ID: 1184065092

View in Genome Browser
Species Human (GRCh38)
Location 22:42114050-42114072
Sequence CCATAGATGTGGAGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184065074_1184065092 29 Left 1184065074 22:42113998-42114020 CCCCCCTGTCCTTGTGGCACCTC No data
Right 1184065092 22:42114050-42114072 CCATAGATGTGGAGGGAAATGGG No data
1184065080_1184065092 20 Left 1184065080 22:42114007-42114029 CCTTGTGGCACCTCTTTTAAGGG No data
Right 1184065092 22:42114050-42114072 CCATAGATGTGGAGGGAAATGGG No data
1184065077_1184065092 26 Left 1184065077 22:42114001-42114023 CCCTGTCCTTGTGGCACCTCTTT No data
Right 1184065092 22:42114050-42114072 CCATAGATGTGGAGGGAAATGGG No data
1184065078_1184065092 25 Left 1184065078 22:42114002-42114024 CCTGTCCTTGTGGCACCTCTTTT No data
Right 1184065092 22:42114050-42114072 CCATAGATGTGGAGGGAAATGGG No data
1184065076_1184065092 27 Left 1184065076 22:42114000-42114022 CCCCTGTCCTTGTGGCACCTCTT No data
Right 1184065092 22:42114050-42114072 CCATAGATGTGGAGGGAAATGGG No data
1184065075_1184065092 28 Left 1184065075 22:42113999-42114021 CCCCCTGTCCTTGTGGCACCTCT No data
Right 1184065092 22:42114050-42114072 CCATAGATGTGGAGGGAAATGGG No data
1184065083_1184065092 10 Left 1184065083 22:42114017-42114039 CCTCTTTTAAGGGGAAGAGAGTT No data
Right 1184065092 22:42114050-42114072 CCATAGATGTGGAGGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184065092 Original CRISPR CCATAGATGTGGAGGGAAAT GGG Intergenic
No off target data available for this crispr