ID: 1184060779

View in Genome Browser
Species Human (GRCh38)
Location 22:42079736-42079758
Sequence GCGGGTGCCCGGGTGAGGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 495}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184060766_1184060779 9 Left 1184060766 22:42079704-42079726 CCGAGGGCGGCACGAGGGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 228
Right 1184060779 22:42079736-42079758 GCGGGTGCCCGGGTGAGGGGCGG 0: 1
1: 0
2: 5
3: 42
4: 495
1184060764_1184060779 10 Left 1184060764 22:42079703-42079725 CCCGAGGGCGGCACGAGGGCTGG 0: 1
1: 0
2: 1
3: 20
4: 197
Right 1184060779 22:42079736-42079758 GCGGGTGCCCGGGTGAGGGGCGG 0: 1
1: 0
2: 5
3: 42
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184060779 Original CRISPR GCGGGTGCCCGGGTGAGGGG CGG Exonic
900087380 1:904950-904972 GCGGGGAGGCGGGTGAGGGGAGG + Intergenic
900244666 1:1631561-1631583 GAGGGTGCCAGGTTGCGGGGCGG - Intergenic
900344646 1:2205067-2205089 GGGGGAGCCCGGGGGAAGGGCGG - Intronic
900344685 1:2205146-2205168 GGGGGAGCCCGGGGGAGGGGCGG - Intronic
900391115 1:2434369-2434391 GTGGGTGCCCGGGAGAGAAGGGG - Intronic
900407315 1:2498390-2498412 GCCGGTGCCAGGGGGAGGGAGGG - Intronic
900609294 1:3537718-3537740 GCGTGTGCCCAGGGCAGGGGTGG - Intronic
900619463 1:3580263-3580285 GGGGGTGCAGGGGGGAGGGGTGG + Intronic
900629288 1:3625155-3625177 GCGGCGGCCCGGGCGGGGGGCGG + Exonic
900946748 1:5835086-5835108 ACGGGTGGCCGTGTGAGGGAAGG + Intergenic
900995417 1:6120954-6120976 GCAGGCCCCCTGGTGAGGGGAGG - Intronic
901183667 1:7358548-7358570 GGGGCTGCCCGGGGCAGGGGTGG - Intronic
901452754 1:9345889-9345911 GCAGTTGGCAGGGTGAGGGGTGG + Intronic
901667567 1:10835365-10835387 GCGGGAGGCCGGGCAAGGGGAGG + Intergenic
901749991 1:11400232-11400254 GCTGGAGCCTGGGTGAGGAGGGG + Intergenic
901810783 1:11765912-11765934 GTGGGTGCCCGGGTGCCAGGTGG + Exonic
901931036 1:12596186-12596208 GTGGGTGCCCGCCAGAGGGGCGG - Intronic
902503425 1:16925045-16925067 GGGGGTCCCAGGGTGTGGGGCGG + Intronic
902911045 1:19597306-19597328 GCAGCAGCCCGGGTGCGGGGTGG + Intronic
903261517 1:22134114-22134136 GCGGGTGTCCAGGTGGGGGCTGG + Intronic
903324747 1:22563477-22563499 GCGGGTGCCCGCGTGTGCGCTGG + Intergenic
904493344 1:30873446-30873468 GTGGGGGCCAGGGTGAGGAGAGG + Intronic
904525291 1:31128907-31128929 GCGAGTGTCCCAGTGAGGGGAGG + Intergenic
904541935 1:31239367-31239389 GCGTGTGCCCGGGCGGGGGGTGG - Intronic
904896112 1:33819688-33819710 GAGGGTGCCCTGGGGAAGGGAGG - Intronic
905033950 1:34905130-34905152 GCGGGGGCCGGGGTTGGGGGGGG - Exonic
905180424 1:36162196-36162218 GGGAGTGCCTGGGTGAGGGCTGG - Intronic
905337557 1:37256072-37256094 GCGGGGGAGCGGGGGAGGGGGGG - Intergenic
905408509 1:37753264-37753286 GTGGGTGCCCGTGAGAGGGGCGG + Intronic
905435475 1:37952502-37952524 GAAGGTGCCCGGGTGTGGGAAGG + Intergenic
905531892 1:38686518-38686540 GCTGCTGGCCGGGGGAGGGGAGG + Intergenic
905643685 1:39609814-39609836 GCAGGGACCCGGGTGATGGGAGG + Intergenic
907341446 1:53738798-53738820 GCGGGTGTGCGGGTGTGTGGCGG - Intergenic
907513792 1:54980776-54980798 GCGGGCGCCGGGGTGAGGCCTGG + Exonic
908131975 1:61082974-61082996 GCGTGTGCCCGCGGGTGGGGGGG + Intronic
912411607 1:109484126-109484148 GCGGGGGCCCGGAAGGGGGGAGG - Intronic
912435184 1:109656590-109656612 GCGTGCGCCGGGGTGGGGGGGGG + Intronic
912550738 1:110483727-110483749 GTGGGAGCCCAGGTGAGGGCTGG + Intergenic
913195749 1:116454738-116454760 GCAGCAGCCTGGGTGAGGGGAGG + Intergenic
914231370 1:145766780-145766802 GCGGCTGGCCGGGGGGGGGGGGG + Intronic
915333165 1:155126118-155126140 GCAGGTGCCCGAGGGAGAGGGGG + Intergenic
915354911 1:155250357-155250379 GCCGGTGCCCCGGTGGGGTGAGG + Exonic
915456101 1:156041861-156041883 GCTGGTACCCAGGTGAGGGTAGG - Exonic
915495880 1:156282502-156282524 CCGGGTGTCGGGGTGAGGTGCGG - Intronic
916549862 1:165839919-165839941 GCGGGGGCCGGGGTGGGGGAAGG - Intronic
917375554 1:174349031-174349053 GCGGCTGGCCGGGCGGGGGGGGG + Intronic
917964678 1:180170906-180170928 GTGGGTGCATGGGTGAGTGGTGG + Intronic
919914975 1:202133663-202133685 GTGGGGGCCCTGGGGAGGGGCGG + Exonic
920184731 1:204152495-204152517 GAGGTTGCCTGGGTGTGGGGGGG - Intergenic
920858004 1:209678815-209678837 TCTGGTGTCTGGGTGAGGGGAGG + Intergenic
921108730 1:212011551-212011573 TCAGGTGCTCGGGTTAGGGGAGG + Intronic
922314976 1:224434442-224434464 GCGGGGGCCGGGGAGAGGGTCGG + Intronic
922507693 1:226135990-226136012 GCGGGAGCCAGGGAGAGGGCGGG + Intergenic
922739416 1:228006995-228007017 GCGGGTGCGCGGGTGTGCGCGGG - Intergenic
923007865 1:230066897-230066919 GCGGGCGGCCGGGGGCGGGGCGG + Intronic
923017950 1:230141454-230141476 GTGGTTGCCAGGGGGAGGGGAGG - Intronic
1062827567 10:583973-583995 GCGGGGGCCAGGGTGCTGGGTGG + Intronic
1065100386 10:22325616-22325638 GCGGGCGGGCGGGGGAGGGGCGG - Intronic
1065590359 10:27256772-27256794 GCGGGAGCGGGGGTGGGGGGCGG - Intergenic
1065760816 10:28981789-28981811 GCTGTTGCGGGGGTGAGGGGTGG - Intergenic
1066022563 10:31318822-31318844 GCGGCTGCCCGGGGCAGGGAGGG - Intronic
1067103710 10:43351266-43351288 ACGGGGGCCCGGGTGTGGGTGGG - Intergenic
1067739013 10:48880895-48880917 GCAGGGTCCCTGGTGAGGGGAGG + Intronic
1068455571 10:57250114-57250136 GCCCGTGGCCGGGGGAGGGGAGG - Intergenic
1069806924 10:71132022-71132044 CCGAGTGCTAGGGTGAGGGGTGG - Intergenic
1070051004 10:72889746-72889768 GTGGCTGCCGGGGTGAGGGAGGG + Intergenic
1070570451 10:77636938-77636960 TCGGGTGCCGTGGTGCGGGGTGG - Intronic
1070768725 10:79070347-79070369 GTGGGGGCGCGGGCGAGGGGCGG + Intronic
1071579479 10:86756569-86756591 GCGGGGGCCTGGGGGAGGGGCGG - Intergenic
1073206204 10:101770740-101770762 GCGGGTGCCCAGGCAGGGGGTGG - Intronic
1073412131 10:103350951-103350973 GCGGGTGCAGGGGTGAGGGCGGG + Exonic
1075079150 10:119371185-119371207 GCTGCAGCCCGGGTGCGGGGAGG - Intronic
1075084513 10:119405560-119405582 GCTGGTGCCTGGGTGGGGGTGGG - Intronic
1076151636 10:128167195-128167217 GAGGGGGCGAGGGTGAGGGGAGG - Intergenic
1076379870 10:130017621-130017643 GCAGGAGCCCAGGTGATGGGGGG - Intergenic
1076604223 10:131678705-131678727 GTGGGGGCTCGGGTGAGGGGTGG + Intergenic
1076776153 10:132699349-132699371 GTGGGTGCTGGGGTGGGGGGGGG + Intronic
1076864362 10:133159951-133159973 GCGGGGCCCGGGGTGGGGGGCGG - Intergenic
1076864375 10:133159970-133159992 GCGGGGCCCGGGGTGGGGGGCGG - Intergenic
1076876853 10:133220357-133220379 GCGCGCGCCCAGGTGAGGAGGGG + Intronic
1076876911 10:133220549-133220571 GCGCGCGCCCAGGTGAGGAGGGG + Intronic
1077081510 11:726506-726528 GCTGGGGCCCGGGCGAGGGGTGG + Intronic
1077090662 11:777004-777026 AGGGGAGCCCGGGTGTGGGGAGG - Intronic
1077110733 11:860927-860949 GTGGGTGCCCAGGTGGGTGGTGG - Intronic
1077124490 11:926261-926283 GTGGGGGCCAGGGTGCGGGGTGG + Intronic
1077254012 11:1572578-1572600 CCGGGGGCCCGGGTGACGGGGGG - Intergenic
1077394718 11:2315296-2315318 GCTGGAGGCCTGGTGAGGGGTGG + Intronic
1077923124 11:6655929-6655951 GCGGGCGCCGGGGGGAAGGGGGG - Intergenic
1079308519 11:19345183-19345205 GCGGTTTCCCGGGTAACGGGAGG + Intergenic
1079689143 11:23400426-23400448 GGGGCTGCGGGGGTGAGGGGAGG - Intergenic
1080628526 11:34052176-34052198 GCGGCTCCGCGGGGGAGGGGCGG + Intronic
1081488147 11:43547525-43547547 GCGTGTGCTCGGGGGTGGGGCGG - Intergenic
1082788360 11:57330186-57330208 CTGGGTGCCTGGGTGAGGTGGGG - Intronic
1083180285 11:60980911-60980933 ACGAGGGCCCGGCTGAGGGGAGG + Intronic
1083180550 11:60982103-60982125 GCAGATGCCCGGGTGGGGGGCGG + Intronic
1083285535 11:61656452-61656474 GAGGGTGCAGGGGTGCGGGGTGG + Intergenic
1084190082 11:67494759-67494781 GGGGGTGCTGGGGGGAGGGGCGG + Intronic
1084266999 11:68010288-68010310 GCCAGTCCCCGGGGGAGGGGTGG - Intronic
1084561648 11:69908993-69909015 GCTGGTGCCAGGGTGAGGCGAGG + Intergenic
1084708474 11:70829599-70829621 GCCTGTGCAGGGGTGAGGGGCGG + Intronic
1085849166 11:80099671-80099693 GCGGGGGCCAGGAGGAGGGGAGG + Intergenic
1089498332 11:118918935-118918957 GGGGGTGCTGGGGTGATGGGAGG - Intronic
1089645472 11:119876004-119876026 TGGGGAGCCTGGGTGAGGGGTGG - Intergenic
1091207782 11:133833083-133833105 GAGGGTGCGGGGGTGAGGGAGGG + Intergenic
1091360660 11:134976543-134976565 GAGGGTGCCCGGGCCAGGGATGG - Intergenic
1095949363 12:47773468-47773490 GCGGGTGCGCGGCTGCGGGGCGG + Intronic
1096676863 12:53230775-53230797 GGGTGTGCCGGGGTGTGGGGGGG + Intronic
1096694596 12:53340543-53340565 GCGGGGGCCTGGGTGGGGGTAGG - Intronic
1097127987 12:56789485-56789507 GCGGCTGGCCGGGCGGGGGGGGG + Intergenic
1097147304 12:56950683-56950705 GAGAGGGCACGGGTGAGGGGAGG + Intergenic
1097169352 12:57104316-57104338 ACTGGGGCCCGGGTGAGTGGGGG - Intronic
1097183786 12:57185516-57185538 GTTGGTGCCTGGGGGAGGGGAGG - Exonic
1097264475 12:57737725-57737747 GCCGGTGCCAGGGTGCGGAGAGG + Exonic
1100490411 12:95073157-95073179 GCGGGGCCCCGGGAGAGGCGGGG - Intronic
1101504057 12:105330647-105330669 GCGGGTCCCCGGGCGGGGCGGGG + Exonic
1102036560 12:109773651-109773673 GCGAGTGGCAGGGGGAGGGGAGG + Intergenic
1102465934 12:113130874-113130896 GGTGGTGGCCAGGTGAGGGGTGG - Exonic
1102682300 12:114698924-114698946 GCCGCTGCTGGGGTGAGGGGAGG - Intergenic
1104670498 12:130676849-130676871 GCTGGGGTCAGGGTGAGGGGAGG + Intronic
1104748626 12:131224654-131224676 GGTGGGGCCAGGGTGAGGGGAGG + Intergenic
1104784496 12:131440910-131440932 GGTGGGGCCAGGGTGAGGGGAGG - Intergenic
1104846252 12:131848589-131848611 GGGGGTGCCCAGGGGAGGGGCGG - Intronic
1104887350 12:132118496-132118518 GGGGCTGCCCAGGGGAGGGGCGG - Intronic
1105015888 12:132786662-132786684 GCATGTGCCCGGGGGAGGTGCGG - Intronic
1105070045 12:133228669-133228691 GTGGGGCCCCTGGTGAGGGGAGG + Intronic
1106157302 13:27171210-27171232 GCCTGTGCCGGGGTGAGGGGTGG - Intronic
1106827746 13:33542673-33542695 GAGGGTTCCCGCGTGAGGGCGGG - Intergenic
1109008589 13:56910155-56910177 GTGGGGGCCGGGTTGAGGGGTGG - Intergenic
1110089151 13:71423434-71423456 GTGGGTGGAGGGGTGAGGGGAGG + Intergenic
1112139595 13:96623755-96623777 CAGGGTGCCCGGGTGAGAGATGG + Intronic
1113737932 13:112690823-112690845 GCCGGGGCCCGGGTCTGGGGAGG + Intronic
1113775775 13:112943979-112944001 GGAGGGTCCCGGGTGAGGGGAGG + Intronic
1113910996 13:113841179-113841201 CCCGGTGCCAGGGTGAGCGGCGG + Intronic
1113935977 13:113995755-113995777 ACGGGGGCCCGGCTGACGGGGGG + Intronic
1113936105 13:113996032-113996054 GGGGGGGCCCGGCTGATGGGGGG + Intronic
1113936114 13:113996049-113996071 GGGGGGGCCCGGCTGATGGGGGG + Intronic
1116656995 14:47665807-47665829 GCGGGGGCGGGGGGGAGGGGGGG - Intronic
1119183573 14:72620531-72620553 GCTGGAGCCCGGGTGAGAGCAGG + Intronic
1119468169 14:74876058-74876080 GCCCGTGGCTGGGTGAGGGGAGG + Intergenic
1121439460 14:93939686-93939708 GGGCGGGCGCGGGTGAGGGGAGG + Intronic
1121828929 14:97033419-97033441 GCGGGAGCCGGGGCGAGGGAAGG - Intergenic
1121926302 14:97930340-97930362 GCTGGTGCCCTGGAGAGGAGAGG - Intronic
1122288836 14:100668654-100668676 CTGGGTGCCTGGGTGCGGGGCGG - Intergenic
1122716918 14:103701396-103701418 GCTGGTGCCCTGGTGCGGCGTGG + Intronic
1122840786 14:104461639-104461661 GGGGGTGGGCGGGGGAGGGGCGG + Intergenic
1123034562 14:105466632-105466654 GCGGGTGCCCGGGCGGGGACGGG - Intronic
1124031394 15:26015670-26015692 GCAGGTGCCCTGTTGAGGTGCGG - Intergenic
1127560235 15:60128982-60129004 GGGGGTGCCCAGGATAGGGGAGG + Intergenic
1127674836 15:61228997-61229019 GCGGGAGCCCGGGCGCGGAGCGG - Intronic
1129376585 15:75137558-75137580 GCAGGTGCTGGGGAGAGGGGAGG + Intergenic
1129488859 15:75904092-75904114 GCGGGTGGCCTGGTGAGGAGAGG + Exonic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1130010862 15:80152542-80152564 TCGGGTACCCGGGCCAGGGGAGG + Intronic
1131441875 15:92465671-92465693 GCGGGTACCTGGGGGTGGGGTGG - Exonic
1132348318 15:101121763-101121785 GCTGGCGCCCTCGTGAGGGGAGG - Intergenic
1132517909 16:374454-374476 GCAGGGTCCTGGGTGAGGGGTGG - Intronic
1132590853 16:725883-725905 GTGGGTGGCCAGGTGAGAGGTGG + Intronic
1132889288 16:2196221-2196243 TCGGGTCCCCGGGGGCGGGGCGG - Intronic
1133051324 16:3119004-3119026 GCGCGTGCACAGGTGAGGGACGG + Exonic
1133069390 16:3235565-3235587 GGGGGTGGCGGGGTGGGGGGTGG - Intronic
1133069436 16:3235652-3235674 GGGGGTGGCGGGGTGGGGGGTGG - Intronic
1133784239 16:8963018-8963040 CCGGGTCCGCGGGCGAGGGGCGG - Intronic
1133950511 16:10387827-10387849 CCGGGTGGCGGGGGGAGGGGGGG - Intronic
1134214434 16:12306050-12306072 GCAGGTGCCTGGCTGAGGGAGGG - Intronic
1136315966 16:29454919-29454941 GCGAGGGCCCTGGTGAGAGGGGG + Exonic
1136430543 16:30194261-30194283 GCGAGGGCCCTGGTGAGAGGGGG + Exonic
1136544685 16:30948576-30948598 GGAGGTGCGCGGGTGGGGGGAGG + Exonic
1136655287 16:31705819-31705841 GAGGGTCCCCGGGTGGGTGGAGG + Intergenic
1137037012 16:35576159-35576181 GCAGGGGCACGGGTGTGGGGGGG + Intergenic
1138229401 16:55326275-55326297 GCGGGGGCGGGGGTGGGGGGGGG + Intronic
1138467192 16:57200938-57200960 GCGGCTGGCCGGGGGGGGGGGGG + Intronic
1139365190 16:66428284-66428306 GCGGGTGCCGGCGTGGGTGGCGG + Intronic
1140482014 16:75266943-75266965 GTGGGTGCCCATGTGGGGGGCGG + Intronic
1141135989 16:81465857-81465879 TCAGGTGCCCGGCTGAGGGCTGG + Intronic
1141377833 16:83548163-83548185 GGGGGTGCCAGGGTGGGGAGAGG + Intronic
1141727717 16:85800346-85800368 AGGAGGGCCCGGGTGAGGGGGGG + Intronic
1142213388 16:88819184-88819206 GCAGGTGGCCGGGGGTGGGGAGG - Intronic
1142403608 16:89873869-89873891 GCGGCGGCCCGGGTGGGGGTGGG + Intronic
1142817851 17:2441299-2441321 GTGGGAGACCGGGTGACGGGAGG + Intronic
1143183528 17:4998020-4998042 CCGGGTGCCCGGGCGGCGGGCGG - Exonic
1143400557 17:6639893-6639915 GTGGGTGACCGGGTCTGGGGAGG - Intronic
1144656822 17:17042410-17042432 GCGGGCGGCCGGGCGCGGGGAGG - Intergenic
1145034699 17:19533095-19533117 GCTGGTGCCAGGCTGAGGGCAGG + Intronic
1145862985 17:28224288-28224310 GCGGCTGGCCGGGCGGGGGGCGG - Intergenic
1145933893 17:28704044-28704066 GCTGGTGCCTAGGTCAGGGGAGG + Exonic
1145987605 17:29057643-29057665 GTGGGTGGAGGGGTGAGGGGTGG + Intergenic
1145996674 17:29108823-29108845 GCTGGGGGCCGGGTGAGGGAAGG + Intronic
1146445371 17:32928310-32928332 CCGGCTGCCGGGGAGAGGGGAGG + Intronic
1146667449 17:34714658-34714680 GCAGGTGCCGGGGTGGGGGCAGG - Intergenic
1146922372 17:36722391-36722413 GGGGGTGCGCGGGTGGGGCGGGG - Intergenic
1147257707 17:39191937-39191959 GCGGGTGCTGGGGGCAGGGGAGG - Intronic
1147440332 17:40443661-40443683 GCGGGCGCGCGGGCGAGCGGCGG - Exonic
1147793086 17:43025297-43025319 GGCGGGGCCCGGGAGAGGGGTGG + Exonic
1148759375 17:49991540-49991562 GCGGGGGCCCGGGAGAGGCATGG + Exonic
1150002669 17:61451671-61451693 CCCGGTGGCCGGGTGCGGGGCGG - Intergenic
1150326662 17:64263273-64263295 GCGTGTGCCCGGGGGCGGGCGGG - Intronic
1150662543 17:67096137-67096159 GCTGGTGGGCGGGGGAGGGGGGG - Intronic
1151175203 17:72282422-72282444 GAGGGTGTGCGGGTGAAGGGTGG - Intergenic
1151197685 17:72443511-72443533 GCTGTTGCCTGGGTGAGAGGTGG - Intergenic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1151388487 17:73770109-73770131 GCGTGTGCTGGGGAGAGGGGAGG - Intergenic
1151660345 17:75515395-75515417 GCGGGCGGCCGGGAGAGGTGAGG - Exonic
1152095102 17:78268111-78268133 GGAGGTGCCCAGGTGGGGGGCGG + Intergenic
1152175182 17:78782394-78782416 GCGGGGCCTCGGGCGAGGGGCGG - Intergenic
1152361562 17:79835404-79835426 ACGGGTGCAGGGGTGAGAGGAGG + Intronic
1152377738 17:79927459-79927481 GCGGGCTCCCGGGTGGGGGCGGG + Intergenic
1152468335 17:80477640-80477662 GCGAGTGCGCGGGTGCCGGGTGG - Intronic
1152729230 17:81961538-81961560 GCGCCTGCCGGGGTGGGGGGCGG + Intronic
1152861148 17:82697800-82697822 GCGGGTTCCAGGGCGAGGGGAGG - Intronic
1153854959 18:9136687-9136709 GCGGGCGCCGGGGGGCGGGGCGG + Intronic
1154341460 18:13505920-13505942 GCGGGTGACAGGATGAGAGGAGG - Intronic
1154485885 18:14871082-14871104 GAGGGTGTGCGGGTGAGGGTGGG - Intergenic
1155057840 18:22200656-22200678 GCGGGTGCCCCGGTGATGACTGG + Exonic
1156275705 18:35581448-35581470 GCGGCTGCGCGGGGGAGGCGGGG - Intronic
1156468024 18:37360340-37360362 GTGGGTGCCAGTGTCAGGGGAGG - Intronic
1156602532 18:38626205-38626227 GCGTGGGCCCTGGTGAGGGTTGG + Intergenic
1157464257 18:47930675-47930697 GCGGGCGCGCGCCTGAGGGGAGG - Intronic
1157833660 18:50879335-50879357 GCGGGGGTCCGGGAGAGGAGCGG + Intronic
1158321329 18:56267571-56267593 GCAGGTGGCTGGGTGACGGGAGG + Intergenic
1160150208 18:76392582-76392604 GCAGGTGGCCGGGTGGGGGAAGG + Intronic
1160150550 18:76393474-76393496 GCGGGTGGTCAGGTGGGGGGAGG + Intronic
1160150598 18:76393589-76393611 GCGGGTGGTCAGGTGGGGGGAGG + Intronic
1160150701 18:76393842-76393864 GCGGGTGGTCAGGTGGGGGGAGG + Intronic
1160150810 18:76394120-76394142 GCGGGTGGTCAGGTGGGGGGAGG + Intronic
1160150839 18:76394189-76394211 GCGGGTGGTCAGGTGGGGGGAGG + Intronic
1160150960 18:76394498-76394520 GCGGGTGGTCAGGTGGGGGGAGG + Intronic
1160151054 18:76394728-76394750 GCGGGTGGTCAGGTGGGGGGAGG + Intronic
1160151093 18:76394820-76394842 GCGGGTGGTCAGGTGGGGGGAGG + Intronic
1160187796 18:76688892-76688914 GCAGGTGGACGGGTGCGGGGAGG - Intergenic
1160668424 19:344492-344514 GCGGGGGCCGGGGTGGGGGAGGG - Intronic
1160698763 19:496668-496690 GAGGGGGCCCAGGAGAGGGGAGG + Intronic
1160698846 19:496908-496930 GAGGGGGCGCGGGAGAGGGGAGG + Intronic
1160698950 19:497234-497256 GAGGGGGCGCGGGAGAGGGGAGG + Intronic
1160698974 19:497290-497312 GAGGGGGCTCGGGAGAGGGGAGG + Intronic
1160698989 19:497327-497349 AGGGGGGCCCGGGAGAGGGGAGG + Intronic
1160725023 19:614043-614065 GCGGGTGCCCTGGCGGGGGAGGG + Intronic
1160826226 19:1081799-1081821 GCGGGAGCCCGGGGGTGGGGAGG - Intronic
1160835430 19:1122611-1122633 GCGGGAGCGGGGGTGGGGGGCGG - Intronic
1160990821 19:1859695-1859717 GCGGGGGGCGGGGTGGGGGGTGG - Intronic
1161029425 19:2050911-2050933 GCGGGCGGCCGGGCGGGGGGCGG + Exonic
1161063595 19:2227149-2227171 GCGGGGGCCGGGGCGGGGGGCGG - Intronic
1161091020 19:2360149-2360171 GCAGGGGGCCGGGGGAGGGGCGG + Intergenic
1161203707 19:3029386-3029408 GCGGGTGCCCGGGGGCCGGGGGG - Intronic
1161241143 19:3224640-3224662 GCGGGGGCCCGGGAGGGAGGCGG + Intergenic
1161467975 19:4442701-4442723 GAGTGTGCCCGGGTGGTGGGGGG + Intronic
1161596399 19:5153177-5153199 GCGGTTGCCCTGGAGAGGGCCGG + Exonic
1161959589 19:7516282-7516304 GCGGGGGGCTGGGTGGGGGGCGG + Intronic
1161983981 19:7644090-7644112 GCTGGGACCTGGGTGAGGGGTGG + Intronic
1161984049 19:7644294-7644316 GCTGGGACCTGGGTGAGGGGTGG + Intronic
1161984060 19:7644328-7644350 GCTGGGACCTGGGTGAGGGGTGG + Intronic
1162031553 19:7919672-7919694 GCAGGTGTCCGGGTAAGGAGAGG - Intergenic
1162044016 19:7987108-7987130 GGGGGTGCCGGGGGGGGGGGAGG + Intronic
1162050416 19:8029193-8029215 GCGGGAGACAGGGTGGGGGGCGG + Intronic
1162324870 19:9993122-9993144 GGGGCTGCCCAGATGAGGGGAGG - Intronic
1162526623 19:11210151-11210173 GAGGGTGGGCAGGTGAGGGGTGG - Intronic
1162924770 19:13924837-13924859 GGGGGAGCCAGGGTAAGGGGTGG - Intronic
1163154703 19:15433351-15433373 GCGGGTGCCAGGTTGGGGGCGGG - Intronic
1163502566 19:17685808-17685830 GTGGGTCCCCGGTGGAGGGGAGG + Intronic
1164109111 19:22138024-22138046 GCGGGTGCGAGGGTGAGGGCGGG - Intergenic
1164594969 19:29526538-29526560 GCGGGGGCCCGGGAGCGGAGAGG - Exonic
1164651471 19:29893709-29893731 GCGGGTCCCAGGGTCAGGGCAGG + Intergenic
1165255896 19:34577118-34577140 GCAGCTGCCCGTGTGAGAGGTGG + Intergenic
1166078229 19:40426149-40426171 GCAGCTGCGCGAGTGAGGGGTGG + Intergenic
1166640988 19:44495271-44495293 GAGGGTGGCCGAGTGTGGGGTGG - Intronic
1166788809 19:45385505-45385527 GCGGGTGCGCAGGAGCGGGGAGG - Intronic
1166790361 19:45395582-45395604 GGGGGTGCTCGGGTGAAGAGGGG + Exonic
1166798946 19:45444265-45444287 GCGGCTGGCTGGGGGAGGGGGGG - Intronic
1167300463 19:48674623-48674645 GCGGGTGCCCGGGGGCAGGCGGG + Intergenic
1167502634 19:49856375-49856397 GGGGGTGGCCCGGTGTGGGGAGG + Intronic
1168100862 19:54140245-54140267 GCGGGTGGCGGGGTGGGGGGAGG - Intronic
1168269494 19:55241840-55241862 GTGAGAGCACGGGTGAGGGGTGG + Intronic
1168333900 19:55586048-55586070 GAGGCTGCACGGGAGAGGGGGGG - Intergenic
1168375891 19:55878953-55878975 GCAGGTGCTCGGGTGAGCTGGGG + Exonic
1168458938 19:56538414-56538436 GCGGCAGACCGGGTGAGGCGGGG - Intergenic
1168714615 19:58519589-58519611 GCGGGGGCCAGAGTGCGGGGTGG - Intronic
925380685 2:3423510-3423532 GCGGGTGCCGGGGCTGGGGGTGG - Intronic
925594307 2:5539925-5539947 CCGGGGGCCAGGGTCAGGGGAGG + Intergenic
925610545 2:5697441-5697463 TCGGGGGGCCGGGGGAGGGGTGG - Exonic
925643185 2:6006911-6006933 GAGGGTGCAGGGGTGGGGGGGGG - Intergenic
925713786 2:6767033-6767055 GCGGGTGGCGGGGCTAGGGGAGG - Intergenic
925912648 2:8583546-8583568 GGGGGTGCCCGGGGTTGGGGCGG - Intergenic
925927119 2:8678662-8678684 GGGGGTGGGCGGGTGAGGGGCGG - Intergenic
926735535 2:16070718-16070740 GGGGGTGCCTGGGAGAGGTGGGG - Intergenic
927703086 2:25280326-25280348 GTGGCTGCCGGGGTGGGGGGTGG - Intronic
927713952 2:25341205-25341227 CCGGGCGCCGGGGGGAGGGGCGG + Intronic
927713985 2:25341302-25341324 GCGGCGGCCCGGGGGAGCGGGGG - Intronic
929579790 2:43074568-43074590 GCAGGAGCATGGGTGAGGGGAGG + Intergenic
929923361 2:46189399-46189421 GCGGTTGCCAGGGTCTGGGGTGG + Intergenic
932231529 2:70087665-70087687 GCGGCTGGCGGGGGGAGGGGAGG - Exonic
933858548 2:86441827-86441849 GCTGGGGCCCGGGTGTGTGGCGG + Intronic
933893201 2:86789608-86789630 GCGGGGGCCCGGGGCGGGGGCGG - Intronic
934728114 2:96638156-96638178 GCGGGGGCCCGGGCTAGGGCCGG - Intronic
934750092 2:96788596-96788618 GCGGGAGCTTGGGTGAAGGGAGG + Intronic
935592473 2:104855363-104855385 GCGGGGGCCCGGGGCGGGGGCGG + Intergenic
937065704 2:119015530-119015552 GCGGGAGGCGGGGTGTGGGGAGG - Intergenic
937854638 2:126663501-126663523 GCTGGTGCCCCGATGAGGTGGGG - Intronic
938639890 2:133266951-133266973 GGGGGGGCCCGGCGGAGGGGAGG - Intronic
942150922 2:173075689-173075711 GCGGGTGCCGGGGCGCGGGGCGG + Intronic
942222114 2:173780506-173780528 TGGGCTGCCCGGGGGAGGGGTGG + Intergenic
942241025 2:173964394-173964416 GCGGCGGCCCAGGTGAGGAGCGG - Exonic
943005822 2:182386760-182386782 GCGGCTGGCCGGGTGGGGGCTGG - Intronic
946173324 2:217908205-217908227 GAGGGTGCCAGAGTGAGGGATGG - Intronic
946321285 2:218955891-218955913 GGGGGTGCCAGGGTGGGGGGGGG + Intergenic
947444884 2:230156133-230156155 GGGGGTGCGGGGGTGGGGGGCGG + Intergenic
948046995 2:234952323-234952345 GCGGGTGCCTGGGCGTGGGGCGG + Intronic
948121618 2:235535161-235535183 GCGGGTGGCCCGGTGGAGGGAGG - Intronic
948505941 2:238427028-238427050 GGGCGTGCGCGGGTCAGGGGCGG + Exonic
948552860 2:238786272-238786294 GCGGGTGCCAGGGCTGGGGGAGG - Intergenic
948564599 2:238875962-238875984 GCAGGTGCCAGGGTGCAGGGAGG + Intronic
948642255 2:239383200-239383222 GCTGGAGCCAGGGTCAGGGGTGG - Intronic
948794253 2:240394085-240394107 GTGGGTGGCAGGGTGAAGGGAGG - Intergenic
1168956599 20:1838648-1838670 GGGGCTGCCCAGCTGAGGGGGGG - Intergenic
1169065519 20:2692708-2692730 ACGGGGGCCCGGGGGAGGCGGGG - Intergenic
1169129466 20:3157993-3158015 GAGGTTGCCGGGGTGAGAGGTGG - Intronic
1171427597 20:25058262-25058284 TCTGCTGCCCGGGAGAGGGGGGG + Intronic
1172042071 20:32052662-32052684 GAGGGTGCCCTAGGGAGGGGCGG + Intronic
1172057403 20:32164190-32164212 GCTGGTGGTCGGGGGAGGGGTGG - Intronic
1172974155 20:38894107-38894129 GGGGGTGCGGGGGTGCGGGGGGG - Intronic
1173120790 20:40287254-40287276 GCCGGCGCCCGGGTCAGAGGGGG - Intergenic
1173412317 20:42823387-42823409 AGGGGTGGCAGGGTGAGGGGAGG + Intronic
1174085657 20:48005706-48005728 GGGAGTGCCGGGGTGAGTGGTGG + Intergenic
1175481207 20:59312485-59312507 GCAGGTGCCTGTGTTAGGGGAGG + Intronic
1175881495 20:62262085-62262107 GAGGGTGACGGGGTGGGGGGGGG - Intronic
1176127895 20:63484137-63484159 GCGGTGGCCGGGGTGAGGGCAGG - Intergenic
1176135486 20:63520475-63520497 GCCTGGGCCCGGGAGAGGGGCGG + Intergenic
1176138589 20:63535767-63535789 GCGGGAGGCCAGGTGAGGGGGGG - Intronic
1176138601 20:63535790-63535812 GCGGGAGGCCAGGTGAGGAGGGG - Intronic
1176138611 20:63535813-63535835 GCGGGAGGCCAGGTGAGGAGGGG - Intronic
1176138622 20:63535837-63535859 GCGGGAGGCCAGGTGAGGGGGGG - Intronic
1176138634 20:63535860-63535882 GCGGGAGGCCAGGTGAGGAGGGG - Intronic
1176138644 20:63535883-63535905 GCGGGAGGCCAGGTGAGGAGGGG - Intronic
1176138654 20:63535906-63535928 GTGGGAGGCCAGGTGAGGGGGGG - Intronic
1176138685 20:63535975-63535997 GCGGGAGGCCAGGTGAGGGGGGG - Intronic
1176138697 20:63535998-63536020 GCGGGAGGCCAGGTGAGGAGGGG - Intronic
1176138746 20:63536110-63536132 GCTGGAGGCCAGGTGAGGGGGGG - Intronic
1176795455 21:13368408-13368430 GAGGGTGTGCGGGTGAGGGTGGG + Intergenic
1179213802 21:39349266-39349288 GGGGGCGCCCGGGGGGGGGGGGG - Intronic
1179339015 21:40486861-40486883 GCGGAGGCCAGGGTGAGGGCAGG - Intronic
1179524355 21:41966029-41966051 GCGATTGTCCGGGTGAGGAGGGG + Intergenic
1179785816 21:43729062-43729084 GCGGGCGGGCGGGTGCGGGGTGG - Intronic
1179786507 21:43733400-43733422 GCTGGTGCACGGGAGAGGGTGGG + Intronic
1179879414 21:44287201-44287223 GTGGGAGCCCGGGTGGGGAGGGG - Intronic
1180019707 21:45114463-45114485 GTGGATGCCAGGGTCAGGGGAGG + Intronic
1180049318 21:45324143-45324165 GTGGGTGCCGGGGGGTGGGGAGG - Intergenic
1180091860 21:45537547-45537569 GTGGGTGCCGGGGTGCCGGGCGG - Intronic
1180091921 21:45537744-45537766 GTGGGTGCCGGGGTGCCGGGCGG - Intronic
1180093066 21:45542458-45542480 GCGGGCGCGCGGCTGCGGGGTGG + Exonic
1180101745 21:45590775-45590797 GCAGGAGCCTGGGAGAGGGGCGG - Intergenic
1181491380 22:23262707-23262729 GGGCGGGCCCGGGTGAGGGCGGG + Intronic
1181512218 22:23394123-23394145 GTGGGTGCCAGGCTGGGGGGTGG + Intergenic
1182321549 22:29481150-29481172 GCAGGCGCGCGGGTGGGGGGAGG + Intronic
1183108468 22:35630914-35630936 CCGGGTGCTCCGCTGAGGGGAGG + Intronic
1183414660 22:37675440-37675462 GGGGGCGGCGGGGTGAGGGGGGG + Intergenic
1183444414 22:37843855-37843877 GGGGCAGCCCGGGCGAGGGGCGG - Intronic
1183535734 22:38399256-38399278 AGGTGTGCCCGGGCGAGGGGAGG + Intergenic
1184060779 22:42079736-42079758 GCGGGTGCCCGGGTGAGGGGCGG + Exonic
1184089183 22:42283516-42283538 GAGGGTGGCCGGGAGAGGAGGGG - Intronic
1184523197 22:45007718-45007740 GCGGGTGTGCGAGTGCGGGGAGG + Intronic
1184769889 22:46590666-46590688 GGGCGTGCTTGGGTGAGGGGAGG + Intronic
1184809171 22:46817400-46817422 GTTGGTGGGCGGGTGAGGGGAGG - Intronic
1185188549 22:49418059-49418081 GCGGGTGCACGTGTGGGGTGTGG - Intronic
1185292210 22:50032791-50032813 GCGGGGACCCGGGTGAGGTGGGG + Intronic
1185339031 22:50283486-50283508 GAGGGTGTCAGGGTGTGGGGTGG - Intronic
1185377082 22:50487585-50487607 GGGGCTGCCTGGGAGAGGGGAGG + Intronic
1185409361 22:50674243-50674265 GCGGGGTCCCGGGTGGGGGCGGG - Intergenic
949559233 3:5187488-5187510 GGCGGGGCCCGGGTGAGGGGCGG + Intergenic
949648772 3:6130384-6130406 GCGGTTGCTGGGGTCAGGGGTGG - Intergenic
950520159 3:13493321-13493343 GCGGGTCCCTGGGTGAGGGGAGG - Intronic
951543857 3:23806694-23806716 GCGGGTGCCCGGGTGGGGGAAGG - Intronic
953436419 3:42881056-42881078 GCGGGCGCTCGGGAAAGGGGCGG + Intronic
953865130 3:46577121-46577143 CCAGGTGCCCGGGAGAGGGGAGG - Intronic
953906332 3:46870172-46870194 CTGGGAGCCGGGGTGAGGGGTGG - Intronic
954478460 3:50772304-50772326 GTGGGTGGCTGGGTGAGGGGAGG + Intronic
957865013 3:86012431-86012453 GCCGGCGCGCGGGCGAGGGGCGG - Intronic
959256831 3:104025779-104025801 GCGGGGGCGCGGGTGGTGGGGGG + Intergenic
959581161 3:107983891-107983913 GCCGGAGGCTGGGTGAGGGGAGG + Intergenic
961158366 3:124700344-124700366 AGGGGTGCCCGGGTGGGAGGAGG - Intronic
961384422 3:126516067-126516089 GTGGGTGCTGGGGTGAGGAGGGG - Intronic
961384457 3:126516161-126516183 GTGGGTGCTGGGGTGAGGAGGGG - Intronic
961427311 3:126858300-126858322 GCGGGGGCGGGGGGGAGGGGTGG + Intronic
961658675 3:128457024-128457046 CGAGGTGCCCAGGTGAGGGGTGG - Intergenic
962245279 3:133785634-133785656 GCGGCTGGCCGGGCGGGGGGGGG - Intronic
963827359 3:149970436-149970458 CCAGGTGCCCGGGTTGGGGGAGG - Intronic
964312028 3:155404168-155404190 GCTGTTGCCCTGGTGAGGAGTGG - Intronic
966319385 3:178684323-178684345 GTGGTTGCCAGGGTGGGGGGTGG + Intronic
966684889 3:182682926-182682948 CCGTGGGCCCGGGCGAGGGGCGG + Intergenic
966886559 3:184380471-184380493 GTGGGCGCCCGGGGGAGGCGCGG + Intronic
968130943 3:196192506-196192528 GTGGGTGCCCAGGTGGGAGGCGG + Intergenic
968133669 3:196207580-196207602 GCGGGCGTCCGGGGGCGGGGCGG - Intronic
968133716 3:196207677-196207699 GCGGGCGTCCGGGGGCGGGGCGG - Intronic
968473509 4:792334-792356 GGGGCTGCCCGGAAGAGGGGCGG - Intronic
968593737 4:1472223-1472245 GCCGGAGCCCGGGTGAGTGTCGG + Intergenic
968647935 4:1749298-1749320 GGGGGTGCCTTGGGGAGGGGGGG - Intergenic
968671843 4:1856199-1856221 GCCGCTGGCCAGGTGAGGGGCGG + Exonic
968864665 4:3200515-3200537 GCGGGGGCCAGGGTTGGGGGTGG - Intronic
968883772 4:3316240-3316262 GAGGTTGCCCGGGGGAGGGCCGG + Exonic
968965199 4:3766097-3766119 GCGGGGGCCCGGAGGAGCGGCGG + Intergenic
968986909 4:3880563-3880585 GCGTGTGGCCGGGGGAGGGACGG - Intergenic
969462431 4:7335852-7335874 GCGGGTGCGGGGGTGAGGCCTGG + Intronic
969663146 4:8542121-8542143 GAGGGTGGCCGGGAGAGGTGCGG + Intergenic
970626308 4:17887908-17887930 GGGGTTGCCGGGGTGAGGCGGGG - Intronic
971405633 4:26319494-26319516 GCGCGTGCCCGGGAGGCGGGCGG - Intronic
973650444 4:52992776-52992798 GCGGCTGCCTGGCGGAGGGGGGG - Intronic
973867208 4:55125692-55125714 CCGGGTACCCGGGTGAGGGGCGG - Intergenic
975702027 4:77075791-77075813 GCGGGGGCCGGGGAGAGGCGGGG + Exonic
978285615 4:107073477-107073499 GCGCGGGCCAGGGTGGGGGGAGG - Intronic
979224225 4:118265834-118265856 GCAGGAGCCCAGGTGGGGGGAGG - Intergenic
982784432 4:159523813-159523835 GCGGCTGGCCGGGGGGGGGGCGG - Intergenic
984784276 4:183553757-183553779 GTGGGTGACTGGGTGAGGGTGGG + Intergenic
985551401 5:535233-535255 GCGGGGGCAAGGGTGAGGTGAGG - Intergenic
985574165 5:665886-665908 GGTGGTGCCTGGGGGAGGGGTGG - Intronic
985794499 5:1952242-1952264 GAGGGTCCCTGGCTGAGGGGCGG + Intergenic
989655796 5:43745895-43745917 GCGGCTGGCCGGGTGGGGGCTGG + Intergenic
992023676 5:72650281-72650303 GGGGGTGAGGGGGTGAGGGGAGG - Intergenic
992766005 5:80000808-80000830 GTGTGTGCACTGGTGAGGGGAGG + Intronic
994171253 5:96662154-96662176 GCGGGTCACCGGGTGAGGACCGG + Intronic
997635098 5:135398981-135399003 GCGGGTGCCCGGGAGCGGCCCGG - Intronic
997654616 5:135545756-135545778 GAGGGGGCCAGGGTGAGGAGAGG + Intergenic
997732827 5:136193188-136193210 GCGGGGGTTCGGGGGAGGGGCGG + Intergenic
998836085 5:146203876-146203898 GCGGGGGCGTGGGGGAGGGGAGG + Intronic
998957634 5:147453727-147453749 GCGGGAGCCCGGGAGGGGGGCGG - Intronic
999230226 5:150057426-150057448 GGGGCTGCTGGGGTGAGGGGTGG - Intronic
999298088 5:150472964-150472986 ACAGGTGCTGGGGTGAGGGGGGG + Intergenic
999327384 5:150651529-150651551 GAGGGTGACCTGGTGAGGGAAGG + Exonic
1001810872 5:174627281-174627303 GCTGGTGTTGGGGTGAGGGGCGG - Intergenic
1002102678 5:176865135-176865157 GCTGGGCCCCGGGTGTGGGGTGG - Intronic
1002131818 5:177086789-177086811 GGGCGGGCCCGGGTGGGGGGGGG + Intergenic
1002195418 5:177498312-177498334 GCGGGTGTCGGGGTGAGGGAAGG + Intergenic
1002201553 5:177531514-177531536 GCGGGTGGCTGGGGGTGGGGGGG + Intronic
1002428861 5:179191626-179191648 GCAGCTGCCGGGGTGGGGGGCGG + Intronic
1002833285 6:843659-843681 GCGTGTGCCTGGGTGGGTGGGGG + Intergenic
1003107934 6:3229444-3229466 CGGCGTGCCCGGGTGAGGGTGGG + Intronic
1003283301 6:4712528-4712550 GCTTGTGCCCGGGTGGGAGGTGG - Intronic
1004289684 6:14355068-14355090 GGGTGTGGCTGGGTGAGGGGTGG - Intergenic
1006472792 6:34237703-34237725 GCCCGGGCCCGGGTGAGGGGCGG + Intronic
1007278104 6:40690381-40690403 GAGGGTGCCCGGTGGAGGGTGGG + Intergenic
1007390417 6:41547097-41547119 GCTGGGGCCCGGGCCAGGGGCGG - Intronic
1007829390 6:44626997-44627019 GCGGGTGCTCAGGGGAGGAGAGG + Intergenic
1010781270 6:79947797-79947819 GCCGATGCCCGGGACAGGGGCGG - Intergenic
1013273152 6:108560770-108560792 AGGGGCGCCCGGGGGAGGGGCGG - Intronic
1013596078 6:111662263-111662285 GTGGCTGCCTGGGGGAGGGGAGG + Intronic
1015828602 6:137343059-137343081 GCGGGTGAGGGGCTGAGGGGAGG + Intergenic
1016614251 6:146028509-146028531 GTGGGTGGACGGGTTAGGGGGGG - Intronic
1018062637 6:160102676-160102698 GCGGGTGGCAGGGCGAGGTGGGG + Intronic
1019255188 7:45262-45284 GCGGGTGAGTGGGTGAGGGATGG - Intergenic
1019292244 7:256484-256506 GCGGGAGCACGGGTGTGGGAGGG - Intronic
1019391149 7:787387-787409 GGGGGTGTCTGGGTTAGGGGAGG + Intergenic
1019395728 7:816738-816760 GCGGGGGCCCGGGGGCCGGGGGG + Intronic
1019483130 7:1275345-1275367 AGGGGTGTCCGGGGGAGGGGGGG - Intergenic
1019518596 7:1450539-1450561 GCAGGAGCACTGGTGAGGGGCGG - Intronic
1019592490 7:1842715-1842737 GCAGGGGCCCAGGTGAGGAGTGG - Intronic
1019707355 7:2502911-2502933 GCGGGACCCCGGGAGATGGGGGG + Intergenic
1019736056 7:2650196-2650218 GCGGGTGCCCGCGTGGCAGGGGG + Intronic
1019953574 7:4393051-4393073 GCGGGTGCCAGGGGCTGGGGAGG + Intergenic
1019984088 7:4642325-4642347 TCGGGTGCGCGAGTGACGGGTGG + Intergenic
1020022364 7:4876796-4876818 GTGGGTGCCTGGGTGGTGGGAGG - Intronic
1020080368 7:5283205-5283227 TCGGGTTCCCGGGACAGGGGCGG - Intronic
1023863631 7:44228838-44228860 GCGGGGGCCCCGCTGAGAGGGGG + Exonic
1023879598 7:44310771-44310793 GTGGGTGCCAGGGTGAGGGAAGG + Intronic
1023951204 7:44847774-44847796 ACGGGTCCCCGGGTGAGAGCTGG - Intronic
1025198547 7:56948974-56948996 TCGGGTTCCCGGGACAGGGGCGG + Intergenic
1025673404 7:63627959-63627981 TCGGGTTCCCGGGACAGGGGCGG - Intergenic
1026992592 7:74595707-74595729 GCAGGTGCCCTGCAGAGGGGAGG + Intronic
1027001428 7:74657388-74657410 GCGGCCGCCCGGGTGGGGGAGGG - Intergenic
1027176338 7:75906216-75906238 GAGGGTGTTCGGGTGAGAGGGGG - Intronic
1027548634 7:79562585-79562607 GCGGGTGGATGGGTGAGGGGAGG - Intergenic
1028621581 7:92833997-92834019 CCGGGAGCGCGGGGGAGGGGAGG + Intronic
1028954522 7:96673996-96674018 GCGGGAGTCAGGGAGAGGGGAGG - Intronic
1029298323 7:99558907-99558929 GCGGAGGCCCGGGTGCGAGGAGG + Exonic
1029535467 7:101154924-101154946 GCGGGGACCCGGGTGGGGAGAGG + Intronic
1029597821 7:101547022-101547044 GCGGGCCCCAGGGTGATGGGAGG + Intronic
1029737636 7:102473511-102473533 GTCGGTGTCAGGGTGAGGGGTGG + Exonic
1031008543 7:116500069-116500091 GCGGGCGGCCTGGTGACGGGTGG - Intronic
1031052802 7:116961926-116961948 GGGGGTGGGGGGGTGAGGGGAGG - Intronic
1032420689 7:131776629-131776651 GGGGGTGCTGGGGTGGGGGGAGG + Intergenic
1032945010 7:136840323-136840345 GCGGGTGACAGGGTGAGGGGAGG + Intergenic
1033165612 7:139036143-139036165 GCGGGAGGCCGGGCGAGGGGCGG + Intergenic
1034349607 7:150407547-150407569 GCGGGGGCGGGGGTGGGGGGTGG - Intronic
1035022657 7:155808522-155808544 GTGGCTGCGCGAGTGAGGGGCGG + Intronic
1035632351 8:1117666-1117688 GTGGTTGCCGGAGTGAGGGGAGG + Intergenic
1035717269 8:1763895-1763917 CAGGGAGCCCGGGTGAGGGCCGG + Intronic
1037826783 8:22164797-22164819 GCGGGGGCGCGGGGCAGGGGCGG + Exonic
1037886820 8:22599815-22599837 GAGGGTGCCCGGCTTGGGGGCGG - Intronic
1038540175 8:28385400-28385422 GCGGGTGCCCGGGGGGGGGGCGG - Intronic
1040032962 8:42842921-42842943 GCGCGTGTCCGCGCGAGGGGCGG - Intronic
1041310339 8:56510183-56510205 GGGGGTGCCCAGGTGAGGTGAGG - Intergenic
1042787610 8:72566907-72566929 GAGGGTGACCGGGTATGGGGTGG + Intronic
1045032751 8:98153315-98153337 GGGGGTACCCAGGAGAGGGGAGG + Intronic
1049389480 8:142360606-142360628 GCGGGGGCCCTGGGGAGGGCCGG - Intronic
1049396350 8:142402953-142402975 GCGGGAGGCCGGGCGGGGGGCGG - Intronic
1049452617 8:142670150-142670172 GGGGGTCCCAGGGTGGGGGGAGG + Intronic
1049580698 8:143409221-143409243 GTGGGGGCCAGGGTGAGGGGTGG + Intergenic
1049797564 8:144503660-144503682 GGGGGTGCTGGGGGGAGGGGAGG - Intronic
1050588928 9:7142442-7142464 GAGGGAGCCCAGGGGAGGGGAGG - Intergenic
1051401718 9:16690850-16690872 GGGGATGCCAGGGTGCGGGGTGG + Intronic
1051896468 9:21994457-21994479 GCGGGTGCGCGCCTGCGGGGCGG - Intronic
1052517029 9:29495060-29495082 GCGGGTGCACACATGAGGGGAGG + Intergenic
1052851632 9:33381708-33381730 GGGGGCGCCAGGGGGAGGGGAGG - Intergenic
1053157525 9:35791483-35791505 CCGAGCGCCCGGGTGGGGGGTGG + Intergenic
1055490241 9:76797667-76797689 GCGGGGGGCAGGGTGGGGGGCGG - Intronic
1055501435 9:76906158-76906180 GCCGGCGGCCGGGCGAGGGGTGG - Intergenic
1056259534 9:84833937-84833959 GAGGATGCCCGGGTGAGGATGGG + Intronic
1056753543 9:89368354-89368376 GCAGGTGTCCGGGTGAGGCCCGG - Intronic
1056787995 9:89606164-89606186 GAGGGTGCCCGAGTGCGGCGTGG + Exonic
1057045971 9:91886540-91886562 GCGGGTCCCCTCGTGAGGGCAGG - Intronic
1057186158 9:93058650-93058672 GCCTGGGCCTGGGTGAGGGGCGG - Intergenic
1060404414 9:123366145-123366167 CCGGGTGCCCGAGGGCGGGGAGG + Intronic
1060734634 9:126059196-126059218 GCGTGTGCCCGGGAAAGGGATGG - Intergenic
1060770265 9:126327083-126327105 GCGGGCCCCCGGCCGAGGGGCGG + Intronic
1060815328 9:126632294-126632316 GCAGGTGCCCGTGAGATGGGAGG + Intronic
1061007437 9:127936125-127936147 CCGGGTGCCTGGATGATGGGTGG - Intronic
1061129932 9:128703033-128703055 GAAGGGGCGCGGGTGAGGGGAGG - Intronic
1061181376 9:129026977-129026999 GGGAGTGCCCGGGTTGGGGGTGG + Intronic
1061195849 9:129106744-129106766 GGGGGTGCCATGGGGAGGGGAGG - Intronic
1061587225 9:131576977-131576999 GCAGGTGTCGGGGTGTGGGGGGG - Exonic
1061861823 9:133472311-133472333 GGGGGAGCCCTGGTGTGGGGGGG - Intronic
1061985446 9:134127663-134127685 GCGGGTGACGAGGTGAGGGGTGG + Intergenic
1062254285 9:135613827-135613849 GGGCCTGCCCGGGTGTGGGGAGG - Intergenic
1062285155 9:135769597-135769619 CCGGGTGCCCGGGGAACGGGGGG + Intronic
1062306018 9:135907476-135907498 GCGCGGTCCCGGGTGAGCGGCGG + Intergenic
1062332791 9:136051838-136051860 GCGGGAGCCCTGGGGCGGGGAGG + Intronic
1062353970 9:136153220-136153242 GTGGGTGACAGCGTGAGGGGCGG - Intergenic
1062392258 9:136338500-136338522 GAGGGCTCCAGGGTGAGGGGTGG - Intronic
1062414838 9:136443038-136443060 CCGGGTGCCCGGGCCAAGGGAGG + Intronic
1062588949 9:137264346-137264368 GCAGGTGCTGGGGTGAGGGTCGG + Exonic
1203562683 Un_KI270744v1:71730-71752 GCGGCTGGCCGGGCGGGGGGCGG - Intergenic
1186271820 X:7896759-7896781 GTGGGTGTCCAGGTGAGTGGTGG + Intergenic
1187173168 X:16870636-16870658 GCGGCTGGCCGGCTGAGTGGGGG + Intergenic
1187405550 X:19000741-19000763 GAGGGGGGCCGGGTGGGGGGTGG - Intronic
1190680908 X:52826944-52826966 GCGGCTGGCCGGGCGGGGGGTGG + Intergenic
1192260474 X:69503708-69503730 GCTGGTGCTTGGGTGGGGGGCGG + Intergenic
1192260570 X:69504111-69504133 GCGGGCGCCCGGGTTAGTGGGGG + Intergenic
1193148818 X:78104195-78104217 GCGGGAGGCGGGGTGTGGGGCGG + Exonic
1194452603 X:94062953-94062975 GCGGTTGCCAGGGGTAGGGGTGG + Intergenic
1194760156 X:97786913-97786935 GTGGTTGCCCGGGTTTGGGGTGG + Intergenic
1196148303 X:112344235-112344257 GTGGGTGTTAGGGTGAGGGGAGG - Intergenic
1197618293 X:128718799-128718821 GGGGGTGGAGGGGTGAGGGGAGG - Intergenic
1197701170 X:129601076-129601098 GCGGGTGCGAGGGAGAGGGCAGG - Intergenic
1197753254 X:129979919-129979941 GTGGGGGGCCGGGGGAGGGGCGG + Intergenic
1199267280 X:145843384-145843406 GAGGCTGCCTGGGGGAGGGGTGG + Intergenic
1199500530 X:148501307-148501329 TCGGATGCCGGGGTGGGGGGAGG + Intronic
1200140651 X:153901229-153901251 GCAGGTGCTGGGGTGAGGGGCGG - Intronic
1200148816 X:153941645-153941667 GCGTGTGGCCTGGTGAGGGGTGG + Exonic