ATCAGTTAGCTATAAATGCATGG + Intergenic
932945578 2:76225752-76225774 ATCAGATAGTTATAGATGTGTGG + Intergenic
932969262 2:76519421-76519443 ATCAATTTGCTTTAGATTTCTGG - Intergenic
933105046 2:78313951-78313973 ATCAATTAACTGTACATGCATGG - Intergenic
933207607 2:79526668-79526690 ATCAATTAACCATAAATATATGG - Intronic
933343752 2:81055890-81055912 ATCAATTGACTATAGATGTGGGG + Intergenic
933490574 2:82981217-82981239 ATTAATTGACTATATATGTATGG - Intergenic
934505101 2:94884195-94884217 ATCAGTTGGTTATATATGTATGG + Intergenic
934881758 2:97988151-97988173 ATTAATTGGCTATATATGCAAGG - Intronic
934914171 2:98285544-98285566 ATCAATTGACTATAAATATAAGG + Intronic
934995461 2:98954208-98954230 ATTAATTAACCATAAATGTAAGG - Intergenic
935195444 2:100812052-100812074 ATCAATTGACCATAAATGTAAGG + Intergenic
935338637 2:102039827-102039849 ATCAAATAGTTGTAGGTGTATGG + Intergenic
935450673 2:103205377-103205399 ATCAGATAGCTGTAGATATATGG - Intergenic
935805171 2:106738870-106738892 ATCAATTAGCCATAGGTTTATGG + Intergenic
935873500 2:107478877-107478899 ATCAATTGACCATAGATATATGG - Intergenic
935900877 2:107791639-107791661 ATCATTTGGCTATATATGTGAGG - Intergenic
936439654 2:112540676-112540698 ATCAGTTCACTATAGATGCAAGG - Exonic
936797735 2:116226997-116227019 ATCCTTTGGCTATATATGTAAGG + Intergenic
936815924 2:116460845-116460867 ATCTATTGGCTGTAGATATATGG - Intergenic
936939339 2:117867685-117867707 ATGAGTTTGCTGTAGATGTATGG + Intergenic
937020912 2:118654195-118654217 ATCAACTAGTCATAGATGTTTGG - Intergenic
937562503 2:123243099-123243121 ATCAATTGACCATGGATGTATGG + Intergenic
938034338 2:128023833-128023855 ATCAATTGGCTATATATATCTGG + Intronic
938098815 2:128483512-128483534 ATCAGTTGACCATAGATGTATGG - Intergenic
938651085 2:133384354-133384376 ATCAGATAGCTATAGATGTGTGG + Intronic
939013920 2:136879214-136879236 ATCAAATAGTTGTAGATGTGTGG + Intronic
939487212 2:142829522-142829544 ATCAGATAGCTGTAGATGTGTGG + Intergenic
939983080 2:148803996-148804018 ATCAATTGGCTATAGATGTAGGG + Intergenic
940054124 2:149495567-149495589 ATCAGATGGTTATAGATGTATGG + Intergenic
940623296 2:156141540-156141562 ATCAGATAGTTGTAGATGTATGG - Intergenic
940635142 2:156290273-156290295 ATCAACTGACTATAAATGTAAGG + Intergenic
941117119 2:161484873-161484895 ATAAATTAGTTATAGAAGGAAGG + Intronic
941145437 2:161838150-161838172 ATCAATTAGTTATATTTGTTTGG - Intronic
941341151 2:164305540-164305562 ATCAATTGACTATAAATGTTAGG - Intergenic
941796183 2:169601432-169601454 ATCAATTAGCAATAAATGCTTGG + Intronic
941927546 2:170911276-170911298 ATCAACTGGCTATAGATGTATGG + Intergenic
941958058 2:171224899-171224921 ATCAATTAACTGTAAATGTGAGG - Intronic
943347757 2:186760083-186760105 ATGAATTCACTGTAGATGTATGG + Intronic
943475522 2:188350006-188350028 ATCAATTGGCTATACATATAAGG + Intronic
943481178 2:188419991-188420013 ATCAATTGACTATATTTGTATGG + Intronic
944026452 2:195175236-195175258 ATCAGTTGGCTATAGATGTGTGG - Intergenic
944424087 2:199561366-199561388 ATCAAATAGTTGTAGATATATGG + Intergenic
945378389 2:209108292-209108314 ATGAATTCACTGTAGATGTATGG - Intergenic
945379816 2:209127224-209127246 ATCAATGGGCTATAAATGTGTGG + Intergenic
945450814 2:209993193-209993215 ATTTATCAGCTATAAATGTAAGG + Intronic
945787937 2:214267339-214267361 ATCAATTCACCATAAATGTATGG - Intronic
945802991 2:214456870-214456892 ATCAATTGGCTGTAAATATATGG + Intronic
946218353 2:218204051-218204073 ATCAATTGACCATAGATGTTTGG + Intergenic
946765951 2:223041006-223041028 ATCAATTGACCATAGATATATGG - Intergenic
946873168 2:224103099-224103121 ATATATTAGATATAGATATATGG - Intergenic
947073081 2:226312642-226312664 ATAAATAAGATATAAATGTAAGG + Intergenic
947146668 2:227073739-227073761 ATCAGTTAGCTGTAGATATTTGG - Intronic
947887856 2:233589639-233589661 ATCAATTGGCCAAGGATGTATGG - Intergenic
947894078 2:233652665-233652687 ATCAATTGGCCAAGGATGTATGG - Intronic
948092878 2:235309976-235309998 ATCAATGGACCATAGATGTACGG - Intergenic
948966781 2:241388272-241388294 ATCAATTAACCATAAATGTAAGG - Intronic
949075001 2:242050580-242050602 ATCAATTGGCCATAAATATAAGG - Intergenic
1168733991 20:114674-114696 ATCAATTGGCTATACTAGTATGG + Intergenic
1168872295 20:1140296-1140318 ATCAATTCCCTATGAATGTATGG - Intronic
1168985858 20:2048628-2048650 ATTGATTCACTATAGATGTATGG + Intergenic
1169238717 20:3955429-3955451 ATCAATTTGTCATAGATGTTTGG + Intronic
1169857594 20:10120305-10120327 ATCAATTGATTATAAATGTAAGG - Intergenic
1170063130 20:12281437-12281459 ATGAGTTAACTGTAGATGTATGG - Intergenic
1170080998 20:12475607-12475629 ATCAGTTAGCCATAGATATATGG + Intergenic
1170146207 20:13177605-13177627 ATCAGTTGGCTGTAGATATATGG - Intergenic
1170170883 20:13411126-13411148 ATCAGTTGGCTATAAAGGTATGG + Intronic
1170730590 20:18971644-18971666 ATGAGTTGGCCATAGATGTAAGG - Intergenic
1170748933 20:19127013-19127035 ATCAATTGGCCCTAAATGTATGG + Intergenic
1171510463 20:25679010-25679032 ATCAGTTGGCTATAAATATATGG - Intronic
1172173037 20:32954425-32954447 ATCATTTGGCTATATATGTGAGG + Intronic
1173067886 20:39730778-39730800 ATCAATTGTCAATATATGTATGG + Intergenic
1173901136 20:46589692-46589714 ATCAACTGGCCATAGATGGATGG - Intronic
1175280062 20:57797710-57797732 ATATATTATATATAGATGTATGG + Intergenic
1175759538 20:61551824-61551846 ATCAACTGGCCATAGAAGTATGG - Intronic
1176174432 20:63712300-63712322 ATCAATTGGCAATATATGTAAGG + Intronic
1177060015 21:16360797-16360819 ATCAGTTGGCTGTAAATGTATGG + Intergenic
1177244594 21:18506775-18506797 ATCAATTGGCTGTAGATGTGTGG + Intergenic
1177652139 21:23970679-23970701 ATGAATTCACTGTAGATGTATGG + Intergenic
1177726569 21:24975888-24975910 ATCAATTGGTTATGGATGTATGG - Intergenic
1177753173 21:25311510-25311532 ATCAGTTGACTATAAATGTAAGG - Intergenic
1177768333 21:25485175-25485197 ATCAGTTGGCTATAGATACATGG - Intergenic
1178346910 21:31837235-31837257 ATCAATTGGCCATATATGCATGG + Intergenic
1178606555 21:34041702-34041724 ATCAATTGACTATAAATATATGG - Intergenic
1178772009 21:35514083-35514105 ATGAAATAGATATAGATGAATGG - Intronic
1179240420 21:39585219-39585241 ATCAGTTGGCTATAGATACATGG - Intronic
1179946308 21:44679731-44679753 ATCAATTGGCTGTAAATATATGG - Intronic
1180583490 22:16864403-16864425 ATCAGTTAGCTGTAGATGTGTGG - Intergenic
1180686341 22:17670064-17670086 ATCAATTGACCATATATGTATGG + Intronic
1180886359 22:19247292-19247314 ATCAATTGGCCACAGATGTAGGG + Intronic
1182140948 22:27957735-27957757 ATCAACTGACTATAGATATATGG - Intergenic
1182538610 22:31025456-31025478 ATCAATTGACCATAAATGTAAGG + Intergenic
1182643199 22:31785790-31785812 ATCAACTGACCATAGATGTACGG - Intronic
1183923121 22:41185207-41185229 ATCAATTGACCATAAATGTATGG - Intergenic
1184056556 22:42054903-42054925 ATCAATTAGCTATAGATGTATGG + Intronic
1184905136 22:47477890-47477912 ATCAATTAACCATAGATATATGG + Intronic
1184966986 22:47984335-47984357 ATCAATTGACCATAGATATATGG + Intergenic
949400623 3:3661977-3661999 ATCAGTCAGCTAGAGATGTGTGG + Intergenic
949420411 3:3859222-3859244 ATCAATTACCCATAGAAGTATGG + Intronic
949528075 3:4925843-4925865 ATCAATTGACCATCGATGTATGG - Intergenic
950047356 3:9957176-9957198 ATGAATTAGTGATAGATGCATGG - Intergenic
950519616 3:13489509-13489531 ATCAACTGGCCATAGATGTATGG + Intronic
950616347 3:14162473-14162495 ATCAACTGGCCATAAATGTATGG - Intronic
951338311 3:21453062-21453084 ATAAATTGGCCATAAATGTATGG - Intronic
951825984 3:26869150-26869172 GTCAATTGGCTATAGATATGAGG - Intergenic
951827081 3:26880689-26880711 ATCAGATGGCTATAGATGTGTGG - Intergenic
952459233 3:33506772-33506794 ATCAATTGCCTATAAATGTGAGG + Intronic
952673239 3:35995945-35995967 ATCAAGTAGTTGTAGATGTGTGG + Intergenic
952676319 3:36035155-36035177 ATCAGTTAACTGTAGATGTATGG + Intergenic
953801688 3:46029181-46029203 ATCAATTGACCATAGATGTATGG - Intergenic
954729477 3:52646590-52646612 ATCAATTGACCATAGATGTATGG - Intronic
955385919 3:58479837-58479859 ATCAATTGGCTGTAAATGCATGG + Intergenic
955441433 3:58959563-58959585 ATCAACTGGCCATAAATGTAAGG + Intronic
955584853 3:60465687-60465709 ATGAGTTTGCTGTAGATGTATGG + Intronic
955682480 3:61516548-61516570 ATCAATTGACTATGGATGAATGG - Intergenic
955937712 3:64118046-64118068 ATCAGATAGCTATAGGTGTGTGG - Intronic
956356450 3:68398264-68398286 ATCAGATAGTTGTAGATGTATGG - Intronic
956543435 3:70371111-70371133 ATCAGTTAGCTGTAAATATATGG + Intergenic
956668918 3:71668097-71668119 ATCAGATAGCTATAGATGTGTGG - Intergenic
956703284 3:71977645-71977667 ATCAATGAACTATTGATGTGTGG + Intergenic
957159429 3:76589631-76589653 ATCAATTAGCTAGATATTTAGGG + Intronic
957433701 3:80147643-80147665 ATCAGATGGCTATAGATGTGTGG + Intergenic
957664371 3:83205432-83205454 ATCAGTTGGCTACAGATGTGTGG - Intergenic
957991172 3:87629362-87629384 ATCAATTGGCTATAAATGCATGG - Intergenic
958263075 3:91404857-91404879 CTCAATTGGACATAGATGTATGG - Intergenic
958474120 3:94558804-94558826 ACCAACTAGCTATTGATGTCAGG + Intergenic
958679176 3:97304588-97304610 ATCAGATGGCTATAGATGTGTGG - Intronic
959644769 3:108686031-108686053 TTCATTTCTCTATAGATGTAAGG + Intronic
959715177 3:109424961-109424983 AACAGTTAGCTATAAATATATGG - Intergenic
959818275 3:110702146-110702168 ATGAATTCACTGTAGATGTATGG + Intergenic
959977505 3:112477918-112477940 ATCAATTGACTACGGATGTATGG + Intronic
960471341 3:118069489-118069511 ATCAGTTTACTATAGATGTATGG + Intergenic
960478166 3:118157197-118157219 ATCAATTGACTATAAATGTGTGG - Intergenic
960766730 3:121138602-121138624 ATCAATTGGCTGTAAATGTGTGG - Intronic
961481992 3:127187264-127187286 ATCAATTGACCATAAATGTATGG + Intergenic
961513191 3:127416389-127416411 ATCAATTGGCCATAAATGTGTGG - Intergenic
961598448 3:128039291-128039313 ATCAATTAACCATAAATGTATGG - Intergenic
961761345 3:129171002-129171024 ATGAATTAGCTATAAATGGAAGG - Intronic
961996278 3:131247416-131247438 ATCAGTTAGCTATAAGTATATGG + Intronic
962353658 3:134675229-134675251 ATCAATTGACCATAGATGTATGG - Intronic
962466614 3:135666191-135666213 ATGAGTTAACTGTAGATGTATGG - Intergenic
962510302 3:136092714-136092736 ATCAATTAGCCCTAAATGTGAGG - Intronic
963074696 3:141334865-141334887 AACAATTAGCTAGATATGGAAGG + Intronic
963282174 3:143395291-143395313 ATCAGATGGCTATAGATGTGTGG - Intronic
963436971 3:145283560-145283582 ATCAATTGGCTGTAAATATATGG + Intergenic
963462230 3:145630775-145630797 ATCAATTAGTCATAGATATGTGG - Intergenic
963507992 3:146211850-146211872 ATCAGTTGGCTACAGATGTTTGG + Intronic
963823706 3:149928466-149928488 ATAAGTTGGCCATAGATGTATGG + Intronic
964062807 3:152544655-152544677 ATCAGTTAGCTATAGATACGTGG - Intergenic
964262897 3:154860025-154860047 ATCAGTTCACTGTAGATGTATGG + Intergenic
964273622 3:154985559-154985581 ATCAGATAGCTGTAGATGTGTGG - Intergenic
964479297 3:157126179-157126201 ATGAATTGGGTATAGATTTAGGG + Intergenic
964521125 3:157568868-157568890 ATCAATTGACCATAGATGTATGG + Intronic
964877236 3:161381519-161381541 ATCAATTGACCATAAATGTAGGG + Intergenic
964925152 3:161946986-161947008 ATCAATTTGCCATAAATATATGG - Intergenic
965051741 3:163658776-163658798 ATCATTTACCTATATATTTAGGG + Intergenic
965102504 3:164318379-164318401 ATTAATTTGCTTTAGATATAGGG - Intergenic
965233760 3:166088944-166088966 AACAATTAGCTTTAGATTGAGGG + Intergenic
965325194 3:167294390-167294412 ATCAGATGGCTATAGATGTGTGG - Intronic
965348940 3:167589234-167589256 ATGAATTCACTGTAGATGTATGG + Intronic
965655892 3:170984364-170984386 ATCAATTGACTATTGATGTGTGG + Intergenic
965800286 3:172485485-172485507 ATCAATTGGCTTTATATTTATGG + Intergenic
966464028 3:180209663-180209685 ATGAGTTTGCTATAGGTGTATGG - Intergenic
967454016 3:189660344-189660366 ATCATATGGCTATAGGTGTATGG + Intronic
967616221 3:191570348-191570370 ATCAATTAACTAAATATGTGTGG + Intergenic
967696069 3:192532046-192532068 ATCAATTAGCTATAAGTGTTTGG + Intronic
967779936 3:193426690-193426712 ATCAGTTGGCCATAGATGTATGG - Intronic
968378831 4:70668-70690 ATAAGTTTGCTGTAGATGTATGG + Intronic
968499646 4:942464-942486 ATCAGTTAACCATAAATGTAGGG + Intronic
969005348 4:4014778-4014800 ATCAGATAGTTATAGATGTGTGG + Intergenic
970141312 4:12985106-12985128 ATCATATAGTTATAGATGTGTGG + Intergenic
970186947 4:13465915-13465937 ATCAATTGACTGTACATGTATGG - Intronic
970357925 4:15276278-15276300 ATCAATTGGCTACAGATGCATGG - Intergenic
970647612 4:18140451-18140473 ATCAATTAGATATACATACAGGG - Intergenic
971033365 4:22665996-22666018 ATCAATTGACTATAAATGTGAGG + Intergenic
971744652 4:30564250-30564272 ATCAGTTAGCTATAAATATGTGG - Intergenic
971810616 4:31421002-31421024 ATCAATTGACCATAGATGTGTGG + Intergenic
971828778 4:31663019-31663041 ATCAAGTAGTTATGGATGTTGGG - Intergenic
972121094 4:35704427-35704449 ATCAGTTGGCTATAGATATGTGG + Intergenic
972128212 4:35797322-35797344 ATCAGTTAGCTGTAGATGTATGG - Intergenic
972582727 4:40409155-40409177 ATCAATTGACCATAGATGTATGG - Intergenic
972891364 4:43560090-43560112 ATCAAATAACTGTAGATGTTAGG - Intergenic
973100575 4:46263528-46263550 ATCAATTGACCATAGATATATGG + Intronic
973222238 4:47740796-47740818 AACAATTGGCCATAGATGTATGG - Intronic
973611892 4:52643935-52643957 ATTCTTTAGCTACAGATGTAAGG + Intronic
974008210 4:56581865-56581887 ATCAATTGCCCATAAATGTAGGG - Intronic
974263528 4:59555763-59555785 ATCAGATAGGTATAGATGTGTGG + Intergenic
974327763 4:60437228-60437250 ATCAATTGGCTATAAATATTTGG - Intergenic
974464744 4:62240700-62240722 ATCAGATGGCTGTAGATGTATGG - Intergenic
974521859 4:62991577-62991599 ATCAATTAACCATAAATGTAAGG + Intergenic
975335986 4:73175649-73175671 ATGAGTTGGCTGTAGATGTATGG - Intronic
975575807 4:75861359-75861381 ATCAATTGACTATAGATGTATGG - Intronic
975761823 4:77627776-77627798 ATTAATTGACTATAGATGTGTGG + Intergenic
975941410 4:79651558-79651580 AGCAATTTGCTATAGAAATAGGG + Intergenic
976013611 4:80522794-80522816 ATCATTTGGCCATATATGTATGG + Intronic
976072009 4:81252257-81252279 ATCAATTGGCTATAGATATGTGG + Intergenic
976372498 4:84305291-84305313 ATCAGTTAGCTATAGATACATGG - Intergenic
976722647 4:88184890-88184912 ATGAATTCACTGTAGATGTATGG - Intronic
976762308 4:88562798-88562820 ATGAATTCACTGTAGATGTATGG + Intronic
976963372 4:91005868-91005890 ATCAATTGGCTGTAGATGTATGG + Intronic
976985463 4:91290617-91290639 ATCATTGAGGTATAGAGGTATGG - Intronic
977053135 4:92155268-92155290 ATCAATCAGCTGTAAATGTGTGG + Intergenic
977087294 4:92618306-92618328 ATCAGTTGGCTGTAGATGTATGG + Intronic
977193277 4:94026884-94026906 ATCAAATGGCCATAGATGTTTGG - Intergenic
977305275 4:95316724-95316746 ATTATTTAAGTATAGATGTAAGG - Intronic
977344111 4:95796206-95796228 ATCAGATAGTTATAGATGTGTGG - Intergenic
977793433 4:101133939-101133961 ATCAGATAGCTGTAGATGTGTGG - Intronic
977914050 4:102571177-102571199 ATCAGATAGTTGTAGATGTACGG - Intronic
978105216 4:104893792-104893814 ATCAATTAGATCTAAATGTTGGG - Intergenic
978258779 4:106725506-106725528 ATCAATTAACTGTAAATGTATGG - Intergenic
978481917 4:109202302-109202324 ATCAATTGGCTATATTTGTGTGG - Intronic
978652939 4:111029818-111029840 ATCAATTGACCATAGATGTATGG + Intergenic
978680049 4:111369232-111369254 ATCAGATAGTTATAGATGTGTGG - Intergenic
979122140 4:116917087-116917109 ATTGATTTGCTATAGATGTGTGG + Intergenic
979138387 4:117140378-117140400 ATCAGTTGGCTGTAGATGCATGG - Intergenic
979154553 4:117367500-117367522 ATCAATTAACCTTATATGTATGG + Intergenic
979373697 4:119919312-119919334 ATCAGATGGCTATAGATGTGTGG - Intergenic
979425069 4:120554056-120554078 AACAATTTGCTATAGATCTTGGG - Intergenic
979887124 4:126042134-126042156 CTAAAGTAGCTATAGATGTGAGG - Intergenic
980095506 4:128486154-128486176 ATCAATTAGTTGTAGGTGTATGG - Intergenic
980222880 4:129943252-129943274 ATCAGATGGCTGTAGATGTATGG + Intergenic
980235897 4:130106397-130106419 ATCAATTGACCATAGATGTGTGG + Intergenic
980310385 4:131121624-131121646 ATAAATTGACTGTAGATGTATGG + Intergenic
980811296 4:137884177-137884199 ATCAATTGAACATAGATGTATGG + Intergenic
980882778 4:138730076-138730098 ATCAATTGGCTATAGATATTTGG - Intergenic
981053646 4:140337520-140337542 TTCAATTGGCCATAGATGTTTGG - Intronic
981807798 4:148737185-148737207 ATCAATTAGCCAAAGAAGTTGGG - Intergenic
981837346 4:149070174-149070196 ATGAATTCACTGTAGATGTATGG - Intergenic
982239568 4:153285232-153285254 ATCAATTGACCATGGATGTATGG + Intronic
982800429 4:159698722-159698744 ATCAATTAGCTATAAGTGCATGG + Intergenic
983410821 4:167395156-167395178 ATTAATTAGCTATGGGTGAATGG - Intergenic
983588409 4:169381169-169381191 ATCAATTGGCTGTAGATATGTGG - Intergenic
983599064 4:169503563-169503585 ATGAATTCACTATAGATGTATGG - Intronic
983695588 4:170525761-170525783 ATCAATTGGCCATAAATATACGG - Intergenic
985280332 4:188280331-188280353 ATCAGATGGCTGTAGATGTATGG - Intergenic
985320441 4:188704739-188704761 ATCAATTAACCATAAATGTTAGG + Intergenic
986033966 5:3920398-3920420 ATGAATTCACTATAGATGTCTGG - Intergenic
986198938 5:5563374-5563396 ATCAATCAGCCATAGACATATGG - Intergenic
986969903 5:13320581-13320603 TTCAGTTAGCTATAAATGTATGG + Intergenic
987140033 5:14936217-14936239 AGCAATTGGCCATAGATGTTTGG + Intergenic
987159152 5:15122501-15122523 ATCAATTAACCATATATGTGAGG + Intergenic
987184558 5:15402429-15402451 ATCAAGTAGCCATAGATGTATGG - Intergenic
987815489 5:22895707-22895729 ATCACTTAGTCATAGATGTGGGG - Intergenic
988384551 5:30544329-30544351 GTGAATTCGCTATAGATGTATGG - Intergenic
989079223 5:37599486-37599508 ATCAATTGGCCATAAATGTAAGG - Intronic
989416847 5:41188467-41188489 ATCAATTGACCATAGATGTATGG - Intronic
989492043 5:42068483-42068505 ATGAGTTTGCTGTAGATGTATGG + Intergenic
990126487 5:52524918-52524940 ACCAATTAGATGTAGATGTAGGG + Intergenic
990223619 5:53624157-53624179 ACCAATTGGCTATATATGCAAGG + Intronic
990317158 5:54593730-54593752 ATCAGTTAGCAATATATGAATGG - Intergenic
990774508 5:59290269-59290291 ATGAGTTCGCTGTAGATGTATGG - Intronic
991077225 5:62554573-62554595 ATCAGTTGGCTGTAAATGTATGG + Intronic
991664092 5:68979952-68979974 ATCAGTTCACTGTAGATGTATGG - Intergenic
991692975 5:69243436-69243458 ATGAGTTTGCTGTAGATGTATGG + Intronic
992257840 5:74939434-74939456 ATCACTTGGCTTTAGATATACGG - Intergenic
992276306 5:75123641-75123663 ATCAGTTAGCTATAGATATGTGG - Intronic
992343739 5:75853719-75853741 ATCAAGTAGCTGAAAATGTAGGG + Intergenic
992668858 5:79038565-79038587 ATAAATTGACCATAGATGTATGG - Intronic
992746152 5:79822905-79822927 GTCAATTGGCCATATATGTATGG + Intergenic
992864631 5:80945353-80945375 ATCAATTGGCTGTACATGTATGG - Intergenic
992945682 5:81807804-81807826 ATCAATTGGCTGTAGGTATATGG - Intergenic
993337067 5:86673240-86673262 ATAAGTTCACTATAGATGTATGG - Intergenic
993403121 5:87477393-87477415 ATCAAATGGTTATAGATGTGTGG - Intergenic
993472059 5:88318268-88318290 ATCAATTGGCTGTAAATGTGAGG + Intergenic
993537713 5:89107331-89107353 ATGATTTCGCTGTAGATGTATGG - Intergenic
993609861 5:90040853-90040875 ATCAAATAGCTGTAGATATGTGG + Intergenic
993654981 5:90566448-90566470 ATTAATTGACTATAAATGTATGG + Intronic
993776683 5:92008682-92008704 ATCAGTTACCTATATATGTGTGG - Intergenic
993823403 5:92649516-92649538 ATTAATTAAATATAGATGAATGG - Intergenic
993892776 5:93493691-93493713 ATCAATTGACCATAGATGTTTGG - Intergenic
994029203 5:95121829-95121851 ATGAATTCACTATAGATGTACGG - Intronic
994221472 5:97200636-97200658 ATCAATTAACTATAAATATAAGG - Intergenic
994266134 5:97719085-97719107 ATCAGATAGTTATAGATGTGTGG + Intergenic
994306452 5:98211340-98211362 ATCAACTGGCTATAAATGCAGGG + Intergenic
994404018 5:99320335-99320357 ATCAGATAGCTATAGGTGTGTGG + Intergenic
994406704 5:99353548-99353570 ATCAATTCACCATAAATGTAAGG + Intergenic
994713529 5:103295221-103295243 ATTAATTAGCTATAGATTTGGGG + Intergenic
994768136 5:103947775-103947797 ATCAATTAAATTTAAATGTATGG + Intergenic
994886591 5:105570928-105570950 ATCAATTGGCTATAAATGTATGG - Intergenic
995268201 5:110189566-110189588 ATGAGTTCACTATAGATGTATGG + Intergenic
995363799 5:111330816-111330838 ATCAACTAACTATTGATCTATGG - Intronic
995640975 5:114257156-114257178 ATCAGTTAGCTGTAGGTATATGG + Intergenic
995677556 5:114680154-114680176 CTCAATTATAAATAGATGTAAGG - Intergenic
995894869 5:117001192-117001214 ATCAATTGTCTATATATGCATGG - Intergenic
996073124 5:119157618-119157640 ATCAATTGAGTATAAATGTATGG + Intronic
996109892 5:119552975-119552997 ATCAAATGGTTATAGATGTGTGG + Intronic
996258701 5:121438824-121438846 ATGAGTTAACTGTAGATGTATGG + Intergenic
996295060 5:121903419-121903441 ATCAAGTACCAATAGATGAACGG + Intergenic
996402513 5:123078106-123078128 ACCAATTAACTATAAATGTAAGG - Intergenic
996632458 5:125650748-125650770 ATCAATTGACTATAGCTGTGTGG - Intergenic
996834318 5:127774550-127774572 ATCAATTAGCCATAGATTTTTGG + Intergenic
997041213 5:130256891-130256913 ATGAATTGGCTATAAATGTGTGG + Intergenic
997044043 5:130292000-130292022 ATCAATTGGCTGTAAATGCATGG - Intergenic
997499463 5:134361225-134361247 TTCAATTAGCTAAAAATGAAGGG + Intronic
997605385 5:135172244-135172266 ATCATTTGGCTATAGATGCAAGG + Intronic
997620829 5:135292454-135292476 ATCAATTGGCCATAGATGTATGG + Intronic
997901448 5:137769384-137769406 ATGAATTCACTGTAGATGTATGG - Intergenic
998039104 5:138940318-138940340 ATCAATTAACTATATCTGTGTGG + Intergenic
998211251 5:140200418-140200440 ATCAAGTGGTTATAGATGTGTGG + Intronic
998258066 5:140604881-140604903 ATCAGTTGGTTATAGATGTTTGG + Intergenic
998686107 5:144528195-144528217 ATCAATTGACCATAGATGTGTGG - Intergenic
998771925 5:145555673-145555695 ATCAATTAGGAATAGATTTTTGG + Intronic
998954190 5:147421703-147421725 ATCAAATAGTTGTAGATGTGTGG - Intronic
999022361 5:148181544-148181566 ATCAATTAGATAAAAATGTGTGG + Intergenic
999036382 5:148355726-148355748 ATCAATTGACTATATATGTGTGG + Intergenic
999313094 5:150565490-150565512 ATCAATTGGCAATAGATGTGAGG - Intergenic
999455413 5:151711873-151711895 ATGAATTTGCTGTAGATGTATGG + Intergenic
999675382 5:153996240-153996262 ATCAGTTGGCCATAGATATATGG - Intronic
1000427178 5:161105292-161105314 AACATTTAGCTATATAGGTAGGG + Intergenic
1001046554 5:168377123-168377145 ATCAAATAGCTGTAGGTGTGCGG - Intronic
1001793238 5:174479593-174479615 ATCAGTTAGCTGTAAATATATGG - Intergenic
1002768203 6:262069-262091 ATAAATTGGCCATAGATGTATGG + Intergenic
1002850513 6:991691-991713 ATCAATTGGCCTTAGATGTATGG - Intergenic
1003229335 6:4236852-4236874 ATCAATTAGCTCTAGTTTAAGGG + Intergenic
1003597270 6:7485420-7485442 ATCAATTGACTATAAACGTAAGG + Intergenic
1003783971 6:9462287-9462309 ATCAATTGACAATAAATGTAAGG - Intergenic
1004672814 6:17813920-17813942 ATAAATGGTCTATAGATGTAAGG + Intronic
1004968801 6:20885362-20885384 ATCAATTGGCTACAGTTGTATGG - Intronic
1005151904 6:22761314-22761336 ATCAAATGGTTATAGATGTGTGG + Intergenic
1006892840 6:37444607-37444629 ATCAATTAGGTATAAAAGTTAGG - Intronic
1007009566 6:38402527-38402549 ATCAGTTGGCCATAGATGTATGG - Intronic
1007639256 6:43324283-43324305 ATCAGTTGGCCATAGATGTATGG - Intronic
1008343801 6:50401252-50401274 ATCAGTTAGCTCTAAATGTATGG + Intergenic
1008736592 6:54552022-54552044 ATCAAATGGTTATAGATGTGAGG - Intergenic
1008782888 6:55128219-55128241 ATCAGTTAGTTGTAGGTGTATGG + Intronic
1008951284 6:57162451-57162473 TCCAATTAGGTATAGATTTATGG - Intronic
1009180956 6:60517143-60517165 CTCAATTGGACATAGATGTATGG + Intergenic
1009183725 6:60549778-60549800 ATCAATTGGATTTGGATGTATGG - Intergenic
1009393902 6:63174993-63175015 ATCAGTTACCTCTAGGTGTAGGG + Intergenic
1009511448 6:64554389-64554411 GTCAATTAGGTATAGAAGAAGGG + Intronic
1009762373 6:68024097-68024119 ATCACATAGTTATAGATGTGTGG + Intergenic
1009803145 6:68568332-68568354 ATCAGTTAGTTGTAGGTGTATGG + Intergenic
1010263534 6:73843203-73843225 ATGAGTTCTCTATAGATGTACGG + Intergenic
1010506641 6:76668786-76668808 ATAAATTATTTATAGAGGTATGG + Intergenic
1010549974 6:77209881-77209903 ATGAGTTCACTATAGATGTATGG + Intergenic
1010837091 6:80601854-80601876 ATGAGTTCACTATAGATGTATGG + Intergenic
1010995476 6:82527388-82527410 ATCAATTGGCTATAGATACATGG + Intergenic
1011181070 6:84621641-84621663 ATCAGTTGGCTGTAGATGTGTGG - Intergenic
1011247736 6:85337344-85337366 ATTATTTGACTATAGATGTATGG + Intergenic
1011523231 6:88233969-88233991 ATCAGTTGGCTATAAATGTGTGG - Intergenic
1011985714 6:93442285-93442307 ATTAATTGACCATAGATGTATGG + Intergenic
1012598549 6:101067951-101067973 ATCAGATGGCTATAGATGTGTGG - Intergenic
1012917492 6:105186262-105186284 ATCAACTGACTATAGATATATGG + Intergenic
1013083614 6:106835040-106835062 ATCAGTTCACTGTAGATGTATGG + Intergenic
1013912873 6:115299159-115299181 ATCAAATGGTTATAGATGTGTGG - Intergenic
1014058028 6:117039117-117039139 ATCAGATGGCTATAGATGTGTGG + Intergenic
1014626754 6:123735556-123735578 ATCAATTGGCTGTAGATATGTGG - Intergenic
1014659410 6:124149577-124149599 ATCAGTTAACCATAAATGTAAGG + Intronic
1014692887 6:124583836-124583858 ATGAATTCACTGTAGATGTATGG - Intronic
1015184933 6:130404955-130404977 ATCAAATAGTTATAGTTGTGCGG + Intronic
1015248345 6:131100394-131100416 ATCAGATAGCTGTAGATGTGTGG + Intergenic
1016483062 6:144503547-144503569 ATCAGTTAGTTATAGATGTGTGG + Intronic
1017467824 6:154711124-154711146 ATAAATTAACTACACATGTATGG + Intergenic
1017537170 6:155360813-155360835 ATCAATGAACAAGAGATGTATGG - Intergenic
1017932090 6:158965097-158965119 ATTAATTGACCATAGATGTATGG + Intergenic
1018448431 6:163880795-163880817 ATCAATTGGCTGTAGATATGTGG - Intergenic
1018660542 6:166082363-166082385 ATCAGTTGGCTATAGATACATGG + Intergenic
1019754126 7:2756142-2756164 ATCAATTGGCCATATATGTGGGG - Intronic
1019757318 7:2782004-2782026 ATCAATTGGCCATAGATATGTGG - Intronic
1019957830 7:4430489-4430511 ATCAGTTGGCTATAGCTGTGTGG - Intergenic
1020443514 7:8244251-8244273 ATCAGATAGCTGTAGATGTGTGG - Intronic
1020481315 7:8665318-8665340 ATCAATTAACCATAGATACATGG + Intronic
1020494394 7:8830454-8830476 ATCACTTAACTATATATGTGAGG + Intergenic
1020855631 7:13418530-13418552 ATCAATTCTGCATAGATGTATGG + Intergenic
1021049109 7:15960465-15960487 ATCAGATGGCTATAGATGTCTGG - Intergenic
1021428181 7:20527969-20527991 ATCAGTTGGCCATAGATGTATGG - Intergenic
1021529469 7:21627575-21627597 ATTAATTGGCTGTAAATGTATGG + Intronic
1021831946 7:24621976-24621998 ATCAATTGACCATAAATGTATGG + Intronic
1022223996 7:28344446-28344468 ATCAGTTGGCTGTAAATGTATGG + Intronic
1022338002 7:29440820-29440842 ATCAATTGGCCACAGATGTATGG - Intronic
1022440826 7:30431489-30431511 ATCAATTGACCATAAATGTATGG - Intronic
1022661535 7:32372031-32372053 ATCAATTGACCATAGATGTTTGG - Intergenic
1023392459 7:39723347-39723369 ATCAATTGACCATAAATGTAAGG - Intergenic
1023458904 7:40372314-40372336 ATTAATTAATTAAAGATGTAGGG - Intronic
1023716584 7:43050870-43050892 ATGAATTCACTGTAGATGTATGG - Intergenic
1023730032 7:43182451-43182473 ATCAGTTGGCTGTAGATGTGTGG + Intronic
1024349472 7:48349073-48349095 AGCAATTCCCTATAGATATAAGG + Intronic
1024468338 7:49738438-49738460 ATCATTTGGCTATAGATGTATGG - Intergenic
1024528651 7:50372023-50372045 ATCTATTAGTCATAAATGTAAGG - Intronic
1024654710 7:51441545-51441567 ATCAACTGACTATAAATGTAAGG + Intergenic
1026125543 7:67576434-67576456 ATGAATTGTCTATACATGTATGG + Intergenic
1026248230 7:68642911-68642933 ATCAATTGGCCATATATGTCTGG - Intergenic
1027349546 7:77296899-77296921 ATCAGTTGTCTATAGATATATGG + Intronic
1027671989 7:81112284-81112306 TTCAGTTAGCTCTAGATGTTTGG - Intergenic
1027692818 7:81369570-81369592 ATATGTTAGCTATAGATGTGAGG - Intergenic
1027779347 7:82503333-82503355 ATCAATTGGCTACAGAGGTCAGG - Intergenic
1027920914 7:84393339-84393361 ATCAATTGACTATAAATGTGTGG + Intronic
1028026941 7:85855009-85855031 ATCAATTGGCTATAAATGCATGG + Intergenic
1028069208 7:86430008-86430030 AGCAGTTAGATATAGATTTATGG - Intergenic
1028159543 7:87470062-87470084 ATCAGATAGTTGTAGATGTATGG - Intronic
1028193866 7:87882175-87882197 ATCCATTAGCCATATATGCAAGG - Intronic
1028282207 7:88945386-88945408 ATCAGTTAGTTGTAGATGTGTGG + Intronic
1028330024 7:89578921-89578943 ATCAGATAGTTGTAGATGTATGG - Intergenic
1028367163 7:90047303-90047325 AGCAGTTAGCTGTAAATGTATGG - Intergenic
1028847531 7:95498942-95498964 ATCAATTGGCAATATATGTATGG + Intronic
1028854124 7:95570811-95570833 ATCAATTGTCTATATATGTGTGG + Intergenic
1028911752 7:96215506-96215528 ATCAATTGACTATAAATGTGAGG - Intronic
1028942703 7:96541878-96541900 ATCAAATGGCTGTAGGTGTATGG + Intronic
1029003271 7:97179136-97179158 ATCAATTGGCTATATATGTAAGG + Intronic
1029932841 7:104391482-104391504 ATCAGATGGCTATAGATGTGTGG + Intronic
1030155049 7:106446318-106446340 ATTAATTGACTATATATGTAAGG + Intergenic
1030225946 7:107151240-107151262 ATAAATTTGCTATAGATGCTGGG - Intronic
1030329068 7:108253749-108253771 ATCAATTATGTACAGATGGATGG + Intronic
1030425767 7:109375336-109375358 ATCAATTAGCTATAAGTATTTGG - Intergenic
1030705189 7:112685348-112685370 ATCACATAGTTATAGATGTATGG + Intergenic
1030778901 7:113572966-113572988 ATCAAATGGTTATAGATGTGTGG - Intergenic
1031209408 7:118803159-118803181 AACATTTGGTTATAGATGTATGG + Intergenic
1031455232 7:121971100-121971122 ATCAGATAGCTGTAGATGTGTGG + Intronic
1031677290 7:124626088-124626110 ATCAATTAACTATAAATATATGG - Intergenic
1031700066 7:124913848-124913870 ATTACTTAGCCATAGAAGTATGG + Intronic
1031747006 7:125512156-125512178 AGAAATTAGCTATACATATATGG - Intergenic
1031827511 7:126584593-126584615 ACAAATGAGCTATAAATGTAAGG - Intronic
1031828235 7:126593444-126593466 ATCAGTTTGCTGTAAATGTATGG - Intronic
1031912194 7:127529718-127529740 ATCAGATGGCTATAGGTGTATGG - Intergenic
1032777256 7:135126712-135126734 ATCAAATAGTTGTAGATGTGTGG - Intronic
1032952618 7:136932468-136932490 ATCACTTAACCATAAATGTAAGG - Intronic
1033382670 7:140839023-140839045 ATCAATTGACTGTAAATGTAAGG - Intronic
1033618001 7:143035756-143035778 ATCAGATAGCTATAGATGCGTGG - Intergenic
1033875476 7:145811856-145811878 ATTAATTCACTGTAGATGTATGG - Intergenic
1034580456 7:152037359-152037381 ATGAGTTCGCTGTAGATGTATGG + Intronic
1034589221 7:152125842-152125864 ATCAATTGGCCATATATGTGTGG - Intergenic
1034846257 7:154448762-154448784 AATAATTGACTATAGATGTATGG - Intronic
1035150359 7:156865772-156865794 ATCAATTGACCATAAATGTAAGG - Intronic
1036777575 8:11624155-11624177 ATCAATTGGCCATGGGTGTATGG + Intergenic
1037266377 8:17066222-17066244 ATCAATTAAATAAAAATGTATGG + Intronic
1037440918 8:18915042-18915064 ATCAATTGACTATAAAAGTAAGG - Intronic
1037663515 8:20946510-20946532 ATAAATTAGACATACATGTATGG - Intergenic
1037895955 8:22655572-22655594 ATCAATTGTCCATATATGTAAGG + Intronic
1038184569 8:25261282-25261304 AGCAATTAGTTACAGATGTTAGG - Intronic
1038414325 8:27382850-27382872 ATCAGTTAGCTATAAATATGTGG + Intronic
1039332653 8:36555871-36555893 ATCATTTGGCTTTAGATTTATGG - Intergenic
1039749874 8:40468354-40468376 ATCAATTGGCTGTAGATATGTGG - Intergenic
1039939791 8:42080208-42080230 ATCAATTTACCATAAATGTAAGG + Intergenic
1040040175 8:42908503-42908525 ATCAACTGACTATAGATGTATGG - Intronic
1040623978 8:49124011-49124033 ATCAATTGGCTGTAGATATGTGG + Intergenic
1040657612 8:49529804-49529826 ATCAGTTGGATATAGATGTGTGG + Intergenic
1040687604 8:49894129-49894151 ATCAATTGGTCATAGATGTATGG - Intergenic
1040766474 8:50917224-50917246 ATCAGATAGCTGTAGATATATGG + Intergenic
1041023780 8:53663754-53663776 ATCAGTTGGCTATAGATGCATGG + Intergenic
1041336594 8:56791941-56791963 GTCAATTAACTATAAATGCAGGG - Intergenic
1041622230 8:59985202-59985224 ATCAATTTGCTATAAATGTGTGG + Intergenic
1041763956 8:61397799-61397821 ATCAATTGACCATAAATGTAAGG + Intronic
1041879025 8:62725649-62725671 ATGAGTTAACTGTAGATGTACGG + Intronic
1041983024 8:63885346-63885368 ATCAATTGACCATAGATATATGG + Intergenic
1042662495 8:71170492-71170514 ATCAATTAACATTAGAAGTAGGG + Intergenic
1042981148 8:74530248-74530270 ATCAATTGATTATAGATGTGTGG - Intergenic
1043110734 8:76177531-76177553 ATCAATTGGCTGTAGATACATGG + Intergenic
1043235735 8:77863557-77863579 ATGAGTTTGCTGTAGATGTATGG - Intergenic
1043320976 8:78986344-78986366 AACAATTAACCATAAATGTAAGG - Intergenic
1043829874 8:84974834-84974856 ATGAATTCACTATAGATGTATGG - Intergenic
1044001050 8:86881860-86881882 ATCAGATAGTTATAGATGTGTGG - Intronic
1044022486 8:87122855-87122877 ATCAGTTAACCATAGATGTATGG + Intronic
1044407738 8:91848896-91848918 ATGAATTCACTGTAGATGTATGG - Intergenic
1044682722 8:94798659-94798681 ATCAATTAACAACAAATGTAGGG - Intergenic
1044693856 8:94903841-94903863 ATCAATTACCTACAGAAGCAGGG - Intronic
1045076610 8:98576197-98576219 ATCAGTTGGCCATAGATTTATGG + Intronic
1045221288 8:100202741-100202763 ATCAACTGGCCATAGATGTATGG + Intronic
1045283219 8:100767624-100767646 ATCAGTTGGCTATAGATACATGG - Intergenic
1045590443 8:103588602-103588624 ATGAATTCACTGTAGATGTATGG - Intronic
1045603457 8:103746240-103746262 ATCAGTTGACCATAGATGTATGG + Intronic
1046233640 8:111392006-111392028 ATCAAATGGTTGTAGATGTATGG - Intergenic
1046242129 8:111510303-111510325 ATCAGATAGTTGTAGATGTATGG - Intergenic
1046267442 8:111848584-111848606 ATCAATTGGCTGTAAATGTGTGG + Intergenic
1046318560 8:112539615-112539637 ATGAGTTGGCTGTAGATGTATGG - Intronic
1047030727 8:120877212-120877234 ATCAATTAACTGTAAATGTGTGG + Intergenic
1047839124 8:128729503-128729525 ATCAATTGGCCATAGATATATGG + Intergenic
1048088467 8:131210868-131210890 ATCAGATAGTTATAGATGTGTGG + Intergenic
1048699531 8:137072931-137072953 ATCAGTTAGCCCTAGATGTGTGG + Intergenic
1050045213 9:1536358-1536380 ATCAATTGACCATAGATGTATGG + Intergenic
1050084971 9:1955383-1955405 ATCAGTTGGCTATAAATGTGTGG - Intergenic
1050603729 9:7278982-7279004 ATCAGATAGCTGTAGATGTGTGG + Intergenic
1050924643 9:11248684-11248706 ATCAAATAGTTGTAGATATACGG - Intergenic
1051137235 9:13935941-13935963 ATCAATTATATATGGATCTATGG + Intergenic
1051716006 9:19984725-19984747 ATCAATTGGCTATAAATATTTGG - Intergenic
1052307560 9:27028094-27028116 ATCGGTTAGCTATAGATATATGG + Intronic
1052484257 9:29075812-29075834 ATTAATTAGATTTTGATGTAAGG - Intergenic
1052611267 9:30777167-30777189 ATCAATTAACTCTAAATGCATGG - Intergenic
1052726335 9:32232351-32232373 ATCAATTGGCTATAAATATATGG - Intergenic
1052869002 9:33485137-33485159 ATCAATTGGCTGCAAATGTATGG - Intergenic
1052992482 9:34527841-34527863 ATCAGATAGTTGTAGATGTATGG + Intergenic
1053322207 9:37109130-37109152 ATCAATTCGCCATAGGTGTTTGG - Intergenic
1054912066 9:70464204-70464226 TTCAATTAGCCACAGATGAAGGG + Intergenic
1054991819 9:71336796-71336818 ATCAGATGGTTATAGATGTATGG - Intronic
1055254407 9:74350336-74350358 ATCACTTATCCATATATGTATGG + Intergenic
1055588315 9:77781388-77781410 ATCAGTTGGCTATAGATATAGGG + Intronic
1056087816 9:83170223-83170245 ATGAGTTGGCTATACATGTAAGG + Intergenic
1056159721 9:83876751-83876773 ATCAACTGGCCATAGATATATGG - Intronic
1056421236 9:86428565-86428587 GCCAATTGGCCATAGATGTATGG + Intergenic
1056571136 9:87816209-87816231 ATCAGTTGGCTGTAGATGCATGG - Intergenic
1056875264 9:90322999-90323021 ATCAATTGGTCATAAATGTATGG + Intergenic
1057065990 9:92052280-92052302 ATTAATTGACCATAGATGTATGG - Intronic
1057127305 9:92628509-92628531 ATCAGTTGACCATAGATGTATGG - Intronic
1057187954 9:93068466-93068488 ATCATTTGACTATAAATGTAAGG + Intronic
1057267294 9:93626876-93626898 ATCAGTTGGCTGTTGATGTATGG + Intronic
1057689395 9:97269925-97269947 ATCAATTGGCTGTAAATGTATGG + Intergenic
1057760336 9:97868501-97868523 ATTAATTAGTCATAGGTGTATGG + Intergenic
1057813522 9:98276591-98276613 ATCAATTGACTATAAATGCAAGG - Intergenic
1058067983 9:100570573-100570595 ACCAATTGACCATAGATGTATGG + Intronic
1058413506 9:104761573-104761595 ACCAGTTGGCTGTAGATGTATGG - Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1058609958 9:106764770-106764792 ATCAGATGGCTATAGATGTGTGG + Intergenic
1058992157 9:110264783-110264805 GTCAATTGACTATAGATTTATGG - Intergenic
1059594489 9:115703748-115703770 ATCAAATGGCCATAGATATATGG - Intergenic
1060902272 9:127270221-127270243 ATCAATTGACTATAGATGTGAGG + Intronic
1062140350 9:134953791-134953813 ATCAATAGGCCATAGATGTGAGG + Intergenic
1187129243 X:16485684-16485706 ATCAATTGACCATAAATGTAAGG - Intergenic
1187194164 X:17066070-17066092 ATCAACTGACCATAGATGTAAGG + Intronic
1187594031 X:20751168-20751190 ATGAGTTTACTATAGATGTATGG + Intergenic
1187798388 X:23030649-23030671 ATCAATTGGCCATATTTGTATGG + Intergenic
1187811515 X:23183089-23183111 ATTAATTATCTATAAATGTGTGG + Intergenic
1188079678 X:25821769-25821791 ATCAGTTGGCAATATATGTACGG - Intergenic
1188327828 X:28828664-28828686 ATCAATTGACTATAAATGTGAGG + Intronic
1188426654 X:30055359-30055381 ATGAATTCACTGTAGATGTACGG + Intergenic
1188524427 X:31073771-31073793 ATCAATTGACCATAGATGTATGG + Intergenic
1188825682 X:34831377-34831399 ATCAGTTAGCTATAAATATATGG - Intergenic
1188854779 X:35180423-35180445 ATCAATTGATAATAGATGTATGG - Intergenic
1189082146 X:37985866-37985888 ATCATTTGACTATAGATGTATGG - Intronic
1189125963 X:38446516-38446538 ATCAGTTGGCTACAGTTGTATGG + Intronic
1189422586 X:40869680-40869702 ATCAGTTGGCTGTAGATGTGTGG + Intergenic
1189555009 X:42133854-42133876 ATCAATTAACCATAAATGTAAGG + Intergenic
1189575233 X:42344130-42344152 ATCAGATTGCTGTAGATGTATGG - Intergenic
1189584071 X:42439549-42439571 TTCAGATGGCTATAGATGTATGG - Intergenic
1189681045 X:43516774-43516796 ATCTTTTAGCTAATGATGTATGG + Intergenic
1189699696 X:43705313-43705335 ATCAATTGGGCATAAATGTAAGG - Intronic
1189769069 X:44404551-44404573 ATCAGTTGGCTATAAATGTGTGG + Intergenic
1190371420 X:49745770-49745792 ATGAATTCACTGTAGATGTATGG - Intergenic
1190585932 X:51942071-51942093 ATCAGTTGGCTGTAGATGTGTGG - Intergenic
1190785095 X:53638870-53638892 ATTAGTTAACTACAGATGTAGGG - Intronic
1190796555 X:53750032-53750054 ATCACTTGGCCATAAATGTAAGG - Intergenic
1190837165 X:54111977-54111999 ATCAATTAGCTGTAGGTATGTGG - Intronic
1190896431 X:54623016-54623038 ATCAATTGGTCATAGGTGTATGG + Intergenic
1191047459 X:56154297-56154319 ATCAGATAGTTATAGATGTGTGG - Intergenic
1191165314 X:57384017-57384039 ATCAGATAGCTGTAGATGTGTGG - Intronic
1191193209 X:57689094-57689116 ATCAGATAGCTGTAGATGTGTGG - Intergenic
1191656746 X:63606939-63606961 ATCAGATAACTATAGATGTATGG - Intergenic
1191695786 X:63988778-63988800 ATCAGATGGTTATAGATGTATGG - Intergenic
1191726557 X:64287659-64287681 ATCAGATAGCTGTAGATGTGTGG - Intronic
1191768450 X:64728580-64728602 ATCAAATGGTTATAGATGTGTGG + Intergenic
1191822154 X:65322539-65322561 ATCAGTTAACCATAAATGTATGG + Intergenic
1191830775 X:65413577-65413599 ATCAATTGACTATAGGTTTATGG + Intronic
1191986906 X:66991780-66991802 ATTAGTTTGCCATAGATGTATGG + Intergenic
1192257692 X:69478407-69478429 ATCAGTTACCTATATATGTGTGG - Intergenic
1192378097 X:70585697-70585719 ATCAGTCAGCCATAGATGTATGG - Intronic
1192540047 X:71960676-71960698 ATCAATTTTCTGTAGATGCATGG + Intergenic
1192559732 X:72119068-72119090 ATCCATCAGCCATATATGTATGG + Intergenic
1192813005 X:74564648-74564670 ATGAGTTCACTATAGATGTATGG - Intergenic
1193020708 X:76789953-76789975 ATCAGTTGGCTGTAAATGTATGG - Intergenic
1193214400 X:78845796-78845818 ATCAATTAACCATATATGTGTGG - Intergenic
1193301607 X:79895556-79895578 ATCAAATAGTTGTAGGTGTATGG - Intergenic
1193318720 X:80095448-80095470 ATGAATTAGGTATTGATGGAAGG + Intergenic
1193343969 X:80384397-80384419 ATGAATTAGGTATTGATGGAAGG + Intronic
1193368386 X:80661985-80662007 ATCAATTAATCATAGATGTATGG + Intergenic
1193406935 X:81112081-81112103 ATCAATAAACCACAGATGTATGG - Intergenic
1193542877 X:82793145-82793167 ATCAGATGGCTGTAGATGTATGG - Intergenic
1193782903 X:85724491-85724513 ATCAGTTGGCTATAAATGCATGG + Intergenic
1193932301 X:87568691-87568713 ATCAACTGACCATAGATGTATGG - Intronic
1194248506 X:91543752-91543774 ATCAGATAGCTATAGATGTGTGG - Intergenic
1194378067 X:93160533-93160555 ATCAATGGGCTATAAATGTGTGG - Intergenic
1195056816 X:101154054-101154076 ATCAATGGACCATAGATGTATGG + Intronic
1195059605 X:101181095-101181117 ATCAATTGACTATAGAAGTACGG + Intergenic
1195164259 X:102202707-102202729 ACCAATTTACCATAGATGTATGG + Intergenic
1195194601 X:102484388-102484410 ACCAATTTACCATAGATGTATGG - Intergenic
1195350980 X:103996847-103996869 AACCATTAGCTAAAGATGTGAGG + Intergenic
1195634341 X:107096453-107096475 ATCAATTGACCATAAATGTAAGG - Intronic
1195648442 X:107259441-107259463 ATCAATTGGCCATAAATGTATGG + Intergenic
1195653156 X:107308428-107308450 ATCAATTGACAATAGATGTATGG - Intergenic
1195661950 X:107387740-107387762 ATCAATTGACCATAAATGTAAGG - Intergenic
1195781251 X:108467299-108467321 ATCAATTTACCATTGATGTATGG + Intronic
1195781804 X:108474894-108474916 ATCAACTGACTGTAGATGTATGG + Intronic
1195785964 X:108523388-108523410 ATCTATTCACCATAGATGTATGG + Intronic
1195823858 X:108975958-108975980 ATGAATTCACTGTAGATGTATGG - Intergenic
1196125136 X:112089541-112089563 ATCAATTGGCCATAGACATATGG + Intergenic
1196164615 X:112525124-112525146 ATCAATTGACCATAAATGTATGG + Intergenic
1196256352 X:113523684-113523706 ATCAGTTGGCTATACATGCATGG + Intergenic
1196474163 X:116063309-116063331 ATCAATTAGCCATAAATTTGTGG + Intergenic
1196801761 X:119550406-119550428 ATCAGTTAACCATATATGTATGG - Intronic
1196914850 X:120522141-120522163 ATCAATTGGCCATAGCTGTATGG - Intergenic
1197185918 X:123587444-123587466 ATCAATTGACTATAAATGTGAGG + Intergenic
1197197514 X:123718133-123718155 ATTAATTGGCTATAAATGCATGG - Intronic
1197246005 X:124167256-124167278 ATTAATTGGCTATAGATGTATGG + Intronic
1197261196 X:124320201-124320223 ATTAAATAGTTATATATGTATGG - Intronic
1197273536 X:124451715-124451737 ATCAGATAGCTATAGATGTGTGG - Intronic
1197390281 X:125854898-125854920 ATCAATTAACTGTAGATGTGTGG + Intergenic
1197402906 X:126014131-126014153 ATGAGTTAACTGTAGATGTATGG + Intergenic
1197444886 X:126540893-126540915 ATCAATTGGCTATAAATTTATGG - Intergenic
1197538255 X:127719897-127719919 ATAAGTTAACTATATATGTATGG - Intergenic
1197582622 X:128303187-128303209 ATCAATTGGTTGTAGATGTGTGG - Intergenic
1197797327 X:130311760-130311782 ATCAATTGACCATAGATGTGTGG + Intergenic
1197982565 X:132232329-132232351 ATCAATTGACCATAGGTGTATGG + Intergenic
1198127873 X:133664343-133664365 ATCAATTAGCTATCCACTTAAGG + Intronic
1198153967 X:133939577-133939599 ATAAATTTGCTATAGTTGTATGG - Intronic
1198155603 X:133957205-133957227 AAAAGTTAGCTATAGATTTAAGG + Intronic
1198180509 X:134203459-134203481 ATCAACTGGCCATAGAAGTATGG - Intergenic
1198515943 X:137406841-137406863 ATCAATTGGCCATAGAGGTAAGG + Intergenic
1198529375 X:137535485-137535507 ATTAATTAACTATAGATGTGAGG - Intergenic
1198566239 X:137907870-137907892 ATCAGTTAACCATATATGTATGG - Intergenic
1198592223 X:138196614-138196636 ATCAATTGACTGTAGATGAATGG + Intergenic
1198771266 X:140132900-140132922 ATTAATTGACCATAGATGTATGG + Intergenic
1198794407 X:140380283-140380305 ATCAGATGGCTGTAGATGTATGG - Intergenic
1198964416 X:142212423-142212445 ATGAATTCACTATAGATGCATGG - Intergenic
1198973576 X:142309154-142309176 ATCAGCTAGCTGTAGGTGTATGG - Intergenic
1199047913 X:143198740-143198762 ATGAATTCACTATAGGTGTATGG + Intergenic
1199459083 X:148062913-148062935 ATGAGTTCGCTGTAGATGTATGG + Intergenic
1199707285 X:150439623-150439645 ATCAATTGGCCATAGATTAATGG + Intronic
1199781388 X:151063810-151063832 AGCAATTAATTGTAGATGTATGG + Intergenic
1200086016 X:153605946-153605968 ATCAATTGATCATAGATGTAAGG - Intergenic
1200271174 X:154685757-154685779 ATCAAATATCCATATATGTACGG - Intronic
1200328441 X:155267160-155267182 ATCAATTGACCATGGATGTATGG + Intergenic
1200365035 X:155653540-155653562 ATCAATTATACATAGATGTTTGG + Intronic
1201302328 Y:12519700-12519722 ATCAGATAGTTATAGATGTGTGG + Intergenic
1201687267 Y:16719639-16719661 ATCAATTAGGTATAATTATAAGG + Intergenic
1201980409 Y:19902207-19902229 ATCAAATTGTTGTAGATGTATGG - Intergenic
1202256335 Y:22924612-22924634 ATCAATTGGCTGTAGTTGTGTGG - Intergenic
1202338738 Y:23837760-23837782 ATAAATAAGCTATAAATGAAAGG - Intergenic
1202409325 Y:24558365-24558387 ATCAATTGGCTGTAGTTGTGTGG - Intergenic
1202461456 Y:25111713-25111735 ATCAATTGGCTGTAGTTGTGTGG + Intergenic
1202532028 Y:25832312-25832334 ATAAATAAGCTATAAATGAAAGG + Intergenic