ID: 1184061289

View in Genome Browser
Species Human (GRCh38)
Location 22:42083531-42083553
Sequence GAAAATGCACAGTTTCTGTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184061289_1184061292 -3 Left 1184061289 22:42083531-42083553 CCCAACAGAAACTGTGCATTTTC 0: 1
1: 0
2: 0
3: 34
4: 285
Right 1184061292 22:42083551-42083573 TTCCCTTAAGAAAGCTTCATGGG 0: 1
1: 0
2: 0
3: 19
4: 193
1184061289_1184061291 -4 Left 1184061289 22:42083531-42083553 CCCAACAGAAACTGTGCATTTTC 0: 1
1: 0
2: 0
3: 34
4: 285
Right 1184061291 22:42083550-42083572 TTTCCCTTAAGAAAGCTTCATGG 0: 1
1: 0
2: 2
3: 21
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184061289 Original CRISPR GAAAATGCACAGTTTCTGTT GGG (reversed) Exonic
901488829 1:9585480-9585502 TGAAATGCACAGTTAATGTTGGG + Intergenic
905622881 1:39464078-39464100 GAGCAGGCACAGTGTCTGTTGGG - Intronic
905801148 1:40843773-40843795 GAAAAGGCACAGTATGTGATAGG + Intergenic
905918694 1:41704326-41704348 GAAAAGGCACATTCTCTATTTGG + Intronic
905994867 1:42373141-42373163 GACAACGCACATATTCTGTTTGG + Intergenic
906985007 1:50673719-50673741 TAAAATGCAAAGGCTCTGTTAGG + Intronic
907467577 1:54649432-54649454 CCTAATGCACAGTGTCTGTTTGG + Intronic
907533250 1:55123387-55123409 GGAAAGGCCAAGTTTCTGTTGGG - Intronic
907586457 1:55622116-55622138 GGAAATGTACAGTGTGTGTTAGG + Intergenic
908182906 1:61623799-61623821 GGAAAGGGACAGTTTCTGTTTGG - Intergenic
909071671 1:71001739-71001761 AAAAATACACAGCTTCTTTTAGG - Intronic
909162310 1:72168460-72168482 GAAAATGAAGATTTTCTGGTGGG + Intronic
911093652 1:94038059-94038081 AAGATTGCACAGTTTCTCTTGGG + Intronic
911632424 1:100198359-100198381 GTAAGTGCAGAGTTTCAGTTTGG + Intronic
912375822 1:109209291-109209313 GAAAAAGCACAGTATATGTAGGG + Intergenic
913070265 1:115292251-115292273 TAAAATCCAGAGCTTCTGTTAGG + Intronic
913114041 1:115680470-115680492 CAAAATGCAGATTTGCTGTTAGG + Intronic
914397334 1:147282525-147282547 GAAAATGCAAAGTTGCTGGAGGG - Intronic
915520736 1:156441157-156441179 GGAAATGTACAGTTCCTGGTGGG + Intergenic
915521880 1:156450581-156450603 GAAAATACAGAGTTCCTGTTAGG + Intergenic
916558073 1:165910126-165910148 GACAATGAACAGTGTCTGCTGGG + Intronic
916866671 1:168867143-168867165 GAAAATTCACATTCTCTGATGGG - Intergenic
917565497 1:176208103-176208125 GAAAATATACAATTTCTGGTAGG + Intergenic
917959416 1:180130384-180130406 GAAAACCCACAGTTTCAGTTAGG + Intergenic
918549951 1:185730864-185730886 TAAAATTCACAGTGTCTGATAGG + Intergenic
919467012 1:197933872-197933894 GCAACTGCACATTTACTGTTTGG + Exonic
920635522 1:207698612-207698634 GAAAATTCTCAATGTCTGTTGGG - Intronic
920960057 1:210656039-210656061 AAAGATGCCCACTTTCTGTTCGG + Intronic
920966920 1:210708790-210708812 CAAAATGGAAAGTCTCTGTTGGG + Intronic
921495725 1:215838856-215838878 TAAAAAGTACAGTTTCTCTTTGG - Intronic
921990154 1:221357210-221357232 GATTATGCAGAATTTCTGTTAGG + Intergenic
923462844 1:234222177-234222199 GAAGATGCACAGCTTCTCTTTGG - Intronic
924018857 1:239759117-239759139 GAAAATGCTCAAGTTCTGATTGG - Intronic
924227252 1:241932303-241932325 GAAAACCAACAGTTTCTTTTTGG + Intergenic
1063642485 10:7844201-7844223 GAAAATCTACAGTTTCAGATAGG - Intronic
1063956774 10:11274386-11274408 GAAAATGCAGACTTTCTCATAGG + Intronic
1065065707 10:21961602-21961624 TAAAGGGTACAGTTTCTGTTTGG + Intronic
1066596680 10:37058442-37058464 GAGAAGACATAGTTTCTGTTGGG - Intergenic
1066612863 10:37267748-37267770 AAAGATGCACTGTTTCTGCTGGG + Intronic
1067689878 10:48494862-48494884 GAGAATGCAAAGTTTCTGGTGGG - Intronic
1067934981 10:50602521-50602543 GAAGATGCACAGTGTTTATTTGG + Intronic
1068317696 10:55367774-55367796 AAAAGTGGACAGTTTCTGATTGG + Intronic
1070683888 10:78467878-78467900 AAAAATGCACAGGCTATGTTCGG - Intergenic
1070868194 10:79723176-79723198 GAATAAGCACAGTTTCTATTTGG + Intergenic
1071271608 10:84012726-84012748 TAGATTGCACATTTTCTGTTTGG - Intergenic
1071635104 10:87245377-87245399 GAATAAGCACAGTTTCTATTTGG + Intergenic
1071660138 10:87492615-87492637 GAATAAGCACAGTTTCTATTTGG - Intergenic
1071777765 10:88808270-88808292 GAAAAAGCACAATTTCTTTTAGG - Intronic
1072124367 10:92432322-92432344 CAAAATGCACAGTTTGGGTTTGG - Intergenic
1072299798 10:94048585-94048607 TAAAATGCCCATTTTCTGTTGGG + Intronic
1072968913 10:99999718-99999740 GAAAATGCAGAGTATATGTAGGG + Intronic
1073928817 10:108549655-108549677 GCACATTCACAGTTTATGTTTGG + Intergenic
1074275805 10:112000658-112000680 GAAAATGCTTAGTAACTGTTGGG - Intergenic
1074336062 10:112577014-112577036 CACAATCCACAGTTTATGTTAGG + Intronic
1075208715 10:120471080-120471102 CATAATGAATAGTTTCTGTTTGG + Intronic
1075458526 10:122600539-122600561 GAAAAGGCAGAGTTTGTGCTTGG + Intronic
1076546978 10:131251901-131251923 GAACCAGGACAGTTTCTGTTTGG - Intronic
1077424526 11:2468085-2468107 GAAAATGCACTGTCTCTCCTGGG + Intronic
1081467744 11:43338555-43338577 GAAAATGCAGAGTATTTTTTAGG + Intronic
1081600322 11:44488327-44488349 GAAAATGAAGTGTTTCTGTAAGG + Intergenic
1083906158 11:65672336-65672358 ACAAATGCAGAGTTTATGTTGGG + Intergenic
1085242343 11:75068520-75068542 ATAAATACAGAGTTTCTGTTTGG - Intergenic
1085843669 11:80042070-80042092 GAACATGGAAAGTTTTTGTTGGG - Intergenic
1085953038 11:81356036-81356058 TAAAATACCCACTTTCTGTTAGG + Intergenic
1086127778 11:83367209-83367231 GCAAATGGACAGTTTCTCTATGG + Intergenic
1087900782 11:103638104-103638126 TAAAATGCATAGTTCCTGCTTGG + Intergenic
1087932391 11:103993003-103993025 GAAAATGAAGAGTAGCTGTTAGG - Intronic
1087954980 11:104274830-104274852 GAAAATACACAGGTTGTGGTTGG - Intergenic
1088864845 11:113837784-113837806 GAAAATGTTCAGTTTCTATCAGG - Intronic
1088901640 11:114122356-114122378 GAATATGCACATTTACTGTGGGG + Intronic
1089183795 11:116601165-116601187 GAAACTGCACAGTCTCGGTGAGG + Intergenic
1090187098 11:124745956-124745978 GAAAATGCTCAGTTCTTCTTCGG - Exonic
1090220931 11:125024620-125024642 GGAAATGCACAGTTGATTTTTGG + Intronic
1090232963 11:125122872-125122894 GAAAATACAGAGTTTTTTTTAGG + Intergenic
1092671698 12:10868699-10868721 CAATATCCACAGTTTCAGTTGGG - Intronic
1093868774 12:24261413-24261435 GCATTTACACAGTTTCTGTTGGG + Intergenic
1094226519 12:28052227-28052249 GAATTGGCAGAGTTTCTGTTTGG + Intergenic
1094324548 12:29222470-29222492 GAAAATGGACAGTTACTATGAGG + Intronic
1094799789 12:34019966-34019988 AAAAATGGGCAATTTCTGTTGGG - Intergenic
1095112579 12:38314271-38314293 AAAAATGGGCAATTTCTGTTGGG - Intergenic
1096056352 12:48655667-48655689 AAAAGTACAAAGTTTCTGTTTGG + Intronic
1097925778 12:65124737-65124759 GAAAATGCACAGGGTATTTTGGG + Intergenic
1098146788 12:67505674-67505696 TAAAGTGCACGCTTTCTGTTTGG - Intergenic
1098202719 12:68073506-68073528 AAAAATGGACAGTTTTTATTAGG - Intergenic
1099134841 12:78884139-78884161 GCAAATGCAATATTTCTGTTAGG - Intronic
1100080501 12:90843242-90843264 GAAAATGCACATATTGTATTTGG + Intergenic
1100165952 12:91917815-91917837 GAGAATTCACAGCTTCTTTTGGG + Intergenic
1102785509 12:115601056-115601078 GTAAATGCACAGCTTATATTTGG + Intergenic
1103217881 12:119217244-119217266 GAAAAGACACAGTTTCTGGTAGG + Intronic
1103431215 12:120888671-120888693 TAATATGTACAGTTTCTTTTGGG + Intronic
1104126994 12:125857194-125857216 GAAATTGAATACTTTCTGTTTGG + Intergenic
1104695245 12:130858639-130858661 GAAAACACACACTTTCAGTTGGG + Intergenic
1105465011 13:20631814-20631836 GAAAATACAGAATTTCTGGTAGG + Intronic
1106793072 13:33175983-33176005 GAAGGAGCACAGATTCTGTTAGG + Intronic
1107910454 13:45100725-45100747 GAAATTACACCCTTTCTGTTTGG - Intergenic
1108637159 13:52346741-52346763 GAAAATACAAAGTCACTGTTGGG + Intergenic
1108891453 13:55265623-55265645 GATAATACACTGTATCTGTTTGG - Intergenic
1108955522 13:56152062-56152084 GAAAATGTTCAGTTTCTAATAGG - Intergenic
1110670007 13:78166817-78166839 AAAGATGCAAAGTTTCAGTTAGG - Intergenic
1111766262 13:92533922-92533944 GAAAATTCACACTTTTAGTTAGG - Intronic
1112527412 13:100164807-100164829 TAATATGTACAGTTTCAGTTTGG - Intronic
1113900058 13:113791792-113791814 GAACTCCCACAGTTTCTGTTGGG - Intronic
1114571969 14:23676404-23676426 GAAAATGCATAGTGTATGTGTGG + Intergenic
1114896927 14:27002368-27002390 TAAAATCCACAGTTCATGTTAGG - Intergenic
1115546277 14:34467378-34467400 GAAAATGCACAGTTTTTAGTTGG + Intergenic
1116917709 14:50541459-50541481 AAAGATGCACAGTGTTTGTTTGG + Intronic
1118154323 14:63223752-63223774 GAAAAAGCAGAGTTTGTGTAGGG - Intronic
1118546252 14:66892761-66892783 GAGAATGGAGAGTTTTTGTTTGG + Intronic
1119114187 14:72003458-72003480 ATAAGTACACAGTTTCTGTTTGG - Intronic
1122075118 14:99230892-99230914 CAAAATGCTGAGTTTCTCTTTGG - Intronic
1122304949 14:100758329-100758351 GAGAATACACAGTCTATGTTAGG + Intergenic
1122381806 14:101313140-101313162 CAAAATGCACAGTTTACATTAGG - Intergenic
1122592051 14:102860670-102860692 GAAAATGAGCACTTTCTGGTTGG - Intronic
1126812778 15:52424957-52424979 TAAAATTCACACTTTCAGTTGGG + Intronic
1127641734 15:60922306-60922328 CAAATTGCATAGTTTATGTTAGG - Intronic
1127854868 15:62945946-62945968 GAAAATGGACAGTTTCACTTTGG + Intergenic
1128914207 15:71545033-71545055 GTGAATACAGAGTTTCTGTTTGG + Intronic
1130214889 15:81958952-81958974 GAAAAGGCACATTTTCTTATGGG - Intergenic
1130347693 15:83064083-83064105 CAAAGTGCACAGTTTCTTTAAGG + Intronic
1131893974 15:97005706-97005728 ATAAATGCACCCTTTCTGTTTGG - Intergenic
1133735268 16:8610184-8610206 CCAGATGCACAGTTTCTGTGTGG - Intergenic
1138424906 16:56924911-56924933 TAAAAAGCACAGATTCTGGTTGG + Intergenic
1138708387 16:58941088-58941110 AAAAATGCAGAGATTCTGTAAGG - Intergenic
1138727685 16:59158576-59158598 GTAAATGCTCAGTACCTGTTAGG - Intergenic
1143569579 17:7747423-7747445 TAAATTGTACAGTTTCTGTAAGG + Intronic
1143926871 17:10378893-10378915 GAAAATGTACAGTTTGGGATGGG - Intergenic
1143988768 17:10938828-10938850 GAAAATGCACAGGTACTGGAGGG + Intergenic
1144830186 17:18126838-18126860 GATTATGCACTGGTTCTGTTTGG - Exonic
1145376703 17:22356355-22356377 AAGAATGCAGAGTTTCAGTTTGG - Intergenic
1146473593 17:33144204-33144226 GAGACTGCTCAGTTTCTTTTTGG + Intronic
1146671120 17:34738611-34738633 TGAAATGCTCCGTTTCTGTTGGG + Intergenic
1147367111 17:39966261-39966283 CAAAATTCCCAGTGTCTGTTGGG - Exonic
1149967303 17:61178111-61178133 TAAAATTCACAGGTTCTGGTTGG + Intronic
1151145205 17:72034156-72034178 GAAATTACACAGTTCCTCTTTGG - Intergenic
1153245629 18:3070590-3070612 GAAAATGCACAGTACTTGTTGGG + Intronic
1153246201 18:3074727-3074749 GAAAATGTACAGTATTTGTTGGG + Intronic
1153269865 18:3309472-3309494 GAAAATATAAAGTTACTGTTTGG - Intergenic
1153671978 18:7420179-7420201 GAAAATACAGATTTTCTGGTGGG + Intergenic
1155559186 18:27057360-27057382 GAAACTGCATAGCTTCTGTGTGG + Intronic
1157543216 18:48527169-48527191 TAAAATCCACAGTTTCCCTTAGG + Intergenic
1158152778 18:54391135-54391157 GAAAATGCACTGGTTTTGTAAGG - Intergenic
1158199793 18:54927052-54927074 CAAAAAAGACAGTTTCTGTTAGG - Intronic
1158200846 18:54938680-54938702 TAAAATGGACAGTTTAAGTTAGG - Intronic
1158284299 18:55862274-55862296 GAAAAAACACATTTTATGTTAGG - Intergenic
1158850351 18:61490460-61490482 AAAAATACACAGTTTTTGATTGG - Exonic
1158935236 18:62358416-62358438 GAAAACGGACGGATTCTGTTGGG + Intronic
1158942533 18:62418862-62418884 GTGGATGCACAGTTTCTTTTTGG - Intergenic
1165338885 19:35196180-35196202 GAAATTGGGCAGTTTCTGTCTGG - Intergenic
1165970456 19:39624446-39624468 GGAAAAGCACAGTATCTGTGCGG + Intergenic
1168375491 19:55875630-55875652 GAAAATGCGATGTTTTTGTTTGG + Intronic
1168460799 19:56555695-56555717 GAAAAAGCACATTTTCTATCAGG + Exonic
1168558366 19:57362570-57362592 GAAAGTTCACAGTTTTTATTGGG + Intergenic
925762926 2:7204218-7204240 CAAAATGCACTGATTCTATTGGG - Intergenic
926023185 2:9515034-9515056 CAAAGTCCACAGTTTATGTTAGG + Intronic
926106276 2:10153907-10153929 GAACAGGTAGAGTTTCTGTTTGG + Intronic
927834399 2:26381435-26381457 GAAGATGCAGCGTTTCTCTTTGG + Intronic
928152745 2:28846849-28846871 GAGAATACATTGTTTCTGTTTGG - Intronic
929537356 2:42792136-42792158 CAAAATGCACAGTGTCACTTGGG + Intronic
931032597 2:58196923-58196945 TAAAATACACATTTTCTATTTGG - Intronic
932842662 2:75098293-75098315 GAAAATGCTCATGTTATGTTTGG - Intronic
933040939 2:77465778-77465800 GCAAAGTTACAGTTTCTGTTTGG + Intronic
933309553 2:80643484-80643506 GAAAATAAGCAGTTTCTCTTAGG + Intronic
933491552 2:82991411-82991433 GAAAATAGAGAGTTGCTGTTTGG + Intergenic
934252878 2:90377311-90377333 GAGATTGCACAATTTTTGTTTGG - Intergenic
934256563 2:91425636-91425658 GAGATTGCACAATTTTTGTTTGG + Intergenic
935873821 2:107484485-107484507 GAAAATGGCTAGATTCTGTTTGG + Intergenic
938577158 2:132615480-132615502 AATAAAGCACAGTCTCTGTTGGG - Intronic
938811706 2:134860000-134860022 GAAAAGGCACAGTAACAGTTTGG + Intronic
938835900 2:135103766-135103788 CAAAAGGAACAGATTCTGTTGGG + Intronic
939623004 2:144444051-144444073 CAAAAAGAAAAGTTTCTGTTTGG - Intronic
941320357 2:164046868-164046890 GACGATGAAAAGTTTCTGTTTGG + Intergenic
941732223 2:168931367-168931389 GTAAATGTAAAGTTTCTGTGTGG - Intronic
941920232 2:170842713-170842735 GAAAATGGACATATTCTTTTTGG + Intronic
942727349 2:179025073-179025095 GAAAATGAACAATCTCTGTAAGG - Intronic
943429593 2:187782672-187782694 AAAAATTCTCATTTTCTGTTAGG + Intergenic
943888653 2:193256516-193256538 GAAAATGCACAGATATTGTTAGG + Intergenic
944418844 2:199506890-199506912 TAAAAAGGACAGTTTATGTTGGG + Intergenic
944433024 2:199657073-199657095 TAAAATGCCCAGATTTTGTTTGG + Intergenic
945032348 2:205677674-205677696 GAAAATGCTCACTGTCTGTTTGG - Intergenic
945157511 2:206855149-206855171 GAATGGGCACAGTTTCAGTTTGG + Intergenic
945499160 2:210547833-210547855 GAGAATCCTTAGTTTCTGTTGGG + Intronic
945897329 2:215498310-215498332 GAAAATGCATAATTTTTTTTTGG - Intergenic
1169248084 20:4039420-4039442 GCACATGCAAAGTTTCTCTTGGG - Intergenic
1169346361 20:4831193-4831215 GAAACTACACAGTCTGTGTTTGG + Intergenic
1171998312 20:31750832-31750854 GAGAAAGCTCAGTTTCTTTTGGG + Intronic
1173682675 20:44897064-44897086 TAAAATGCACCCTTTCTGTTTGG - Intronic
1173723748 20:45282303-45282325 GGACATGAACAGTCTCTGTTGGG + Intergenic
1174951635 20:55048393-55048415 GAAAATGCACACTTTCTGCCAGG + Intergenic
1177503826 21:21996286-21996308 GAAATTCCTCAGCTTCTGTTTGG + Intergenic
1184061289 22:42083531-42083553 GAAAATGCACAGTTTCTGTTGGG - Exonic
1184780257 22:46645239-46645261 GACAAGGCACAGGTTCTGCTGGG - Intronic
1185026769 22:48418644-48418666 GAAAAACCATAGTATCTGTTTGG + Intergenic
949743928 3:7266719-7266741 TACAATGCCCAGTTTCTGTTTGG - Intronic
950132000 3:10553770-10553792 GATAATCCAAAGTTTCTGTTGGG + Intronic
956119213 3:65949356-65949378 GAAATTGCTAAGTTCCTGTTAGG + Intronic
956967773 3:74483374-74483396 GAAAATGAATAATTTCTATTGGG + Intronic
957614203 3:82506714-82506736 GCAAATGAACATTTTGTGTTTGG - Intergenic
959074196 3:101733455-101733477 GAAAATGCAGAGTTTTAATTTGG + Intronic
959148400 3:102577607-102577629 GGAGATGGACAGTTTCTGCTTGG + Intergenic
960753807 3:120985528-120985550 AAAAATGCAAAGTTTCATTTAGG - Intronic
961207445 3:125096262-125096284 GAAGATGCACTGTTTCAGGTAGG - Intronic
962117497 3:132526980-132527002 CAAAAAGTACAGTTTCTGTTAGG + Intronic
963371745 3:144409927-144409949 GAAACTGCAAAGTTTCTGCACGG - Intergenic
964030784 3:152136566-152136588 GGAAATGCTCAGTAACTGTTGGG + Intergenic
964473378 3:157077246-157077268 GAAAATGCTCTGCTTCTGTACGG - Intergenic
964811216 3:160666782-160666804 ATATATGCACAGTTTCTGTATGG - Intergenic
966006492 3:175020083-175020105 GGAAATCCACAGATTCTGTTGGG + Intronic
966773545 3:183524502-183524524 GAAACAGGACAGTTTCTTTTAGG - Intronic
967662119 3:192125487-192125509 GCATAAGCACTGTTTCTGTTAGG + Intergenic
967887651 3:194344293-194344315 GAAAATGCACACCTTCCTTTAGG + Intronic
968256833 3:197281949-197281971 GAAAATGCGATGTTTCTGTTTGG - Intronic
970542683 4:17095490-17095512 GAAAAAACACAGAGTCTGTTTGG + Intergenic
971141321 4:23928232-23928254 GAAAATCCACAATTTCTGGTGGG + Intergenic
971551814 4:27966778-27966800 GACAATACCCAGTTTCTGATGGG - Intergenic
971784412 4:31082375-31082397 TAAAATTCACATTTTATGTTGGG - Intronic
971846267 4:31923006-31923028 GAAAAAACACAGTTTCCTTTAGG + Intergenic
972295880 4:37737533-37737555 GGAACTGCACAGTTTCTTTTTGG - Intergenic
972309715 4:37868878-37868900 CTAAATGCATACTTTCTGTTTGG - Intergenic
975110882 4:70625107-70625129 GAAGATGCTCAGTTTTTCTTTGG + Intergenic
975971650 4:80046311-80046333 AAAAATGCATAGTTTGTGATTGG + Intronic
979066441 4:116141630-116141652 GATTATGAACAGTTTTTGTTAGG + Intergenic
979662908 4:123279113-123279135 AAAAATGAAGAGTTTCTTTTAGG + Intronic
980504952 4:133706593-133706615 GCAGATACAGAGTTTCTGTTGGG - Intergenic
981544000 4:145875535-145875557 GAAAAGGGACATTTTCTGGTAGG + Intronic
982851082 4:160316993-160317015 AAAGAAGCACAATTTCTGTTGGG - Intergenic
982900215 4:160989429-160989451 AAAAATGTACAGTATCAGTTAGG + Intergenic
984729936 4:183058679-183058701 TAAAAAGAACAGTTCCTGTTTGG - Intergenic
984732377 4:183079752-183079774 GAAAATGCAAATTTCATGTTGGG + Intergenic
986548562 5:8926722-8926744 GAACATGAAAAGTTTCTCTTTGG - Intergenic
986951559 5:13092652-13092674 GTAAATGCACAGATTTTGTGGGG - Intergenic
987363920 5:17131287-17131309 GAAAAAGCATAGTTGCTGCTAGG + Intronic
989409734 5:41105340-41105362 TAAAGTGCACAGTTTATATTAGG + Intergenic
989771269 5:45148988-45149010 GAAAATGCAGAGTTTCTTCAGGG - Intergenic
991730816 5:69586146-69586168 GAATATGTTCAGTTTCTTTTAGG - Intronic
991807252 5:70441308-70441330 GAATATGTTCAGTTTCTTTTAGG - Intergenic
991864134 5:71041710-71041732 GAATATGTTCAGTTTCTTTTAGG + Intronic
993007819 5:82447139-82447161 GAAAATGCATAATTTCTGAGTGG + Intergenic
994235545 5:97358214-97358236 GTGAATCCACAGTTTCTGTCTGG + Intergenic
994741760 5:103627944-103627966 AAAAATGCACATTCTCTTTTTGG + Intergenic
996497014 5:124170251-124170273 GAATAAGCTCAGTCTCTGTTTGG + Intergenic
996535912 5:124577596-124577618 CAAAATGAACAGTTACTCTTTGG - Intergenic
998690491 5:144582103-144582125 GAAAATGCCCAGTCTTTCTTTGG + Intergenic
1000437362 5:161229504-161229526 GGAGATGCACTGTTTCTGCTGGG + Intergenic
1000961355 5:167605123-167605145 GAAAATGCTCAGTATGTTTTAGG - Intronic
1001137260 5:169112833-169112855 CAAAAGCCACAGCTTCTGTTGGG + Intronic
1002047952 5:176552614-176552636 GAAAAAGCACAGTGTCTGTGTGG - Intronic
1002703189 5:181141880-181141902 GAGTATACACAGTTTCAGTTAGG - Intergenic
1004131433 6:12924056-12924078 CAAAAAGCACAGTTTGTATTTGG - Intronic
1005399705 6:25418986-25419008 GAAAATGCATTGTTTCTATTTGG + Intronic
1006687194 6:35845696-35845718 GAAACTCCTCATTTTCTGTTTGG - Intronic
1007102371 6:39258239-39258261 GTGAATACAGAGTTTCTGTTTGG - Intergenic
1008172867 6:48231790-48231812 GAACATGCAAAGTTTGTCTTTGG + Intergenic
1009291338 6:61886505-61886527 GAGCATGCATAGTTTCTATTTGG + Intronic
1009816086 6:68737661-68737683 GAACATGGACAATTTATGTTTGG - Intronic
1010369261 6:75088594-75088616 AAAAATGAAAAGTTTCTATTAGG - Intronic
1010581390 6:77601128-77601150 GGAAAATCACTGTTTCTGTTTGG - Intergenic
1010660596 6:78566646-78566668 GACAATTCATTGTTTCTGTTGGG - Intergenic
1011080765 6:83488286-83488308 TAAAATCCACAGTTTCTATTAGG + Intergenic
1012556837 6:100523543-100523565 GAAAATGGGCAGTCTCTGTAAGG + Intronic
1013775642 6:113675868-113675890 GACAATGCACATTTTTTGTGAGG + Intergenic
1014407289 6:121067631-121067653 GAAAATTCAGGGTTTCTGTAAGG + Intergenic
1015889933 6:137960322-137960344 AAATATGCATACTTTCTGTTGGG + Intergenic
1016240585 6:141924962-141924984 TAAAATTAACATTTTCTGTTAGG - Intergenic
1016718737 6:147267410-147267432 GTAAATGCACAGTGTCTCTTTGG - Intronic
1016967809 6:149734854-149734876 GAAAATGAAAAATTTCTGTCCGG + Intronic
1018460276 6:163991920-163991942 GATAATGCATACTTTTTGTTCGG - Intergenic
1018845735 6:167553955-167553977 CACAATGCATAGTTTCTGTTTGG + Intergenic
1020559261 7:9709240-9709262 AAAAATAAAAAGTTTCTGTTAGG + Intergenic
1021642883 7:22757188-22757210 AAAACTGCAGAGTTTCTGGTGGG + Intergenic
1022183126 7:27941099-27941121 CAAGATGCACAATTTCTGTTTGG + Intronic
1023934920 7:44732853-44732875 GTACATGCAAAGTTTCAGTTAGG + Intergenic
1024315206 7:48009703-48009725 GAAAAGGTAAAGTTACTGTTTGG + Intronic
1025562849 7:62391778-62391800 GAGACTGCACAGTTTTTATTTGG + Intergenic
1028697248 7:93728824-93728846 GCATATGCAAAGGTTCTGTTTGG - Intronic
1033219995 7:139521432-139521454 AATAATGCAGAGATTCTGTTAGG - Intergenic
1033390034 7:140918365-140918387 TCACATGCACAGTTTCTGATAGG + Intronic
1035992843 8:4511223-4511245 GAGAATTCACACTTTCTTTTGGG - Intronic
1037591878 8:20319548-20319570 GAAAATGCAGCGTCTCTGCTAGG + Intergenic
1040589466 8:48777203-48777225 GAAAATGCACATTTAGTTTTGGG + Intergenic
1040786764 8:51176006-51176028 GAAAATGAACTGTATCTCTTTGG - Intergenic
1042821850 8:72937721-72937743 GAAAGGGAACAGTTTCTGCTTGG - Exonic
1045205167 8:100031675-100031697 CTAAATGCACAATTTTTGTTAGG + Intronic
1047340123 8:123973067-123973089 GAAAAGGAACACTTTCAGTTTGG + Intronic
1048572125 8:135665029-135665051 GAAACTGCACTGTCTCTGCTGGG + Intergenic
1049063644 8:140295884-140295906 CAAAATGCACATTATTTGTTTGG - Intronic
1050500424 9:6292751-6292773 GAAAATGCACAGGGACTTTTAGG - Intergenic
1050652374 9:7788596-7788618 GACCATGGATAGTTTCTGTTAGG - Intergenic
1051624931 9:19090353-19090375 GAAAAAGAAAAGATTCTGTTTGG - Intronic
1052381454 9:27775365-27775387 GAAAAAGCAAAGATGCTGTTTGG - Intergenic
1052822050 9:33145291-33145313 GAAAATGCACCATTTTTATTAGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053112433 9:35473498-35473520 AAAAATGGGAAGTTTCTGTTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053610273 9:39706215-39706237 GAAAATGCACATTTTCTCACAGG + Intergenic
1053868310 9:42464244-42464266 GAAAATGCACATTTTCTCACAGG + Intergenic
1054087979 9:60764941-60764963 GAAAATGCACATTTTCTCACAGG - Intergenic
1054243251 9:62636180-62636202 GAAAATGCACATTTTCTCACAGG - Intergenic
1054557376 9:66670698-66670720 GAAAATGCACATTTTCTCACAGG - Intergenic
1055279236 9:74655640-74655662 CAGTATGCAAAGTTTCTGTTGGG - Intronic
1056123189 9:83509856-83509878 GAAAACGCACATTCTCTGTGTGG + Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059369242 9:113812261-113812283 GAAAATGCTAAATTTCAGTTAGG + Intergenic
1060887677 9:127167168-127167190 GAAAATCCACAGCCTCCGTTTGG + Intronic
1187265431 X:17727893-17727915 GGAAAAGCACAGTTTTTGGTTGG - Exonic
1187651849 X:21418490-21418512 GAAATTCCACAGCTTTTGTTTGG + Intronic
1187967303 X:24624716-24624738 CAAAATTCACAGCTTCTGTGAGG + Intronic
1188190803 X:27169590-27169612 GATAATGCACTGTTACTGCTTGG - Intergenic
1188475851 X:30591039-30591061 GACAATGCAAACTTTCTGTTGGG + Intergenic
1189403121 X:40690953-40690975 GAAAATGGACTTTTTCAGTTGGG - Intronic
1190003722 X:46714039-46714061 TAAAATGTACTTTTTCTGTTTGG - Intronic
1191739610 X:64422925-64422947 GAAAAGGCAGAATTTCTGCTGGG - Intergenic
1192382080 X:70627567-70627589 GAATATCCACATTTTCTCTTGGG + Intronic
1194288837 X:92043000-92043022 GAAAATGCACAGCTATTTTTAGG - Intronic
1196048762 X:111283006-111283028 GAAAATGCCCAGTTTGGTTTGGG + Intergenic
1196659073 X:118251106-118251128 GTAAATGGGGAGTTTCTGTTTGG - Intergenic
1198746283 X:139893946-139893968 GAAAGAGCAGATTTTCTGTTGGG - Intronic
1200606357 Y:5267567-5267589 GAAAATGCACAGCTATTTTTAGG - Intronic
1201350978 Y:13041002-13041024 GTAAGTACAGAGTTTCTGTTTGG + Intergenic