ID: 1184061612

View in Genome Browser
Species Human (GRCh38)
Location 22:42085940-42085962
Sequence TTGCATGTCAGTAAACAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184061612 Original CRISPR TTGCATGTCAGTAAACAGGA AGG (reversed) Exonic
900619706 1:3581150-3581172 GGGCATATCTGTAAACAGGATGG - Intronic
901793456 1:11666773-11666795 TCCCATCTCAGAAAACAGGAGGG - Intronic
905901933 1:41587393-41587415 TTACATCTCAGTCAACAGGGTGG + Intronic
905992402 1:42349923-42349945 TTGAATATCAGAAAACAGGCTGG - Intergenic
909332587 1:74431835-74431857 TTGCAAGTTAGCAAACAGCATGG + Intronic
911361358 1:96881274-96881296 TTACATGGCAGCAAACAAGAGGG + Intergenic
911559539 1:99387690-99387712 TTGCATTTCAGGGAAGAGGAAGG - Intergenic
911948024 1:104136814-104136836 TTGCATGTCAGCAAAGACAAGGG + Intergenic
912202502 1:107474187-107474209 TCCTATGTCAGTAAACAGAAAGG - Intronic
912731188 1:112107007-112107029 TTGTATGTCAGGAAACAGGGAGG + Intergenic
912895027 1:113577204-113577226 TTGCTTGTAACTAAACAGAAAGG + Intronic
913376287 1:118156415-118156437 TAGCATGTCAGGAAACTGCAGGG + Intronic
914687995 1:149999387-149999409 ATTCATGTCAGTAAACAACAGGG + Intronic
914844828 1:151276975-151276997 TTGTATGTCAGTACACGGGTGGG - Intergenic
919055024 1:192559853-192559875 TTGTGTGTCAGGAAATAGGAAGG + Intergenic
919383225 1:196884744-196884766 TTACATGTCAGAAAAATGGATGG + Intronic
920950506 1:210567914-210567936 TTGTATGTCAGGAAACTGGGAGG - Intronic
921022258 1:211246798-211246820 ATGCATCTCAGTGAACAGAAGGG + Intergenic
922780338 1:228247319-228247341 TTCCATGTCCATAAAAAGGAGGG - Intronic
924063627 1:240202155-240202177 TTGTATTTCTGTAAACGGGAAGG + Intronic
924469592 1:244330050-244330072 TTACATGCCAGAAAACAGGGAGG - Intergenic
924820940 1:247490110-247490132 TAGCATGTCAGTTGTCAGGATGG + Intergenic
1066060625 10:31720719-31720741 CTGCATTCCAGTCAACAGGAAGG - Intergenic
1066674423 10:37873400-37873422 ATGCATGTATGTAAATAGGATGG - Intergenic
1067381044 10:45773705-45773727 TAGCCAGTCAGTAAAAAGGAAGG + Intronic
1067888742 10:50114344-50114366 TAGCCAGTCAGTAAAAAGGAAGG + Intronic
1068958973 10:62847394-62847416 TTGCATGTCAGCAAACACAAGGG + Intronic
1069136028 10:64766868-64766890 TTGCATTTCAGTTAACTGGAAGG + Intergenic
1070405231 10:76088475-76088497 TTGGTTGCCAATAAACAGGAAGG + Intronic
1071127789 10:82354943-82354965 GTTCCTGTAAGTAAACAGGAGGG - Intronic
1071275030 10:84045918-84045940 ATTCAAGTCAGAAAACAGGAGGG + Intergenic
1071465177 10:85933170-85933192 TCCCATGTCAGAAAGCAGGAGGG - Intronic
1073304098 10:102489174-102489196 TTTCATGACAGAACACAGGAAGG + Intronic
1074038204 10:109761941-109761963 TTGCATCTCAGTTACCAGGTTGG - Intergenic
1075452794 10:122563982-122564004 TGGCATGTCAGAAAAGAGGTGGG + Intronic
1081286260 11:41274087-41274109 TGGCATGTCAGGAAATAGCAGGG + Intronic
1085633274 11:78137622-78137644 TTGTATCTCAGTCAACAGCAAGG + Intronic
1086554014 11:88088101-88088123 TTCCATGTCAGCAGACAGGATGG + Intergenic
1087652706 11:100887036-100887058 ATGCATGTCAGTACTCAGGATGG + Intronic
1090040357 11:123285286-123285308 TTCAATGTCTGTAAACAGAATGG - Intergenic
1092736788 12:11590339-11590361 TTGCTTATGAATAAACAGGAAGG + Intergenic
1093161819 12:15755741-15755763 TTGAATGGCAGCAGACAGGAAGG - Intronic
1093220138 12:16410946-16410968 TTCCATGTCAGAAAAAAGCATGG - Intronic
1093302554 12:17473813-17473835 CTGCATGTAAGGAAAAAGGATGG - Intergenic
1093772723 12:23036352-23036374 ATGAATGACAGTAATCAGGATGG + Intergenic
1095588349 12:43874203-43874225 TTGCATTACAATAAATAGGAAGG + Intronic
1095796329 12:46222919-46222941 TTTCATGACAGTAAAGGGGATGG + Intronic
1097409566 12:59234629-59234651 TCACAGTTCAGTAAACAGGAAGG - Intergenic
1098016809 12:66113884-66113906 TAGCATGGCAGAAAAGAGGACGG + Intergenic
1098503085 12:71217081-71217103 TTCCATGGTAGTAAACAGAATGG - Intronic
1099947509 12:89261386-89261408 TTGCTTTTTAGTAAACAAGAGGG - Intergenic
1100187819 12:92156687-92156709 TTGTATGCCAGGAAGCAGGAGGG - Intergenic
1104977441 12:132558499-132558521 TTTCATGGCAGGAAACAGCAGGG + Intronic
1105784124 13:23731312-23731334 TTGCAATTCAGTGAACATGAAGG + Intronic
1108734036 13:53263833-53263855 TTTCAGGTCAGAAAGCAGGAGGG - Intergenic
1108819862 13:54335570-54335592 TTACATGGCAGAAAACAGAAAGG + Intergenic
1109111963 13:58332295-58332317 TTGTATGTAAATAAACAGGCTGG + Intergenic
1110238997 13:73246060-73246082 ATGCATTTCAGTTAACAGGTTGG - Intergenic
1111784825 13:92773100-92773122 TTGTATATCAGTTATCAGGAAGG - Intronic
1112672818 13:101660402-101660424 TTGCATTTCTGAAAACTGGATGG - Intronic
1113258667 13:108535347-108535369 GTGCATGTCAGTCAACAGATAGG - Intergenic
1118116789 14:62786944-62786966 TTGTGTCTCAGAAAACAGGAAGG - Intronic
1118674010 14:68162998-68163020 TTTCATGTCATTTAACAAGAAGG - Intronic
1120416664 14:84227864-84227886 TGGCATGTGAGTACACAAGAAGG - Intergenic
1120572852 14:86143384-86143406 TTGCATTTCAGATGACAGGATGG - Intergenic
1121749342 14:96335692-96335714 TGGGATGTCAGTAGTCAGGAAGG - Intronic
1122404285 14:101490688-101490710 GTGCATGTCAGAAAGGAGGATGG + Intergenic
1122482777 14:102058324-102058346 TTGCATTTCTGATAACAGGATGG + Intergenic
1126826960 15:52561047-52561069 TTGCATGTTTTTAAAAAGGAAGG - Intronic
1127435487 15:58953486-58953508 TTACATGCCAGAAAACAGGGAGG - Intronic
1127626363 15:60784021-60784043 ATGCTGGTCAGTAAACAGTATGG + Intronic
1128863294 15:71092622-71092644 TTACATCTCAGTAAGCTGGAAGG + Intergenic
1129947025 15:79548072-79548094 TTACATGCCAGTAATCATGAGGG - Intergenic
1130548942 15:84877142-84877164 TTGCCTCTCAGTAACCAGGCTGG - Intergenic
1131107142 15:89743054-89743076 GTGCATGTGGGTAGACAGGATGG - Intronic
1133566690 16:7002163-7002185 TTGCATGTCAGTACACTGAGAGG - Intronic
1135569434 16:23537009-23537031 TTGCACATGAGTGAACAGGAGGG + Intronic
1138396809 16:56710619-56710641 TTTGATGTAAGTAGACAGGATGG - Intronic
1139207208 16:65040795-65040817 TTACATGTCAATAAAAAGCATGG - Intronic
1140584978 16:76278613-76278635 TTGTTTGTCATTAATCAGGAGGG - Intronic
1141906424 16:87029656-87029678 TTGCATGTCAGGAAGCTTGAAGG + Intergenic
1144117363 17:12111166-12111188 TAGCCTGACAGTAAATAGGAAGG + Intronic
1144540595 17:16137691-16137713 TTGCATGTATGTAATCAGAAAGG - Intronic
1145984600 17:29036876-29036898 CTACCTATCAGTAAACAGGAGGG + Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155024639 18:21930275-21930297 TTCCATGTCATTAAACCGGGGGG - Intergenic
1155072840 18:22331256-22331278 GAGAATGTCAGTAATCAGGAGGG - Intergenic
1155685859 18:28549435-28549457 TTGTATTTCAATAAACAGTAAGG + Intergenic
1157546214 18:48548373-48548395 TGGCATGTCACCAAACAGGCTGG + Intronic
1159869962 18:73750114-73750136 TTGCATGTTAGGGAACTGGAGGG - Intergenic
1163874790 19:19858925-19858947 GCGCATGTAAGTGAACAGGATGG - Intergenic
1163919352 19:20274361-20274383 GAGCATGTAAGTGAACAGGATGG - Intergenic
1163958749 19:20667383-20667405 GAGCATGTAAGTGAACAGGATGG + Intronic
1164997725 19:32735023-32735045 TTGTGTGTCAGTGAACAGGAAGG - Intronic
1168345229 19:55647571-55647593 TTGCAGGTGAGTTAACAGGCTGG + Intronic
925556937 2:5141992-5142014 TTACATATAAGTAAACAGAAGGG - Intergenic
926494851 2:13573454-13573476 TTGCATTTCAATAAAAAGGAAGG - Intergenic
929185175 2:39086621-39086643 TTCCATGTTGGTAAACAGGAAGG + Intronic
929898982 2:45985279-45985301 TGGCACGGCAGGAAACAGGAAGG - Intronic
931174026 2:59834855-59834877 TTGCAGGACAGGAAACAGGCTGG - Intergenic
931187168 2:59964398-59964420 TTGCATTCCAGGCAACAGGAAGG + Intergenic
933246103 2:79976407-79976429 TTACATCTCAATAAAAAGGAAGG - Intronic
933802534 2:85974689-85974711 CTGCAAGTCAGAAAGCAGGAAGG - Intergenic
934604135 2:95681520-95681542 CTCCATGCCAGTAATCAGGAAGG + Intergenic
935237084 2:101148542-101148564 ATGCATGTATGTAAGCAGGAGGG + Intronic
935344136 2:102089297-102089319 TTGCATCTCAGAGAATAGGAAGG + Intronic
936537526 2:113323754-113323776 CTCCATGCCAGTAATCAGGAAGG + Intergenic
936808897 2:116372141-116372163 TTTCCTGGCAGAAAACAGGATGG + Intergenic
938744593 2:134265296-134265318 TGGGATCTCAGTAAAAAGGAGGG - Intronic
940381466 2:153019194-153019216 TTACATGACAGTAAACAAGAGGG + Intergenic
940613120 2:156015667-156015689 TTGCATCTCAGAAATCAGGGAGG - Intergenic
941969332 2:171332672-171332694 CAGCATGTCATTAAACAGTAAGG + Intronic
942767928 2:179479280-179479302 TTTCAGGTCAGTAAACAAAATGG - Intronic
943442637 2:187944798-187944820 TTGCCTGTCAGAAAATTGGAAGG - Intergenic
946731235 2:222711471-222711493 GGGGATGTCAGTAAACAGGAAGG - Intergenic
947234620 2:227927045-227927067 TTGCATCTCAGGAAACAGAGAGG - Intergenic
1171106324 20:22436157-22436179 TCCCATGTCAGTAAAGTGGATGG - Intergenic
1172581099 20:36049560-36049582 TTGCCTCGCTGTAAACAGGATGG + Intergenic
1174218051 20:48932298-48932320 TTGGTTGTGAGTAAAGAGGACGG + Intronic
1175798845 20:61789412-61789434 GTGCATGTCAGAAAAGGGGAGGG + Intronic
1177231391 21:18325265-18325287 TTGCTTGTAAGTAAACAGATTGG + Intronic
1178482953 21:32996230-32996252 TTGTATGCCAGGAAACAGGGAGG - Intergenic
1178574635 21:33774398-33774420 TGGCGTGTCAGTAAATAAGAAGG + Intronic
1182776797 22:32837356-32837378 TTGCATGGCAGTAAGCAAGTCGG + Intronic
1183213875 22:36466915-36466937 AAGCATGTTAGTGAACAGGAAGG + Intergenic
1183561619 22:38579073-38579095 TAGCATGTCAGTTAAGAGCATGG - Intronic
1184061612 22:42085940-42085962 TTGCATGTCAGTAAACAGGAAGG - Exonic
1184360965 22:44018451-44018473 TTGGATGTCACTAACCAGCAGGG - Intronic
1184853397 22:47133695-47133717 TTGGCTGTCAGGAAACAGGAGGG + Intronic
952457960 3:33491998-33492020 TTGGATGTGAGAAAATAGGATGG - Intergenic
954369170 3:50161222-50161244 ATGCATGCAAGTAAGCAGGAGGG + Intronic
957536557 3:81512445-81512467 TTGAGTGTCAGAAACCAGGATGG + Intronic
958047659 3:88304475-88304497 TTGGATGTCAGAAAATAGCAGGG + Intergenic
959014322 3:101115578-101115600 TTGCATCTCAGGGAACTGGAAGG - Intergenic
959347423 3:105216559-105216581 TTGAATGTAAGTAAACACTATGG - Intergenic
960634014 3:119765704-119765726 ATGCTTGTCAATACACAGGATGG - Exonic
961671514 3:128535278-128535300 CTGCATGTCAGGCAGCAGGATGG - Intergenic
962033485 3:131626122-131626144 TTGTATCTAAGGAAACAGGAAGG - Intronic
962183264 3:133231023-133231045 ATGCATGTCAGTAATCAGGGTGG - Intronic
962260157 3:133896869-133896891 CTGCATGTCGGTGAACACGATGG + Intergenic
962629464 3:137261128-137261150 TTGCATGACAATAAAAAGTATGG + Intergenic
963601577 3:147383564-147383586 TGGCATTTCAGTAAACACAATGG - Intergenic
966348041 3:179000749-179000771 TTGAATGTCACAAAAAAGGAAGG - Intergenic
967921135 3:194615355-194615377 CTCCATGCCAGTAAACAGGAAGG + Intronic
968243061 3:197110405-197110427 TTTCATGTCAGTCTACAGGATGG + Intronic
968601299 4:1511190-1511212 CTGCAGCTCAGGAAACAGGAAGG - Intergenic
970505482 4:16725141-16725163 TTTCATGTCAGTGAATAGGTGGG - Intronic
971488696 4:27188801-27188823 AGGCATTTCAGTAAACAGGTGGG + Intergenic
972893844 4:43594230-43594252 TTTCATGTCACTAAATTGGAAGG - Intergenic
973714249 4:53659315-53659337 TTGCATTTCAGTGACCAGGTTGG + Intronic
974186718 4:58456718-58456740 TTACATGTGAATAAGCAGGAGGG - Intergenic
974613150 4:64242625-64242647 TTGCTTGTCAATATACAGGGAGG - Intergenic
976489393 4:85651123-85651145 TTGGAGCTTAGTAAACAGGACGG + Intronic
977169465 4:93742794-93742816 TTGTGTCTCAGCAAACAGGAGGG - Intronic
979290013 4:118969054-118969076 TTCCAGGTCAGTTAAAAGGAGGG + Intronic
979460780 4:120980488-120980510 TTCCATATCAGTAAAAAGAAAGG + Intergenic
980310370 4:131121263-131121285 TTGAATGACAGTAAAATGGAAGG + Intergenic
981102868 4:140849724-140849746 CAGCATTTCAGAAAACAGGATGG + Intergenic
981978003 4:150754941-150754963 TTGCACGTAAGTAAACAGTGTGG - Intronic
983911407 4:173243684-173243706 CTGCATGTCATTAAATCGGAAGG - Intronic
984023895 4:174520216-174520238 TGGGATGTCAGAAAACAAGATGG - Intronic
985348526 4:189033549-189033571 TTGTATGTCAGGTTACAGGACGG - Intergenic
986679753 5:10222090-10222112 TAGCATGTCCAAAAACAGGAAGG + Intergenic
987320818 5:16767539-16767561 TTCCAAATCAGAAAACAGGAAGG - Intronic
987989206 5:25189629-25189651 TTGCCTCGCTGTAAACAGGATGG + Intergenic
990783320 5:59391769-59391791 TAGCATGTGAGCAAACATGAAGG - Intronic
990813120 5:59751211-59751233 TTGCAATTCAGTAAGAAGGAAGG + Intronic
996059975 5:119022479-119022501 ATGCGTGTAAGTAAAGAGGAAGG + Intergenic
997426498 5:133806455-133806477 ATGCATGTCAGTAAACAAAAGGG + Intergenic
998397205 5:141826372-141826394 TTGCTTGCAAATAAACAGGAGGG - Intergenic
1000153929 5:158532056-158532078 ATGCATGTCCTTAAACTGGAAGG + Intergenic
1000899389 5:166894552-166894574 TTGCATGATAGTCTACAGGATGG - Intergenic
1002093231 5:176816935-176816957 TTGCATGACAAGAAACAGAAAGG - Intronic
1003539626 6:7007038-7007060 TTGTAGGTCATGAAACAGGAAGG - Intergenic
1004291147 6:14368638-14368660 TTGCTTGTCAGCCATCAGGATGG - Intergenic
1004350608 6:14887345-14887367 TTGCTTTTCTGTAAAAAGGAGGG - Intergenic
1004371582 6:15057240-15057262 TTGCATCTCAGAGAACAGGAAGG + Intergenic
1004790054 6:19015492-19015514 TTCCATTTCAGAAAAGAGGAAGG - Intergenic
1005867455 6:29946900-29946922 TTGCAGGTCACTGAAAAGGAGGG - Intergenic
1006583175 6:35088266-35088288 TTGGATGGCAGGAGACAGGAAGG + Intronic
1007509615 6:42365007-42365029 ATGCAGGTCAGCACACAGGAGGG + Intronic
1008522201 6:52373019-52373041 TAGCATGGCAGTAAACAAGATGG - Intronic
1010275584 6:73965192-73965214 TTGCATGAGAAGAAACAGGATGG + Intergenic
1015118860 6:129679645-129679667 TTACATGTAAGTAAACAACAGGG + Intronic
1017029455 6:150207955-150207977 TAGCATGGCAGAAAACTGGAAGG + Intronic
1017048163 6:150366396-150366418 TTGCAAGTCACCAAACATGATGG + Intergenic
1017958451 6:159200051-159200073 TTTCAGCTCTGTAAACAGGACGG - Exonic
1019416198 7:927559-927581 TCACATGGCAGTAAACAGGGAGG + Intronic
1021063016 7:16137219-16137241 TTCCATGTGAGTAAATAGGCAGG + Intronic
1022087836 7:27086453-27086475 GTTCATGAAAGTAAACAGGAAGG + Intergenic
1026425223 7:70284900-70284922 CTGCATCTCAGAAAGCAGGAAGG - Intronic
1028101150 7:86822552-86822574 TTGCATGTGAGCAAAGAGGAAGG + Intronic
1028870532 7:95766717-95766739 TTGTATCTCAGGAAATAGGAAGG - Intergenic
1029318503 7:99736193-99736215 CTGCATGTCTGGAAACAGTAGGG + Intergenic
1033387238 7:140889876-140889898 TAGCATGGCAGTTAACAGCATGG + Intronic
1035421481 7:158732454-158732476 TCGCATGTCATTCAGCAGGAGGG + Exonic
1036975026 8:13401227-13401249 TTGTTTATCATTAAACAGGAAGG - Intronic
1037195451 8:16183221-16183243 TTGCATTTCAGTAAAAATGGAGG - Intronic
1040839902 8:51773587-51773609 TTCCATCTCAGGAAACAAGAAGG + Intronic
1041169744 8:55129446-55129468 TTGCAGGTTAGTAAAGAGAATGG - Intronic
1043157830 8:76807455-76807477 TTGCATGTCAGTAAATGAGTAGG + Intronic
1044918079 8:97137376-97137398 GTGGATGTCAGGAAACAGGAAGG - Intronic
1045649312 8:104327668-104327690 TTGCATTTCTGAAAACTGGATGG - Intergenic
1045941178 8:107739932-107739954 TTGCATTTCAGACAGCAGGATGG + Intergenic
1046100057 8:109603682-109603704 TTGCATGGCAGTAAAAACAAGGG + Intronic
1046144583 8:110141476-110141498 TTACATGGCAGTAGACAAGAAGG - Intergenic
1047042517 8:121012480-121012502 TTGAATGTTTGGAAACAGGAAGG - Intergenic
1048512134 8:135072431-135072453 CTACATGTGGGTAAACAGGAAGG + Intergenic
1048886770 8:138915202-138915224 GTGCTTGTCAGTTACCAGGAGGG + Intergenic
1050334151 9:4574569-4574591 TTGGAAGCCATTAAACAGGAAGG + Intronic
1050496469 9:6247511-6247533 TTTCTTGTGAGTAAATAGGAAGG - Intronic
1051133760 9:13894159-13894181 TGGCATGTGTGTAAGCAGGAAGG + Intergenic
1051454265 9:17235916-17235938 TTGCATGTGAGAAAACTGTATGG - Intronic
1052248457 9:26367887-26367909 TTGAATGTCAGTAAACAAGAGGG + Intergenic
1052776196 9:32735431-32735453 TTGCTTGTCGGGAAACCGGATGG + Intergenic
1055677747 9:78682523-78682545 TAAAATGTTAGTAAACAGGAAGG + Intergenic
1056814203 9:89789816-89789838 TTGCATTTCAGGCAGCAGGAAGG + Intergenic
1057925958 9:99149270-99149292 TCGCAACTCAGTCAACAGGAAGG + Exonic
1060108294 9:120888586-120888608 TGCCATCTCTGTAAACAGGATGG + Intronic
1185728879 X:2445255-2445277 TTGCATGTCAGAAAAAGGAAAGG + Intronic
1186237859 X:7532772-7532794 TTAAATGTGAGTAACCAGGACGG + Intergenic
1187673831 X:21695911-21695933 TTGCAAGTATGTATACAGGAAGG + Intergenic
1187996833 X:24935721-24935743 TGGCATGTTAGGAAACAAGAGGG - Intronic
1189658360 X:43270691-43270713 TTGCATTTCAGGTAGCAGGAAGG + Intergenic
1190298893 X:49044522-49044544 TGGGATGTCAGGAAAGAGGAAGG - Intergenic
1190955126 X:55185774-55185796 TTGTATGCCAGTAAACAGGATGG - Intronic
1192620863 X:72678858-72678880 TTGCAGGCCACTATACAGGAAGG + Intronic
1195411532 X:104571757-104571779 TTGCAGGTGAGTACACAGCACGG + Intronic
1195881162 X:109593952-109593974 TAGCATGTCAGAAAACATGAAGG + Intergenic
1196065676 X:111461649-111461671 TTGCATGACAGGAGACAGGCTGG - Intergenic
1197129796 X:122992058-122992080 TTACAGGTCAATAAATAGGAGGG - Intergenic
1197529218 X:127602057-127602079 TTGTATCTCAGAAAATAGGAAGG - Intergenic
1198736528 X:139791921-139791943 CTTTATGTCAGGAAACAGGAAGG - Intronic