ID: 1184058689

View in Genome Browser
Species Human (GRCh38)
Location 22:42068746-42068768
Sequence CTTGCAAAGCAGTAAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184058686_1184058689 -7 Left 1184058686 22:42068730-42068752 CCTGCAATGGCTGGCTCTTGCAA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1184058689 22:42068746-42068768 CTTGCAAAGCAGTAAGTGGGAGG 0: 1
1: 0
2: 4
3: 13
4: 186
1184058683_1184058689 20 Left 1184058683 22:42068703-42068725 CCTGGGTTTAGGGTAGAATTGGC 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1184058689 22:42068746-42068768 CTTGCAAAGCAGTAAGTGGGAGG 0: 1
1: 0
2: 4
3: 13
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184058689 Original CRISPR CTTGCAAAGCAGTAAGTGGG AGG Intronic
900817897 1:4863915-4863937 CATTTAAAGCAGTATGTGGGGGG - Intergenic
901646898 1:10721707-10721729 CCTGCAAACCAGGAAGTGGACGG + Intronic
904832116 1:33312004-33312026 CTGTCAAAGCTGTGAGTGGGAGG - Intronic
905329954 1:37187542-37187564 CCTGCACAGCAGTGAGTGGGTGG - Intergenic
905343567 1:37295797-37295819 CTGGGGAAGTAGTAAGTGGGAGG + Intergenic
911406264 1:97444077-97444099 CTTGCAAAGCATTAAGAGCTGGG + Intronic
911647992 1:100356022-100356044 CTTGGAAAACAGCAAGTGTGAGG + Intronic
919451297 1:197775476-197775498 CTTGCAAATCAGGAAGTCGCCGG + Intronic
920877314 1:209849112-209849134 CTTGCAAGGCATGAAGTCGGGGG + Intronic
920938682 1:210459933-210459955 CTTTCAAAGGTGTAACTGGGCGG + Intronic
924097361 1:240566406-240566428 CTCTCAAAGCAGTAAGCTGGGGG - Intronic
1064368370 10:14728655-14728677 CTTGCAAAGCAGTCAGCTGTGGG + Intronic
1064913297 10:20427264-20427286 CTGGCAAAGCAGTTGGGGGGAGG + Intergenic
1067136699 10:43614896-43614918 CTTGCAAAGCAGTGAGGAAGAGG - Intronic
1068616691 10:59126358-59126380 CTCACTAAGAAGTAAGTGGGAGG - Intergenic
1069029433 10:63579784-63579806 GTTGCTAAGAAGTAAGTTGGAGG + Intronic
1070721389 10:78759665-78759687 ATTGCAAAGCAATGTGTGGGAGG - Intergenic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1077701733 11:4448597-4448619 CTTGCAAAAAGGTAAGTGTGGGG + Intergenic
1079438055 11:20477809-20477831 GCTGCAAAACAGGAAGTGGGGGG - Intronic
1082212210 11:49518879-49518901 CTTGCATGGCAGTTGGTGGGAGG - Intergenic
1082903428 11:58281635-58281657 CTTACAAAGAAGAGAGTGGGGGG - Intergenic
1086062302 11:82712402-82712424 CTTGGAAAGAAAGAAGTGGGTGG - Intergenic
1086637379 11:89105634-89105656 CTTGCATGGCAGTTGGTGGGAGG + Intergenic
1087630470 11:100645021-100645043 CTTTGAAATCAGTAAGTGTGTGG - Intergenic
1088155454 11:106797757-106797779 CATTCAAAGCAGTATGTGGAGGG + Intronic
1088715729 11:112547536-112547558 CTCAGAAAGCAGTAAGTGAGTGG + Intergenic
1089271775 11:117306504-117306526 CTTGGAAAAGAGTAAGTGGTAGG + Intronic
1089363826 11:117909045-117909067 CTTGCAGAGGAGATAGTGGGGGG - Intronic
1089552071 11:119287220-119287242 CTTGAAAAGCAGTCAGTGGGTGG + Intronic
1092144204 12:6203412-6203434 CTTGAAAAGCAGGAATTGTGAGG + Intronic
1096991199 12:55805301-55805323 CTAGCAAAGCATTTAGTGAGTGG + Intronic
1097708376 12:62892300-62892322 ATTTCAAAGCAGTAAGAGGCTGG - Intronic
1099697907 12:86044578-86044600 CTGGCAAAGCAGCATGGGGGAGG + Intronic
1102455610 12:113069247-113069269 CTAGCAAAGCAGGAAGTGGAGGG - Intronic
1103343639 12:120235042-120235064 CTTGCTAGGCAGTGAGTTGGAGG - Intronic
1105620416 13:22061001-22061023 ATTGCTGAGGAGTAAGTGGGAGG + Intergenic
1108118596 13:47159391-47159413 CTTGCCAAGAAGTCAGTGGCAGG + Intergenic
1108902985 13:55435818-55435840 CCTGTAAAGCGGTAAGGGGGTGG - Intergenic
1110383364 13:74879435-74879457 CTTGCATAGCTGTAAGGGGCAGG + Intergenic
1113122740 13:106941978-106942000 CCTGCATAGCAGGAAGTGAGCGG - Intergenic
1116039685 14:39670562-39670584 CTTGCAAGGCAGTGAGTTGAAGG + Intergenic
1118452102 14:65912592-65912614 CTTCCCAAACAGTAAGTGGAGGG + Intergenic
1118603859 14:67488879-67488901 CCTGCAGACCAGGAAGTGGGAGG - Intronic
1119369600 14:74128157-74128179 CTTTCAAAGCAGTAAGCTTGGGG - Intronic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1122412793 14:101534523-101534545 CCTGCAATGCAGAAAGTAGGGGG + Intergenic
1125517890 15:40333034-40333056 TTTGGAAGGCAGTGAGTGGGTGG - Intronic
1125838551 15:42775882-42775904 CTTCCAAAGCAGGATGTGGCAGG - Intronic
1126227643 15:46289831-46289853 CCAGCAAAGCAGTATGGGGGAGG + Intergenic
1126594725 15:50373898-50373920 CTTGCATAGCAGTCTGTTGGTGG - Intergenic
1127564981 15:60178577-60178599 CTTTCAAAGCAGTATGAGGGGGG + Intergenic
1127805237 15:62513215-62513237 CCTGCAAAGCAGTAAGGAGGGGG - Intronic
1128554766 15:68623790-68623812 CTTGCAAAGCATGAGGTTGGAGG + Intronic
1131358666 15:91769265-91769287 GTTGAAAAGCAGTAAGTGCAAGG + Intergenic
1131546727 15:93321976-93321998 CATGCATAGCAGGAACTGGGCGG + Intergenic
1139067352 16:63334399-63334421 CTTGGACAGTAGTAAGTGGCAGG - Intergenic
1140298632 16:73734187-73734209 GCTGCACAGCAGGAAGTGGGAGG - Intergenic
1141820176 16:86440340-86440362 TCAGCAAGGCAGTAAGTGGGGGG - Intergenic
1144026665 17:11282805-11282827 GCTGCCAAGCAGCAAGTGGGAGG + Intronic
1144113530 17:12063170-12063192 TTTGTAAAACAGTAAGTTGGGGG + Intronic
1145390159 17:22449397-22449419 CTTGAAAAGCAGGTAGTGGAGGG + Intergenic
1146111440 17:30093663-30093685 ATTGGAAAGCAGAAAGTGGTGGG - Intronic
1148013202 17:44502697-44502719 CTTGGAAAGCAGTAAGTTACTGG - Intronic
1148217865 17:45843569-45843591 TTTTCAAAGCAGTTAGTGTGCGG - Intergenic
1151881096 17:76895011-76895033 GCTGCACAGCAGGAAGTGGGCGG + Intronic
1151968500 17:77444808-77444830 CGGGCTAAGAAGTAAGTGGGCGG + Intronic
1153550949 18:6261541-6261563 GCTGGAAGGCAGTAAGTGGGAGG - Intronic
1154040952 18:10855353-10855375 CTTGCATAGTAGTCATTGGGTGG + Exonic
1155283747 18:24268051-24268073 CATGCAAAGGAGTGAGTGTGAGG - Intronic
1155774152 18:29737733-29737755 CTGGCAGAGCAGCATGTGGGAGG + Intergenic
1157313325 18:46568666-46568688 CATGAAAAGCAGTAATGGGGAGG - Intronic
1158369528 18:56784139-56784161 CTTTCAGAGGAGTAAATGGGAGG + Intronic
1158380016 18:56919318-56919340 CTTCCCAGGCAGGAAGTGGGAGG - Intronic
1160087985 18:75797182-75797204 TGTGCAAACCAGTAAGTGTGTGG + Intergenic
1162070034 19:8147857-8147879 CTTGAAAAGCTTTGAGTGGGAGG + Intronic
1164843587 19:31413080-31413102 CATGGAGAGCAGTAGGTGGGTGG - Intergenic
1166594005 19:44028252-44028274 CCAGCTAAGCAGAAAGTGGGAGG - Intronic
1167500302 19:49842823-49842845 CTTGCAAAGGAGCAGGTGGTAGG + Intergenic
1168200268 19:54810022-54810044 ATTGCAAAGGATTAAATGGGAGG + Intronic
926438730 2:12864186-12864208 CTTTCTATGCAGCAAGTGGGAGG + Intergenic
927178069 2:20424327-20424349 CTTGCCAAGCAGCAAGTCAGTGG + Intergenic
928680803 2:33700339-33700361 CCAGCAAAGCAGTAAGGAGGTGG - Intergenic
930684787 2:54296284-54296306 CTTCCAAAGCAATAAATGCGTGG + Intronic
931720372 2:65062982-65063004 CTTGGACAGAAGTGAGTGGGAGG + Intronic
932161042 2:69459796-69459818 CTTGAAAAGTAGTATGTGGTTGG - Intronic
935124215 2:100208677-100208699 GGTGCACAGCAGAAAGTGGGGGG + Intergenic
935900287 2:107784317-107784339 CTGGCAATGCAGTAACTGTGAGG - Intergenic
936932037 2:117799755-117799777 CTTGCAAAGCAGAGGCTGGGGGG - Intergenic
937079955 2:119133744-119133766 CATGCACAGCAGGAAGTGGCAGG - Intergenic
938066051 2:128282623-128282645 CCTGCAAGGCAGGAAGTGGCAGG + Intronic
938757456 2:134393858-134393880 CTTCCAAAGCAGCAGGTGGTGGG - Intronic
938911379 2:135888592-135888614 CTTGCTAAGAAGTGAGTGGTTGG + Intergenic
941517043 2:166492974-166492996 CTGGCAAATCAGTAATTGAGCGG - Intronic
943093797 2:183404806-183404828 CAAGCAAAGCAGCAAGGGGGAGG + Intergenic
943361032 2:186919608-186919630 CTTGGAAAGGAGTATGTGGATGG - Intergenic
943727482 2:191267160-191267182 CTTAAAAAGCTGTGAGTGGGAGG - Intronic
944759769 2:202802837-202802859 CTTTCAAATCAGTAAATGGCAGG + Intronic
945167085 2:206957683-206957705 CTTTCAGAGCGGTAGGTGGGTGG - Intronic
946434927 2:219645037-219645059 CTCGGAAAGCAGTAAGGGGCGGG - Intergenic
946673178 2:222128412-222128434 GTGTCAAAGCAGTCAGTGGGAGG + Intergenic
947338227 2:229109494-229109516 TTTGCAAAACAGTGGGTGGGAGG - Intronic
1169718672 20:8648169-8648191 ATACCAAAGCAGGAAGTGGGTGG + Intronic
1170333904 20:15247541-15247563 CATGTAAAGCAGAAAGTGGCAGG - Intronic
1171478636 20:25434885-25434907 CTTGCATAGCAGAAGGTGGAAGG + Intronic
1174418810 20:50385887-50385909 ATTGCAATGAAGTAAGGGGGTGG + Intergenic
1174563994 20:51451603-51451625 GGCGCACAGCAGTAAGTGGGTGG + Intronic
1180032479 21:45222022-45222044 CTTGGAGCGTAGTAAGTGGGAGG - Exonic
1180100773 21:45583979-45584001 CCTGCACAGCAGCAAGTGAGTGG - Intergenic
1181045108 22:20210677-20210699 CTCACAAAGCAGCAAGGGGGAGG - Intergenic
1181572434 22:23774873-23774895 CTTGCAATCCAGAAAATGGGAGG - Intronic
1183731863 22:39622699-39622721 GATGCAGAGCAGCAAGTGGGTGG + Intronic
1184058689 22:42068746-42068768 CTTGCAAAGCAGTAAGTGGGAGG + Intronic
1185323614 22:50214967-50214989 CTTTCAAAGCAGTTACTGAGGGG + Intronic
953196101 3:40735015-40735037 CTTGTAAACCAGTAGTTGGGGGG + Intergenic
954341431 3:49957089-49957111 CTTGCAAAGAATGAAGCGGGAGG - Intronic
955505658 3:59630645-59630667 CTTAGAAAGCACTGAGTGGGAGG - Intergenic
955668050 3:61371030-61371052 CTTGCAAAGCAGAAACTGATTGG - Intergenic
955803940 3:62714398-62714420 GTTCCAAAACAGTAAGTGGAAGG - Intronic
955943976 3:64173564-64173586 CTTGCAAGGCAGTATGAGGCCGG + Intronic
956092442 3:65682271-65682293 CCTACAAAGAAGGAAGTGGGAGG + Intronic
956656437 3:71557657-71557679 CTTGAAGAGCAGAAAGTCGGAGG - Intronic
957955017 3:87175365-87175387 TTTGGAAATCAGTAAGTGGGAGG - Intergenic
958064725 3:88528778-88528800 CTAGCAAAGCAGTAGGGGGAGGG + Intergenic
960216315 3:115042632-115042654 TTTGTAAATCAGTAAGTGGGTGG - Intronic
960264588 3:115605885-115605907 GTGGCAAAGCAGCAAATGGGTGG + Intergenic
962414941 3:135173472-135173494 CTGGAAAAGCAGTGGGTGGGAGG - Intronic
963226686 3:142869441-142869463 CTTGCAAAGCTGTCTGTTGGGGG + Intronic
963929544 3:150989311-150989333 CTTCCAAAGGAGTAAATGGCTGG - Intergenic
966197366 3:177326713-177326735 TCTGCAAAGCAGTATGTGGACGG - Intergenic
966473320 3:180317087-180317109 CAGGCAAAGCAAAAAGTGGGAGG - Intergenic
967475712 3:189914989-189915011 CTTGCAAAACTGAATGTGGGTGG - Intergenic
968266713 3:197368544-197368566 CCTGCAAGGCAGGAAGGGGGAGG + Intergenic
971258298 4:25032894-25032916 CTTGCACAGCAGTAAGTGGCAGG - Intergenic
971328312 4:25662397-25662419 GTTGCAAAGCATCAACTGGGTGG - Intronic
973554660 4:52070864-52070886 CTCCCAAAAGAGTAAGTGGGGGG + Intronic
974438617 4:61888579-61888601 CTTACATAGCAGTAAATGGAAGG + Intronic
975526508 4:75356413-75356435 CTAGCACTGCAGTAACTGGGTGG + Intergenic
975909234 4:79248294-79248316 CTGACAAAGCAGTATGGGGGAGG - Intronic
976389226 4:84492793-84492815 GTTGCACAGCAGTGTGTGGGGGG + Exonic
977457921 4:97284843-97284865 CTTACAAACCAGTCAGGGGGAGG - Intronic
977876706 4:102158238-102158260 GTTGCACAGCAGGAAGTGAGTGG - Intergenic
982159194 4:152550567-152550589 CAAGCAAAGCATTATGTGGGTGG - Intergenic
982878899 4:160685990-160686012 CTTGCAAAGCAGCACATAGGAGG - Intergenic
983711281 4:170719929-170719951 CTTCCAAATCAGAAAGTGGGAGG + Intergenic
985149359 4:186930160-186930182 CTCGCAAAGCCGTAACTGGAAGG - Intergenic
989822431 5:45810002-45810024 CTTCCAAAGCAGGAAGTAGTAGG + Intergenic
990718283 5:58663818-58663840 CTTGCAAAGCAATTGGTGGCAGG + Intronic
991479465 5:67061704-67061726 CTTGTTAAGCAGAAAGAGGGAGG - Intronic
993211798 5:84961667-84961689 CCTGCAATGCAGCAAATGGGAGG + Intergenic
995441257 5:112194942-112194964 ATGGCAAAGCCGTAAGTCGGTGG + Intronic
996633866 5:125667233-125667255 CTTGCAACCCAGGAAGTGGTGGG - Intergenic
998472859 5:142396868-142396890 TTTGCAATGCAGAAAGGGGGTGG + Intergenic
998848947 5:146336737-146336759 CTTGCCAAGCAGTAGAAGGGAGG - Intronic
1001721663 5:173861864-173861886 ATTTCAAAGCAGTAAATTGGTGG - Intergenic
1002702027 5:181130965-181130987 CATGCAAAGCACTGGGTGGGGGG + Intergenic
1002975126 6:2067254-2067276 CATGCAAAGCAGTATGTAGAGGG + Intronic
1004864814 6:19842627-19842649 CTTGCAAAGCAGAAACGGGAAGG - Intergenic
1005591537 6:27333606-27333628 CTTGCAACGGAATAAGTTGGAGG - Intergenic
1007335166 6:41150487-41150509 CTCTGGAAGCAGTAAGTGGGTGG - Intronic
1007854186 6:44837488-44837510 CTTGCAAAATGGTAAGTGTGTGG - Intronic
1008094095 6:47321227-47321249 CTTGTAAAGAAGGAAGTGGAGGG - Intergenic
1009030314 6:58048971-58048993 CTTGTAAAACAGGGAGTGGGAGG + Intergenic
1010529556 6:76950897-76950919 CTGGCACAGCAGCAAGTGTGGGG - Intergenic
1010740300 6:79495042-79495064 CTTGCACAGCAGGAGGTGAGTGG + Intronic
1011262989 6:85487859-85487881 CTTGTAAAGCAGTATGTTGGTGG - Intronic
1015834215 6:137402475-137402497 TTTGCATAGCAGTAAGTGGGTGG - Intergenic
1015898167 6:138036770-138036792 CATCCCAAGCAGTAAATGGGTGG - Intergenic
1020683730 7:11268396-11268418 CATCCAAACCAGTAAGTGGGAGG - Intergenic
1020945415 7:14599881-14599903 CTTACATAACAGTAAATGGGAGG + Intronic
1023921144 7:44631015-44631037 GTTGCATAGCAGGAAGTGAGCGG - Intronic
1024215581 7:47245683-47245705 CGTGCAAAGCAGAATGTGTGGGG + Intergenic
1030756401 7:113292095-113292117 CTTGCAATGCAGTGAGCAGGGGG - Intergenic
1030904008 7:115160338-115160360 GCTGCAAAGCAGGAAGTGAGTGG + Intergenic
1032324969 7:130918962-130918984 CTTGCCAAGGAGCAACTGGGTGG + Intergenic
1033452796 7:141476748-141476770 GCTGCAAAGCAGAAAGTGTGCGG - Exonic
1035951141 8:4022590-4022612 GTCGCAAAGCAGTAACTTGGAGG - Intronic
1039377162 8:37045968-37045990 GTTGCAAAAGAGAAAGTGGGAGG - Intergenic
1040674743 8:49735055-49735077 CTCTCAACACAGTAAGTGGGAGG + Intergenic
1041942314 8:63402300-63402322 CAAGCAAAGCTGGAAGTGGGAGG + Intergenic
1042532914 8:69833169-69833191 CCTGCAAAGCAGAAAGAGGGCGG + Exonic
1043397310 8:79851618-79851640 CTTGAGAAAGAGTAAGTGGGAGG - Intergenic
1044937744 8:97309297-97309319 GTTGCACAGCAGAAAGTGAGTGG + Intergenic
1045109834 8:98929824-98929846 CTTGAAAAGCAGAAAGTGCTTGG + Intronic
1045380993 8:101625704-101625726 CTTGCCAATCAGAAAGTAGGTGG + Intronic
1048071797 8:131028989-131029011 GTTGCACAGCAGCAAGTGAGAGG + Intronic
1048930612 8:139312633-139312655 TTTGCAAAGCAGTAAGTGTGAGG - Intergenic
1057179906 9:93024123-93024145 ATTGCCAAACAGTAAGTGTGAGG + Intronic
1057828267 9:98387846-98387868 CTTGCAAAGAAGGAATTTGGAGG - Intronic
1058013136 9:100000186-100000208 TTTGGAAGGCCGTAAGTGGGAGG + Intronic
1058916223 9:109568507-109568529 CTGGCAAAGCAGTTGGGGGGAGG - Intergenic
1060439945 9:123628938-123628960 CATGCATAGCAGTAAGTGAATGG - Intronic
1062470608 9:136701985-136702007 TTTGCAAAGGTGTAAGTGGGGGG - Intergenic
1185807659 X:3075090-3075112 CTATCAAACCAGTGAGTGGGTGG + Intronic
1185835060 X:3337877-3337899 CTTGGAGGGGAGTAAGTGGGTGG + Intronic
1188216758 X:27488631-27488653 CTTGAAAAACACCAAGTGGGAGG - Intergenic
1189401044 X:40668915-40668937 CTTGGAGAGCAATAAGAGGGGGG + Intronic
1192101660 X:68271226-68271248 CTTGAAAAGCAGTAATTTGGTGG + Intronic
1192114413 X:68396872-68396894 CTTGATAAGTAGTAAGTGGCTGG + Intronic
1193017462 X:76751378-76751400 CAAGCAAAGCATTATGTGGGTGG - Intergenic
1195736127 X:108014385-108014407 CATGCAAAGCAGTATGTAGAGGG + Intergenic
1196349042 X:114703550-114703572 CTTTCAAAGCAGTGAGTAGAAGG + Intronic
1196495113 X:116315973-116315995 AGTGCAAAGGAGAAAGTGGGTGG + Intergenic
1200154338 X:153967380-153967402 CTTGCAGAGCATGAAGTGGTTGG - Intronic