ID: 1184074166

View in Genome Browser
Species Human (GRCh38)
Location 22:42165507-42165529
Sequence CCCTTGGCACAAAGAGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 227}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184074156_1184074166 13 Left 1184074156 22:42165471-42165493 CCCTGCCAACCAATGACACAAGC 0: 1
1: 0
2: 1
3: 6
4: 119
Right 1184074166 22:42165507-42165529 CCCTTGGCACAAAGAGACAGTGG 0: 1
1: 0
2: 0
3: 18
4: 227
1184074160_1184074166 4 Left 1184074160 22:42165480-42165502 CCAATGACACAAGCCAGCAAGGC 0: 1
1: 0
2: 0
3: 4
4: 152
Right 1184074166 22:42165507-42165529 CCCTTGGCACAAAGAGACAGTGG 0: 1
1: 0
2: 0
3: 18
4: 227
1184074157_1184074166 12 Left 1184074157 22:42165472-42165494 CCTGCCAACCAATGACACAAGCC 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1184074166 22:42165507-42165529 CCCTTGGCACAAAGAGACAGTGG 0: 1
1: 0
2: 0
3: 18
4: 227
1184074158_1184074166 8 Left 1184074158 22:42165476-42165498 CCAACCAATGACACAAGCCAGCA 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1184074166 22:42165507-42165529 CCCTTGGCACAAAGAGACAGTGG 0: 1
1: 0
2: 0
3: 18
4: 227
1184074162_1184074166 -9 Left 1184074162 22:42165493-42165515 CCAGCAAGGCAACCCCCTTGGCA 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1184074166 22:42165507-42165529 CCCTTGGCACAAAGAGACAGTGG 0: 1
1: 0
2: 0
3: 18
4: 227
1184074155_1184074166 26 Left 1184074155 22:42165458-42165480 CCACTGTCAAAAGCCCTGCCAAC 0: 1
1: 0
2: 0
3: 16
4: 163
Right 1184074166 22:42165507-42165529 CCCTTGGCACAAAGAGACAGTGG 0: 1
1: 0
2: 0
3: 18
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184074166 Original CRISPR CCCTTGGCACAAAGAGACAG TGG Intronic
901594892 1:10377147-10377169 GCCATGGCAAAAAGAGACAGAGG - Exonic
904901666 1:33862543-33862565 CCCTTGGGAGAAAGAGCCAGGGG + Intronic
905231339 1:36516479-36516501 CCATTGGGAGAAAGAGACAAAGG + Intergenic
905297914 1:36966082-36966104 CCCATGGTCCCAAGAGACAGGGG + Intronic
906939752 1:50245766-50245788 CCCTTAGCATAAAGAGATTGGGG + Intergenic
908230054 1:62095573-62095595 TCCTTGCCACAATGAGGCAGGGG - Intronic
908417581 1:63928362-63928384 CCATTGGCACTCAGAGACTGGGG + Intronic
908834280 1:68213105-68213127 CCCTTGGCAAATAAAAACAGAGG - Intronic
910296441 1:85650682-85650704 CTCTTGGTACAAAGTGAAAGGGG + Intronic
911044604 1:93617990-93618012 ACCTTCCCACAAAGAGCCAGAGG + Intronic
911687408 1:100792987-100793009 CCCTTGGACCAGAGAGAAAGAGG + Intergenic
914238410 1:145833426-145833448 CCATTGGCACATAGAGCCAGGGG + Intronic
915599627 1:156914046-156914068 CCCCAGCCACAGAGAGACAGTGG + Exonic
916337077 1:163684947-163684969 GCCTTGTCACAAAGAGAGATTGG - Intergenic
916525490 1:165605315-165605337 CCTGTGGCACAAGGAGAGAGAGG + Intergenic
919405306 1:197173787-197173809 CCATGGGCACATAGAGAAAGAGG + Intronic
919779928 1:201215193-201215215 CACCTGGTACAAAGAGACTGTGG - Intronic
919866432 1:201786538-201786560 CCCTTTGCACTCAGAGACATGGG - Exonic
920183981 1:204149303-204149325 TCCTTGACAAACAGAGACAGAGG + Intronic
922062159 1:222103280-222103302 CCCTTGACCCAGAGACACAGAGG + Intergenic
922299484 1:224284457-224284479 CACTTGACCCAAAGAGGCAGAGG - Intronic
1063474796 10:6318724-6318746 CCCTTTACACAAAGTGTCAGAGG - Intergenic
1063588369 10:7373265-7373287 CTCTTGGCAGAAAGAGGAAGGGG - Intronic
1063807149 10:9658578-9658600 AACTTGGCACACAGAGAAAGAGG + Intergenic
1063849328 10:10166786-10166808 ACCCTCCCACAAAGAGACAGAGG - Intergenic
1067437379 10:46287554-46287576 CCCTAGTGAAAAAGAGACAGTGG - Intronic
1068630671 10:59294341-59294363 CCAATGGGACAAAGGGACAGAGG + Intronic
1068949898 10:62766382-62766404 TCCTTGGCACACAGAATCAGTGG - Intergenic
1069632327 10:69904497-69904519 CCATGGGCAGAAGGAGACAGAGG + Intronic
1069716013 10:70521836-70521858 TCCTTGGCACAAAAAAAAAGAGG - Intronic
1070167240 10:73908036-73908058 CCCTTGAGACACAGAGGCAGGGG + Intergenic
1070348279 10:75566749-75566771 ACCTTGGGAGAAAGAGAAAGTGG - Intronic
1071052915 10:81473312-81473334 CCCTTGGCACAAAGAACTTGGGG + Intergenic
1071524286 10:86349189-86349211 CCCTGGCCAGAAAGAGGCAGTGG + Intronic
1072294760 10:93998340-93998362 CCCTGGCTGCAAAGAGACAGGGG - Intronic
1072610510 10:97014458-97014480 TCCTTGGCACAAAGTGATAAGGG + Intronic
1073960703 10:108924249-108924271 CCCTTGACATAAAGAGATAGTGG + Intergenic
1075253110 10:120900042-120900064 CCCTTGGAACAAGGAGATAGGGG - Exonic
1075903326 10:126060998-126061020 CTCAGGGCACAAAGGGACAGTGG - Intronic
1076008176 10:126964862-126964884 CCCTCTGCAAAAAGATACAGAGG - Intronic
1077067242 11:647626-647648 CCCTCAGCCCAAAGAGAGAGGGG + Intronic
1077341201 11:2027152-2027174 CCCTGGGCAGAGGGAGACAGGGG + Intergenic
1077413070 11:2412452-2412474 CCCTGGGCACAAAGAGGCCCTGG - Intronic
1078329239 11:10405827-10405849 CCCTTGGCACACAGAGGGAAAGG - Intronic
1078443971 11:11390386-11390408 TCCTTGGGGCAAAGACACAGGGG + Intronic
1079789143 11:24713770-24713792 CCCTTGAACCCAAGAGACAGAGG - Intronic
1080313317 11:30920158-30920180 CATGTGGCAGAAAGAGACAGTGG + Intronic
1084491311 11:69480133-69480155 CCCTGGGCACCAAGACAAAGAGG + Intergenic
1084532911 11:69739591-69739613 CCCATTTCATAAAGAGACAGAGG + Intergenic
1084545268 11:69812233-69812255 CCCGTGGCAGAGAGAGAGAGTGG + Intronic
1084700594 11:70784136-70784158 CACTTGGCACAAAGAGGCCTCGG + Intronic
1084720547 11:70902851-70902873 CCCTTGGCACTCAGAGCCACAGG + Intronic
1085532893 11:77202279-77202301 GCCTAGGGACCAAGAGACAGGGG - Exonic
1085846565 11:80072762-80072784 CCCTTGGCACATAGCCCCAGGGG + Intergenic
1085848543 11:80094301-80094323 CCCTTGAACCCAAGAGACAGGGG - Intergenic
1087159399 11:94934447-94934469 TCCTTGGCTCAAAAAGCCAGAGG + Intergenic
1089203738 11:116741386-116741408 CCCCTGGCAAAAAGAGACAAGGG + Intergenic
1089282307 11:117382868-117382890 CCCTGGGCAGGAAGAGGCAGAGG + Exonic
1202824186 11_KI270721v1_random:82341-82363 CCCTGGGCAGAGGGAGACAGGGG + Intergenic
1091682102 12:2534454-2534476 CTCTCGGCACAGAGAGAGAGGGG - Intronic
1093361951 12:18239720-18239742 CCTGTGGCACAAACAGAAAGGGG - Intronic
1093824859 12:23671558-23671580 CCATTAGCAAAAAGAGACATGGG + Intronic
1095985640 12:47997706-47997728 CCCTTGGCATAAAGAGAAAAAGG + Exonic
1096749962 12:53752196-53752218 ACCCAGGCAGAAAGAGACAGAGG - Intergenic
1096887098 12:54728948-54728970 CGCTTGAAACCAAGAGACAGAGG + Intergenic
1102573969 12:113844383-113844405 GCCTTGGCAGGAAGAGACAGAGG - Intronic
1106748700 13:32733927-32733949 CCATTGGCATAAGGAGAGAGAGG - Intronic
1106885848 13:34183368-34183390 CCCCTGGGAGAAAGAGAGAGTGG - Intergenic
1112175812 13:97022930-97022952 CACTTGGCACAAAATGACAGAGG + Intergenic
1113706855 13:112440641-112440663 CTGTTGGCACATAGGGACAGAGG - Intergenic
1113984067 13:114299797-114299819 CCCTGGGCACCAGGAGACTGTGG - Intronic
1115436955 14:33385820-33385842 ACCATGGCATGAAGAGACAGAGG + Intronic
1117162366 14:53002059-53002081 CCCTAGGCCCAAAGGGACAAGGG + Intergenic
1118803447 14:69212670-69212692 CCATTGGAACCAAGTGACAGTGG - Intronic
1120516676 14:85479401-85479423 CCCCTAGCACAGAGAGACTGTGG + Intergenic
1120551753 14:85881190-85881212 CCCATGGGACAAAGAGGCAGAGG - Intergenic
1121528785 14:94638234-94638256 CCCTTGGCAAAAACCAACAGAGG - Intergenic
1122981635 14:105194814-105194836 CCCTTGGCATAAGGAGCCAGAGG - Intergenic
1124647773 15:31451380-31451402 CACTAGGCCCAAAGACACAGTGG - Intergenic
1129371093 15:75096139-75096161 GCATTGGCACAGAGGGACAGAGG - Intronic
1129519441 15:76176625-76176647 CCCTGGGCACAGAGAGCCACAGG - Intronic
1129594632 15:76952702-76952724 CGCTTGACCCCAAGAGACAGAGG - Intronic
1130061238 15:80571684-80571706 CCCTAGGGCCAAAGGGACAGGGG - Intronic
1131167733 15:90154612-90154634 CCCTTGGAAGATAGAGGCAGGGG + Intergenic
1132497116 16:269140-269162 CCCTGGGCACAAGGGGACACTGG + Exonic
1133592421 16:7258466-7258488 CCCTTGACAGAGAGAGAGAGAGG - Intronic
1133689079 16:8195735-8195757 CCTCTGAAACAAAGAGACAGAGG - Intergenic
1135544317 16:23355520-23355542 GCCCTGGCACCGAGAGACAGTGG + Intronic
1137625133 16:49903005-49903027 CCCTTCACACAAACAGCCAGTGG - Intergenic
1138075358 16:54037020-54037042 CACGTGGCCCAAAGATACAGTGG - Intronic
1139613432 16:68074983-68075005 CCCATGGGAGGAAGAGACAGAGG - Intronic
1143210032 17:5179214-5179236 CCCAAGGCACAGAGAGAGAGAGG - Intergenic
1145959557 17:28879536-28879558 CCATTGGAGCAAGGAGACAGAGG + Exonic
1149594730 17:57857996-57858018 GCCTTAGGCCAAAGAGACAGAGG - Intergenic
1150350891 17:64443592-64443614 CACTGGGCAGACAGAGACAGTGG + Intergenic
1151522330 17:74639273-74639295 TTCTGGGCACCAAGAGACAGAGG - Intergenic
1152649084 17:81483686-81483708 CACTTGACATAAAGGGACAGAGG - Intergenic
1156299547 18:35824293-35824315 CCCGTGGCCCACAGAGACATAGG + Intergenic
1156641642 18:39108000-39108022 CCCTTGGCACATGGAGATTGTGG - Intergenic
1158451541 18:57570418-57570440 CCCATGGCACAAAGTAACAAAGG - Intronic
1158896269 18:61916582-61916604 ACCTTGGCTCAGAGACACAGTGG - Intergenic
1159391758 18:67802535-67802557 CCATGTGCAGAAAGAGACAGAGG + Intergenic
1159482069 18:69002249-69002271 CCAATGGCGCAAAGTGACAGAGG + Intronic
1159964368 18:74581105-74581127 TCCTGGTCACAAAGAGACTGGGG + Intronic
1161605790 19:5214251-5214273 CCCATGGGACAGAGAGAAAGCGG - Intronic
1162029942 19:7912963-7912985 CCCATGGCGCAATGAGTCAGTGG + Exonic
1162399494 19:10436229-10436251 CCCATGGCATAAGGAGACAAGGG - Intronic
1163496606 19:17649581-17649603 CCCTGGGCTGAAAGACACAGAGG + Exonic
1165755513 19:38290561-38290583 CCCTTGGCTCAAAGGGTAAGTGG + Exonic
1166536134 19:43575983-43576005 CCCTTGGCCCCAGGAGACAGGGG - Exonic
925096096 2:1204604-1204626 CCCTTATCACAAGGAGACGGAGG + Intronic
925455630 2:4014354-4014376 CACATGGCAGAGAGAGACAGAGG + Intergenic
925644985 2:6026661-6026683 CCCTTGGCAAACACAGACAGAGG - Intergenic
925976601 2:9146274-9146296 CCCCAGGCACAAAGAGACCCGGG + Intergenic
926161634 2:10494084-10494106 CCCTTGGCACAATAAGACTGTGG + Intergenic
926220161 2:10931020-10931042 CCCTTGGCCCAAACAGATGGTGG - Intergenic
928256872 2:29730260-29730282 CCCTCAGCACAAGTAGACAGAGG + Intronic
929908786 2:46070820-46070842 CATTTGACACAAAGATACAGAGG - Intronic
932423905 2:71617257-71617279 CTCTGGTCACAAAGAGACAAGGG + Intronic
932930979 2:76038275-76038297 CCTATGGCAGAAAAAGACAGGGG - Intergenic
933202911 2:79471427-79471449 CCCATGGAAGAAAGAGACTGAGG + Intronic
933805780 2:85997304-85997326 GCCTTGGCCCAAGGAGACATGGG - Intergenic
933897617 2:86825481-86825503 CCCCAGGCACACAAAGACAGAGG + Intronic
934558869 2:95301995-95302017 CCCTGGGCACAGACAGACATAGG - Intronic
934920874 2:98344352-98344374 CCCATGGCACTAAGAGACCAAGG - Intronic
936538727 2:113332968-113332990 CAGTTGGCACAAACAGACTGAGG + Intergenic
936993936 2:118394189-118394211 CCCCTTGCACAAGGAGGCAGAGG - Intergenic
937222178 2:120347958-120347980 CCGGTGGCACAAAATGACAGCGG + Intronic
937254548 2:120546049-120546071 GCCCTGGGACAAAGACACAGTGG + Intergenic
938489626 2:131754862-131754884 CCCTTGGCACAAAGCGGCCGAGG - Intronic
940787796 2:158001049-158001071 CTCTTGGCACAGAGAAACAAAGG - Intronic
942106962 2:172642720-172642742 ACCTTGGCACAAAGTGCCTGAGG - Intergenic
945019392 2:205556077-205556099 CTCCTGGCAAAAGGAGACAGCGG - Intronic
946069171 2:217016565-217016587 CCCTTAGCAAAAAGCTACAGGGG - Intergenic
948280987 2:236747942-236747964 CCCTTGGCACACAGATCCACTGG + Intergenic
1171538822 20:25926713-25926735 TCCTTGGAAAAAGGAGACAGAGG + Intergenic
1174452617 20:50629319-50629341 CCGTTGGCTCAGACAGACAGAGG + Intronic
1174843057 20:53917770-53917792 CCTTTGGGACAAAGATTCAGTGG + Intergenic
1175303287 20:57958241-57958263 CCTTTTGAACAAAGAGAGAGAGG - Intergenic
1175925523 20:62469451-62469473 CCCTTAGCACACACAGATAGGGG + Intronic
1176266065 20:64209967-64209989 CCATGGGCACAAAGAGACACAGG + Intronic
1177207714 21:18029677-18029699 CACTTCCCACAAAGAGACAAAGG + Intronic
1177856415 21:26405338-26405360 CCTTTCTCACAAGGAGACAGAGG + Intergenic
1179244968 21:39625166-39625188 CCTATGGCACAAAAAGCCAGGGG + Intronic
1179292402 21:40030210-40030232 CGCATGGCAAAAAAAGACAGAGG - Intronic
1180116002 21:45705436-45705458 CCCTGTGCACATAGAGACAAGGG + Intronic
1181707633 22:24658502-24658524 GCCTGGGCACAAAGGGAGAGAGG + Intergenic
1183464421 22:37972586-37972608 CCCTTGGCTCCAGGAGACACAGG - Exonic
1184074166 22:42165507-42165529 CCCTTGGCACAAAGAGACAGTGG + Intronic
1184912988 22:47548445-47548467 CTGTTGGCAGAAAGGGACAGGGG + Intergenic
950143622 3:10632632-10632654 GCCTTGCCACAAAGGGACACTGG + Intronic
951114453 3:18843742-18843764 CCTTTGGATCAAAGAGTCAGGGG + Intergenic
952494361 3:33902876-33902898 CCCTTAACACAAAGAGATATGGG + Intergenic
954155064 3:48680857-48680879 ACCTTGGCAGTAAGAGACATGGG - Intronic
954639772 3:52090934-52090956 CCCATGGGACAGACAGACAGAGG + Intronic
955651375 3:61197789-61197811 CCCATGACACAAAGAGACCAGGG + Intronic
955913698 3:63884731-63884753 CCCTTGAGCCCAAGAGACAGAGG - Intronic
958568347 3:95845787-95845809 CTCTTGGCACAAAGAGCCCAAGG - Intergenic
962684088 3:137829843-137829865 CCCATGGCAGAAGGTGACAGGGG + Intergenic
964513241 3:157476712-157476734 CCCTTGACACAAAGAACCTGAGG - Intronic
968360860 3:198145689-198145711 CGCATGGCCCAAAGAGACAATGG - Intergenic
969545753 4:7826466-7826488 CCCAAGGCACAAAAAGCCAGAGG + Intronic
969640286 4:8394170-8394192 GCCTCGGCATAAAGAGACATCGG - Intronic
971867959 4:32196874-32196896 ACCTTGGGATAAAGAGACAGGGG + Intergenic
973994279 4:56440802-56440824 CCCTTGGCACATGGATACACCGG + Intronic
975370942 4:73586808-73586830 CCCATGGCATAAAGAGAAAAGGG + Intronic
975512109 4:75205520-75205542 CCCTTGGTACAAACATACACGGG + Intergenic
979453700 4:120902836-120902858 ACCTTTGGACAAAGAGAGAGAGG + Intronic
979648996 4:123107685-123107707 TCCTTGGCACAAACAGCCTGGGG - Intronic
984134298 4:175916312-175916334 CCCTTGGCTAAGAGAGTCAGGGG - Intronic
986264008 5:6176930-6176952 CCATGGGCAGAAAGAGACAAAGG + Intergenic
986447388 5:7833191-7833213 TTCTTGGCACAAAAAGATAGAGG + Intronic
987708660 5:21483873-21483895 GCCTGGGCACAAAGGGAGAGAGG + Intergenic
988750949 5:34190272-34190294 GCCTGGGCACAAAGGGAGAGAGG - Intergenic
991736088 5:69632196-69632218 GCCTGGGCACAAAGGGAGAGGGG - Intergenic
991739218 5:69653484-69653506 GCCTGGGCACAAAGGGAGAGGGG - Intergenic
991758980 5:69902947-69902969 GCCTGGGCACAAAGGGAGAGGGG + Intergenic
991788356 5:70215175-70215197 GCCTGGGCACAAAGGGAGAGGGG - Intergenic
991790793 5:70233225-70233247 GCCTGGGCACAAAGGGAGAGGGG - Intergenic
991812588 5:70487835-70487857 GCCTGGGCACAAAGGGAGAGGGG - Intergenic
991815545 5:70508312-70508334 GCCTGGGCACAAAGGGAGAGGGG - Intergenic
991818679 5:70529601-70529623 GCCTGGGCACAAAGGGAGAGGGG - Intergenic
991838209 5:70778013-70778035 GCCTGGGCACAAAGGGAGAGGGG + Intergenic
991880803 5:71215539-71215561 GCCTGGGCACAAAGGGAGAGGGG - Intergenic
991883240 5:71233560-71233582 GCCTGGGCACAAAGGGAGAGGGG - Intergenic
992150399 5:73896836-73896858 CCCCTGGCACACCGTGACAGAGG + Intronic
994420721 5:99524899-99524921 GCCTGGGCACAAAGGGAGAGAGG + Intergenic
994420793 5:99525223-99525245 GCCTGGGCACAAAGGGAGAGAGG + Intergenic
994486250 5:100389091-100389113 GCCTGGGCACAAAGGGAGAGAGG - Intergenic
994486322 5:100389415-100389437 GCCTGGGCACAAAGGGAGAGAGG - Intergenic
997884848 5:137620916-137620938 CCCTTGGCACTTTGTGACAGTGG - Exonic
999931089 5:156433508-156433530 GCGGAGGCACAAAGAGACAGGGG - Intronic
1000751685 5:165102846-165102868 CCCCTGGAACACAGAGGCAGGGG - Intergenic
1002163276 5:177329680-177329702 CCTTTGGCAGGAGGAGACAGAGG + Intergenic
1004791941 6:19036176-19036198 CCCTTCTCACTAAGAAACAGGGG - Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1005759418 6:28954110-28954132 CCCCTGGCAAACAAAGACAGTGG - Intergenic
1007491043 6:42222243-42222265 CCCTTGGACCCAAGAGGCAGAGG - Intergenic
1009019839 6:57938011-57938033 GCCTGGGCACAAAGGGAGAGAGG - Intergenic
1009059066 6:58375443-58375465 GCCATGGCTCAAAGAGACACAGG - Intergenic
1009231780 6:61071680-61071702 GCCATGGCTCAAAGAGACACAGG + Intergenic
1011546900 6:88491411-88491433 CCTCTGACACAAAGAGACAAAGG - Intergenic
1015685196 6:135851096-135851118 CCCATGGCACAAACTGACACAGG + Intergenic
1023286734 7:38629225-38629247 TGCTTGGCACAAAGAGAAAAGGG - Intronic
1026449401 7:70514243-70514265 TCCTTGGCATAAAGAAACAATGG - Intronic
1027000224 7:74647681-74647703 CACTTGGGACCAAGAGATAGAGG + Intergenic
1028697377 7:93730826-93730848 CCATGTGCACAAAGAGAAAGGGG + Intronic
1029990382 7:104957782-104957804 CCCTTGTTACTAAGTGACAGCGG - Intergenic
1030220221 7:107090582-107090604 CCTTTGGCAAAGAAAGACAGAGG - Intronic
1033605876 7:142928323-142928345 CCCTTGAGACAGACAGACAGTGG + Intronic
1033672888 7:143510709-143510731 CCCTTGAACCCAAGAGACAGAGG - Intergenic
1034878043 7:154742681-154742703 CCAGTGGCACGATGAGACAGTGG - Intronic
1037568166 8:20135311-20135333 CCCTTGGCTCAAAGTGGCAGGGG + Intergenic
1039344899 8:36692857-36692879 CCCCTGGCACACAGATAAAGGGG + Intergenic
1039714556 8:40093414-40093436 CCCTTGGCACAGTGAGTCTGGGG + Intergenic
1040414287 8:47182926-47182948 CCCTGGGCACTAAGGGACTGGGG - Intergenic
1040947327 8:52897269-52897291 CTCATGGCAGAAAGAGGCAGGGG + Intergenic
1041135662 8:54755686-54755708 CCCTCTCCCCAAAGAGACAGAGG - Intergenic
1041179412 8:55232155-55232177 CCCTTGGCCACAAGAGCCAGGGG - Intronic
1044130106 8:88511746-88511768 CCCATGGCTCAAAGAGAAAAAGG - Intergenic
1046139078 8:110065974-110065996 CCTTTGGCTTAAGGAGACAGAGG + Intergenic
1046247624 8:111585873-111585895 CCCAAGGCACAAAGATAAAGAGG - Intergenic
1048461768 8:134627047-134627069 CCAATGGCATACAGAGACAGTGG + Intronic
1055712503 9:79078781-79078803 ACCTTGGCAAAAAGAGAAATGGG + Intergenic
1056531606 9:87492990-87493012 CCCTAGGCTCAAAAAGACAAAGG + Intergenic
1060540690 9:124428257-124428279 CCCTTGAGACCAGGAGACAGAGG + Intergenic
1062052818 9:134456266-134456288 CCCCAGGCACAAGGAGGCAGGGG + Intergenic
1062163002 9:135090009-135090031 CCCTGGGAACAAAGAGGCACAGG - Intronic
1062384683 9:136304497-136304519 CCCTTTGCCCACAGTGACAGTGG + Intronic
1062745565 9:138209520-138209542 CGCATGGCCCAAAGAGACAATGG - Intergenic
1185623060 X:1465193-1465215 CCCCTGACACAGAGAGGCAGAGG + Exonic
1185777334 X:2814632-2814654 TCATTTGCACAAAGAGACTGTGG + Intronic
1186122726 X:6381249-6381271 CACGTGCCACATAGAGACAGAGG - Intergenic
1187804466 X:23103726-23103748 CCCTAGGCTGAAAGAGAAAGGGG - Intergenic
1192157585 X:68758118-68758140 ACCATGGCACAAAGACACACAGG + Intergenic
1193031902 X:76907535-76907557 CCCTTGCCAGAAAGAGAAATTGG + Intergenic
1193492258 X:82164432-82164454 CCCTTTGCACAGAAAGACATGGG + Intergenic
1195121813 X:101762150-101762172 CCCTTTGCGCAAAGAGACCTGGG - Intergenic
1195203450 X:102571880-102571902 GCCTTGGCCTTAAGAGACAGTGG + Intergenic
1196344674 X:114639760-114639782 CCATTGGCAAAAATAAACAGCGG + Intronic
1196907183 X:120449230-120449252 CCCCAGGCACAAAGTGACAAAGG + Intronic
1200293116 X:154890087-154890109 CCCTTGACAGAAAGAGTCTGTGG - Intronic
1200339963 X:155385819-155385841 CCCTTGACAGAAAGAGTCTGTGG - Intergenic
1200346507 X:155454869-155454891 CCCTTGACAGAAAGAGTCTGTGG + Intergenic
1200831601 Y:7691737-7691759 TCCTTGCCAGACAGAGACAGAGG + Intergenic
1201705988 Y:16937722-16937744 CCCTTGGACCCAAGAGGCAGAGG - Intergenic