ID: 1184072506

View in Genome Browser
Species Human (GRCh38)
Location 22:42154769-42154791
Sequence CAGCAAACATGGGTGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184072506_1184072522 21 Left 1184072506 22:42154769-42154791 CCACCCACCACCCATGTTTGCTG No data
Right 1184072522 22:42154813-42154835 CTCCTCCCTCACCTGGTTGAAGG No data
1184072506_1184072518 -4 Left 1184072506 22:42154769-42154791 CCACCCACCACCCATGTTTGCTG No data
Right 1184072518 22:42154788-42154810 GCTGGTGGTGGGGGATCCTCAGG No data
1184072506_1184072520 14 Left 1184072506 22:42154769-42154791 CCACCCACCACCCATGTTTGCTG No data
Right 1184072520 22:42154806-42154828 TCAGGACCTCCTCCCTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184072506 Original CRISPR CAGCAAACATGGGTGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr