ID: 1184059608

View in Genome Browser
Species Human (GRCh38)
Location 22:42074099-42074121
Sequence CACCGACCAGTGCTGTGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184059590_1184059608 27 Left 1184059590 22:42074049-42074071 CCGAGGCCCGCGGACCGTCCGAG 0: 1
1: 0
2: 0
3: 1
4: 115
Right 1184059608 22:42074099-42074121 CACCGACCAGTGCTGTGGCTCGG 0: 1
1: 0
2: 0
3: 16
4: 123
1184059603_1184059608 -1 Left 1184059603 22:42074077-42074099 CCTCTGGGTTCGAGGCCGCCCGC 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1184059608 22:42074099-42074121 CACCGACCAGTGCTGTGGCTCGG 0: 1
1: 0
2: 0
3: 16
4: 123
1184059601_1184059608 9 Left 1184059601 22:42074067-42074089 CCGAGGGGGGCCTCTGGGTTCGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1184059608 22:42074099-42074121 CACCGACCAGTGCTGTGGCTCGG 0: 1
1: 0
2: 0
3: 16
4: 123
1184059596_1184059608 21 Left 1184059596 22:42074055-42074077 CCCGCGGACCGTCCGAGGGGGGC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1184059608 22:42074099-42074121 CACCGACCAGTGCTGTGGCTCGG 0: 1
1: 0
2: 0
3: 16
4: 123
1184059597_1184059608 20 Left 1184059597 22:42074056-42074078 CCGCGGACCGTCCGAGGGGGGCC 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1184059608 22:42074099-42074121 CACCGACCAGTGCTGTGGCTCGG 0: 1
1: 0
2: 0
3: 16
4: 123
1184059600_1184059608 13 Left 1184059600 22:42074063-42074085 CCGTCCGAGGGGGGCCTCTGGGT 0: 1
1: 0
2: 1
3: 6
4: 113
Right 1184059608 22:42074099-42074121 CACCGACCAGTGCTGTGGCTCGG 0: 1
1: 0
2: 0
3: 16
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184059608 Original CRISPR CACCGACCAGTGCTGTGGCT CGG Intergenic
901393113 1:8960367-8960389 CAACTATCAATGCTGTGGCTGGG + Intronic
901685498 1:10941291-10941313 CACTGTCCAGGGCTGTGTCTGGG + Intergenic
903708185 1:25302359-25302381 GACAGACCAGTGGTGGGGCTCGG + Intronic
903718924 1:25390054-25390076 GACAGACCAGTGGTGGGGCTCGG - Intronic
907306557 1:53516378-53516400 AACCGAGCAGGGCTGTGGCAGGG + Intronic
907441551 1:54481693-54481715 GACTGATCAGTGCTGTGGCAGGG + Intergenic
907569750 1:55472310-55472332 CACAGACCAATGCTGAGCCTAGG - Intergenic
913657132 1:120971893-120971915 CATGGACCAGTGCTGGGGGTTGG + Intergenic
914008475 1:143754977-143754999 CATGGACCAGTGCTGGGGGTTGG + Intergenic
914647105 1:149663628-149663650 CATGGACCAGTGCTGGGGGTTGG + Intergenic
915763239 1:158336528-158336550 CACCTGCCATTGCTGAGGCTTGG + Intergenic
922016353 1:221651921-221651943 CCCCAACCAGTGATGTGGATAGG - Intergenic
924375163 1:243399985-243400007 CACTTAGCAGTGCTGTGACTTGG - Intronic
1062787485 10:277752-277774 CACCGACAGGTGCTGTCGCCAGG - Intronic
1063077566 10:2732137-2732159 CACCAACCACTGCTGAGGCATGG + Intergenic
1064205579 10:13321080-13321102 CGTCGACCTGTGCTGTGGCGAGG - Intronic
1067791196 10:49288961-49288983 CAGGGGCCAGTGCTGTGGCCTGG - Intergenic
1070810509 10:79295372-79295394 GACCACCCAGTGCTGTAGCTGGG - Intronic
1071523319 10:86344381-86344403 CACTGGACAGTGCTGTGGCTGGG - Intronic
1071614822 10:87065872-87065894 CACCCATCAGTGCTGTGACTTGG - Intronic
1072805175 10:98419445-98419467 CACAGCCCTGTGCAGTGGCTGGG + Intronic
1073194196 10:101674798-101674820 CACAGACAAGTCCTGTGGCAGGG + Intronic
1077444837 11:2586131-2586153 CTCCGCCCAGTGCAGTGGCTGGG + Intronic
1081094950 11:38921135-38921157 CATCCACCATTGCTGAGGCTTGG - Intergenic
1085707434 11:78799279-78799301 CAATGACCAGTGTTGGGGCTGGG + Intronic
1092631472 12:10382154-10382176 CCCAGACCAGTGCTGTGCCAGGG - Intronic
1094682619 12:32679501-32679523 CACCGACCAGGCCTGCGGCCGGG - Intronic
1094755411 12:33463038-33463060 CATCCACCATTGCTGAGGCTTGG + Intergenic
1103165319 12:118765388-118765410 CACGCACCAGTGATGAGGCTGGG - Intergenic
1103592852 12:122004481-122004503 CACTCACCAGTGTGGTGGCTTGG + Intergenic
1104050670 12:125191443-125191465 CACAGACCAGTGCCTGGGCTGGG - Intronic
1104301890 12:127571873-127571895 CACCGAACAGTGCTGATGATGGG - Intergenic
1106409373 13:29500270-29500292 CAGAGGCCAGTCCTGTGGCTAGG + Intronic
1108549248 13:51526818-51526840 CATCCACCATTGCTGAGGCTTGG + Intergenic
1108647096 13:52441111-52441133 CACAGACCAGTACTGGGGGTTGG + Intronic
1111993449 13:95139270-95139292 CTGAGACCAGTGTTGTGGCTGGG + Intronic
1113591091 13:111501807-111501829 CACCCGCCATTGCTGAGGCTTGG - Intergenic
1113764338 13:112871498-112871520 CCACCACCAGTTCTGTGGCTTGG - Intronic
1113912587 13:113850568-113850590 CAGCTAACAGTGCAGTGGCTTGG - Intronic
1114210247 14:20607978-20608000 CACAGTCCATTTCTGTGGCTTGG + Intronic
1114512934 14:23277421-23277443 CACTCACCAGTCATGTGGCTTGG - Intronic
1118314191 14:64715760-64715782 CACCTCCCAGGGCTGTGGCCTGG + Intronic
1122544491 14:102514667-102514689 CACCCACCAGTGGTGGGACTGGG + Intergenic
1122882210 14:104695245-104695267 CACCTACCATGGCTGTGGCTGGG - Intronic
1122894906 14:104752036-104752058 AACCGACCCGTCCTGTGGCGTGG - Intergenic
1124185827 15:27527818-27527840 CACCTACCGGTGACGTGGCTTGG + Intronic
1124410588 15:29433149-29433171 CAGCCACCAGTGCTGGGGCTGGG - Intronic
1124424213 15:29549607-29549629 CACAGACTAGTGCTGTTGTTGGG + Intronic
1127904295 15:63364924-63364946 CACACACCAGTGCAGTTGCTAGG - Intronic
1128403807 15:67314313-67314335 TACTGTCCAGTGCTGAGGCTGGG - Intronic
1129384468 15:75188336-75188358 CAGCTCCCAGTGCTGTGGCTGGG - Intergenic
1130532279 15:84756583-84756605 CATAGACCAGAGCTTTGGCTGGG - Intronic
1131356034 15:91748040-91748062 CAACTTCCAGGGCTGTGGCTGGG + Intergenic
1132735194 16:1382471-1382493 CAGCGCCCAGTGGTGGGGCTTGG - Intronic
1132742203 16:1420453-1420475 CACCGACCAGCGGTGAGGGTTGG + Exonic
1134422573 16:14108033-14108055 CACAGTCCACTGCTGTGGCCTGG - Intronic
1137579369 16:49623858-49623880 GACTGGCCAATGCTGTGGCTAGG + Intronic
1137745508 16:50817388-50817410 CTCTGAGCAGTGCTGTGGCTGGG - Intergenic
1139880013 16:70174622-70174644 CGCCGAGGAGCGCTGTGGCTGGG + Intronic
1140372498 16:74420895-74420917 CGCCGAGGAGCGCTGTGGCTGGG - Intronic
1142139079 16:88464608-88464630 CACCGACCATTGCCATGGCGGGG - Intronic
1142233360 16:88910116-88910138 CACCCGCCTGTGCTGTGCCTCGG + Intronic
1147516656 17:41124071-41124093 CTCTGACCAGGGCTGTGGCCTGG - Exonic
1147518017 17:41140436-41140458 CTCTGACCAGGGCTGTGGCCTGG - Exonic
1150209047 17:63431734-63431756 CACAGACCAGGGCTGGGGGTGGG - Intergenic
1151426160 17:74032388-74032410 CACCCACCCGACCTGTGGCTTGG - Intergenic
1158763137 18:60414398-60414420 CACAGACCAGTACTGGGGGTTGG + Intergenic
1159665886 18:71159118-71159140 CTCAGACCAGTTCTGTGGTTAGG + Intergenic
1160605117 18:80044433-80044455 CACAGGCCTGTGCTGTGGCCTGG + Intronic
1165684000 19:37802333-37802355 CACAGACCAGTACTATGGGTTGG + Intronic
1166276087 19:41755289-41755311 CACGGACCTCTGCTGTGTCTGGG - Intronic
929489147 2:42381087-42381109 CAAAGTCCAATGCTGTGGCTAGG + Intronic
935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG + Intergenic
936073936 2:109389856-109389878 CACCTGCCTGGGCTGTGGCTGGG + Intronic
938729539 2:134135778-134135800 CACCACCCATGGCTGTGGCTCGG - Intronic
1174048010 20:47747673-47747695 CACCCACCAGGCCTGTGGCTGGG - Intronic
1174080381 20:47967217-47967239 CACAGCCCACTGCTGGGGCTGGG + Intergenic
1174137212 20:48388056-48388078 CACAGCCCACTGCTGGGGCTGGG - Intergenic
1174331407 20:49821980-49822002 CACCTACCAGTGGTGTGACAGGG + Intronic
1175800088 20:61796552-61796574 CCCCGACCATTGCTCTGGCTTGG + Intronic
1176299084 21:5090192-5090214 CACCAACCAGAGCTGCGGCCAGG + Intergenic
1179376546 21:40854356-40854378 CACAGAGCTGAGCTGTGGCTGGG - Intergenic
1179857941 21:44171756-44171778 CACCAACCAGAGCTGCGGCCAGG - Intergenic
1182197051 22:28529364-28529386 CGCCCACCATTGCTGAGGCTTGG + Intronic
1183104813 22:35608252-35608274 CACCAGCCAGGGCTGTGGTTGGG - Intronic
1184059608 22:42074099-42074121 CACCGACCAGTGCTGTGGCTCGG + Intergenic
955403700 3:58611607-58611629 CACTGCCCAGTGCAGTGGGTGGG - Intronic
958906189 3:99944628-99944650 CACTTGCCAGTTCTGTGGCTTGG - Intronic
962891152 3:139674101-139674123 CACCCAGAAGTGCTGTGTCTGGG - Intronic
963225268 3:142855848-142855870 CACCGTCCAGTGCAGTGGGAGGG - Intronic
970643250 4:18090677-18090699 CACCTGCCATTGCTGAGGCTCGG + Intergenic
975150160 4:71012224-71012246 CGCCCACCATTGCTGAGGCTTGG + Intronic
977343681 4:95791824-95791846 CACCCACCAATGCTGAGGCTTGG + Intergenic
982016825 4:151162868-151162890 CAAAGACCAATCCTGTGGCTGGG - Intronic
987148627 5:15017054-15017076 CTCCTACCAGTGCTGGGGCATGG - Intergenic
988559100 5:32264207-32264229 CGGCAAGCAGTGCTGTGGCTTGG - Intronic
989398958 5:40988974-40988996 CACCTACCTGTGCAGTGGCCTGG + Intergenic
992742804 5:79790910-79790932 CAAGGACCAGTGCTGTCCCTAGG - Intronic
995926926 5:117386003-117386025 CAAGGTCCAGAGCTGTGGCTGGG - Intergenic
1001732088 5:173968229-173968251 CACTGCCCAGTGCAGGGGCTAGG + Intergenic
1004148527 6:13092250-13092272 CACAGACCAGTCCTGGGGCCTGG + Intronic
1010029478 6:71258157-71258179 CACCGAGCAGAGCTGAGGCTAGG - Intergenic
1011237222 6:85230769-85230791 CACCCACAAGTGCTTTGGCAGGG + Intergenic
1011296800 6:85835053-85835075 CACCCACCATTGCTGAGGCTTGG - Intergenic
1011668022 6:89654454-89654476 CACTGACCAGCTATGTGGCTTGG + Intronic
1012731855 6:102893235-102893257 CACCAACCAGGGCTGGGGGTGGG - Intergenic
1017485545 6:154898785-154898807 CACCACCCAGGGCTGTGGGTAGG + Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1019176807 6:170163919-170163941 CACGTACCAGTGCTGTGGGGCGG + Intergenic
1019422952 7:959480-959502 CACCCACCAGCGCTGTGGGAGGG - Intronic
1019622113 7:1997694-1997716 CACAGCCCAGTGCGGTGGCGGGG + Intronic
1020213447 7:6171747-6171769 CAGCGCCCAGTGCTGTAGGTGGG - Intronic
1022507960 7:30918516-30918538 CACTGCCCAGTGCTGAGTCTTGG + Intronic
1023262626 7:38373257-38373279 CTCCTGCCAGTGCTGTGGCCAGG + Intergenic
1023795710 7:43790201-43790223 CACCTCCCAGTGCAGCGGCTGGG - Intronic
1024204857 7:47149323-47149345 CATGGACCAATGCTGTGGCCTGG - Intergenic
1024738228 7:52328500-52328522 CGCCTACCATTGCTGAGGCTTGG - Intergenic
1025753053 7:64310546-64310568 CACTGACCAGCCCTGTGCCTGGG - Intronic
1026506048 7:70984898-70984920 CATTGACCAGTTCTGTGACTTGG - Intergenic
1026977051 7:74505403-74505425 CACCCACCTGGGCTGTGGCTCGG + Intronic
1030723799 7:112901151-112901173 CACGGACCAGTACTGGGGGTTGG - Intronic
1033484535 7:141775624-141775646 CACCCACCATTGCCGAGGCTTGG - Intronic
1033904519 7:146185561-146185583 AAGGGAGCAGTGCTGTGGCTCGG + Intronic
1034951661 7:155301094-155301116 CACCACCCAGTACTGGGGCTGGG - Intronic
1038087663 8:24217778-24217800 TACCCACCAGTGGTGTGGATTGG + Intergenic
1038088466 8:24226970-24226992 CACTTAACATTGCTGTGGCTTGG + Intergenic
1039897588 8:41727160-41727182 CACCTACCTGGGATGTGGCTTGG - Intronic
1041297275 8:56370898-56370920 CACCGAGCACTGTTGTGGGTGGG - Intergenic
1043436296 8:80239018-80239040 CACTGCACAGTTCTGTGGCTTGG - Intergenic
1048095277 8:131285339-131285361 CAAAAACTAGTGCTGTGGCTGGG + Intergenic
1049589295 8:143448984-143449006 CAGTGACCAGAGCTGTGCCTTGG + Intronic
1057704181 9:97386083-97386105 CACTGAACAGCCCTGTGGCTGGG - Intergenic
1060219123 9:121755120-121755142 CAATGACCAGTGCCGTGGGTGGG - Intronic
1060740170 9:126092586-126092608 CACAGAGCAGTGCTGGGGCTGGG + Intergenic
1060885018 9:127145319-127145341 CACTGACCAGCGCTGTGGCCTGG - Intronic
1060996459 9:127877095-127877117 CACTGAGCAGTGCTGTGGGAAGG + Intronic
1187821182 X:23290118-23290140 CACCTACCATTGCTGAGGTTAGG + Intergenic
1188104471 X:26133028-26133050 CACTCACCAGGGCTGGGGCTAGG + Intergenic
1189238010 X:39503413-39503435 CCCTGACCAGAGCTGAGGCTAGG + Intergenic
1195398390 X:104435562-104435584 CCCAGACCATTGCTCTGGCTGGG - Intergenic