ID: 1184074501

View in Genome Browser
Species Human (GRCh38)
Location 22:42167606-42167628
Sequence TTGGGGTCTCTAGAAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184074501_1184074507 15 Left 1184074501 22:42167606-42167628 CCTGCAGCTTCTAGAGACCCCAA 0: 1
1: 0
2: 0
3: 19
4: 161
Right 1184074507 22:42167644-42167666 TTTCACAGATGCCTGCCAAGAGG 0: 1
1: 0
2: 1
3: 22
4: 200
1184074501_1184074508 16 Left 1184074501 22:42167606-42167628 CCTGCAGCTTCTAGAGACCCCAA 0: 1
1: 0
2: 0
3: 19
4: 161
Right 1184074508 22:42167645-42167667 TTCACAGATGCCTGCCAAGAGGG 0: 1
1: 0
2: 0
3: 11
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184074501 Original CRISPR TTGGGGTCTCTAGAAGCTGC AGG (reversed) Intronic
900990066 1:6094534-6094556 TTGGGGTCTCCATACGCAGCCGG - Intronic
902551510 1:17222316-17222338 TCAGGGTCTCTGGAAGCTCCGGG + Exonic
905103606 1:35547711-35547733 TTGTGGTTTCTAGTAGCTGGGGG + Intronic
907269872 1:53284572-53284594 CTGGGGTCTGTAGAACCTGGAGG - Intronic
907974102 1:59414355-59414377 TTGGGGTATCTAGATGAGGCAGG + Intronic
908773007 1:67613117-67613139 TAGGGGTCTGGAGGAGCTGCTGG + Intergenic
916040037 1:160954038-160954060 TTGGGATCTCCAGAGGCAGCTGG - Intronic
918609688 1:186474352-186474374 TTCTGGTTTCTAGAGGCTGCTGG + Intergenic
919383155 1:196883337-196883359 ATGAGGTCACTAGAATCTGCAGG - Intronic
920199218 1:204249255-204249277 TCTGGGTCCCTAGAAGCTGCTGG - Exonic
920252919 1:204633977-204633999 TTGGGGGCTCTGGGAGCCGCTGG - Intronic
922813294 1:228430439-228430461 TTGGAGCTTCCAGAAGCTGCAGG + Intergenic
923870781 1:237991959-237991981 TTATGGTCTCTAGGAGCTGAGGG + Intergenic
1066230127 10:33424089-33424111 TGGGCATCTCTAGATGCTGCGGG + Intergenic
1069700624 10:70422243-70422265 TTGGGGTCTTTAAAACCAGCAGG + Exonic
1070224822 10:74492322-74492344 TTGTCATCTCTAGAAACTGCTGG + Intronic
1072600451 10:96922047-96922069 TTGGGATCTCTTGAAACTTCAGG + Intronic
1077420686 11:2448542-2448564 TTGGAGTCTGAAGCAGCTGCTGG + Intronic
1078089864 11:8258336-8258358 TTGGGGTCTAGAGCAGATGCAGG - Intronic
1081621817 11:44623194-44623216 CTGGGGTCTTTAGAGGCTGTAGG + Intergenic
1083881680 11:65552011-65552033 TAGGGCTCTCCGGAAGCTGCTGG + Exonic
1085667850 11:78431462-78431484 TTGGTTTCTCTGGAAGCTGAGGG + Intergenic
1085846055 11:80066346-80066368 TTGGGGACTCTTGAAGCTGAGGG + Intergenic
1086831651 11:91573139-91573161 TTGTGGTCTCCAGAAACTTCTGG - Intergenic
1087606469 11:100384040-100384062 TTGGACTCTCTAAAGGCTGCAGG - Intergenic
1090770651 11:129916756-129916778 TTGGGGTTTCTATAAGGTGGAGG - Intronic
1098456607 12:70681390-70681412 TCAGGGTCTGTAGAAACTGCAGG + Intronic
1102928623 12:116845686-116845708 TGGGAATCTGTAGAAGCTGCAGG + Intronic
1104430650 12:128713367-128713389 TGGGGGTCACTAGACCCTGCAGG - Intergenic
1106699790 13:32217107-32217129 TTGGGGACACTGGAAGGTGCAGG - Intronic
1115259819 14:31440569-31440591 TTGTGGTCTTTATAATCTGCAGG - Intronic
1117814010 14:59578393-59578415 TTGGTGGCTCTAGAAGTGGCAGG + Intergenic
1117944152 14:60999784-60999806 TTGCAGTCTCTGGTAGCTGCTGG - Intronic
1121452287 14:94016615-94016637 CTGGAGTCTCCAGAAGGTGCTGG + Intergenic
1122896411 14:104759764-104759786 GTGGGGTCTCTAGGAGCTGGCGG - Intronic
1124238356 15:28008933-28008955 TGGAGGTCTCTAGATTCTGCAGG - Intronic
1124617472 15:31251990-31252012 GTGGGGTCACAAGAACCTGCAGG + Intergenic
1124879224 15:33626139-33626161 TAGGGTTTTCTAGAAGATGCTGG + Intronic
1126852630 15:52806258-52806280 TCGGGGGCGCCAGAAGCTGCGGG - Intergenic
1127800990 15:62477425-62477447 TTGGAGTCTCTTCTAGCTGCAGG + Intronic
1129666558 15:77582555-77582577 TTGGGGTTTCTAGTAGCCTCAGG - Intergenic
1129786659 15:78314346-78314368 GCGGGGTCTCTAGATGCTGAAGG + Intergenic
1131117285 15:89803182-89803204 TTGGGGTCTTGAGATGCTGAAGG - Intronic
1131472160 15:92706861-92706883 TTGGGGTCTTTAGATGCTGTTGG + Intronic
1131999566 15:98165139-98165161 CTGGGGTCTTTAGCAGCTGCAGG - Intergenic
1138119736 16:54390105-54390127 TTGGGGTCGGCGGAAGCTGCAGG - Intergenic
1139449390 16:67017562-67017584 GTGGGGTCTCTAGAAGGCCCCGG - Intergenic
1140831925 16:78759866-78759888 TTCCAGTCTCTAGAGGCTGCTGG + Intronic
1141392252 16:83674663-83674685 TTGGAGTCTCAGGATGCTGCTGG + Intronic
1142219427 16:88846388-88846410 TGGGGGCCACCAGAAGCTGCAGG + Intronic
1143040339 17:4030683-4030705 TGGGGGTCTCTACAAAGTGCTGG + Intronic
1143674426 17:8421495-8421517 TGGTGGCCTCTAGAAGCTGGAGG + Intronic
1143883757 17:10050859-10050881 TTTTGGTTTCTAGAAGCTGCTGG - Intronic
1143893936 17:10122304-10122326 TGAGGGTTTCTAGAAGATGCTGG - Intronic
1144576321 17:16431998-16432020 TTGGGGCCTGTAGGAGCTTCGGG - Exonic
1147644620 17:42026460-42026482 ATGGGGTCTCTAGCTGCAGCAGG - Intronic
1147817002 17:43217498-43217520 TAGGGCTGTCTGGAAGCTGCTGG + Intronic
1149255444 17:54821164-54821186 TTGGAGTCTATAGAGGCAGCAGG - Intergenic
1150382821 17:64734087-64734109 CTGAGGTCTCTAAAAGGTGCTGG - Intergenic
1150773349 17:68060057-68060079 CTGAGGTCTCTACAAGGTGCTGG + Intergenic
1151024261 17:70658728-70658750 TTGGGGTTTCTAGCAGCCCCAGG - Intergenic
1151106358 17:71620808-71620830 TAGGAGTCTCCAGAAGCAGCCGG + Intergenic
1152430951 17:80248079-80248101 TTGGGGCCTCGGGCAGCTGCCGG + Intronic
1154384340 18:13879992-13880014 TAGGGGTCTCTATGAACTGCAGG - Intergenic
1154384556 18:13881104-13881126 TGGGGGCCTCTAGGAACTGCTGG - Intergenic
1154384562 18:13881124-13881146 TGGGGGCCTCTAGGAACTGCTGG - Intergenic
1154384570 18:13881163-13881185 TGGGGGTCTCTGGGAACTGCTGG - Intergenic
1155464651 18:26121025-26121047 TTGGGCTCTCTAAGAACTGCAGG - Intergenic
1157357668 18:46950330-46950352 TAGGGGTCTGGAGAAGCTGGAGG + Intronic
1159910288 18:74139032-74139054 GTGGGGGCTCCAGATGCTGCAGG - Intronic
1162152785 19:8657431-8657453 TTGGGGACTCTGGCTGCTGCAGG + Intergenic
1162370872 19:10278481-10278503 CTGGGGTTTCCAGAAGCTGCTGG - Intronic
1162402651 19:10455103-10455125 TTGGGCTCTATAGAAGCTGGGGG - Intronic
1163372729 19:16910888-16910910 CTGGGGTCCCTGGAAGCTGGAGG + Intronic
1165653525 19:37512032-37512054 TTAGGGATTCTGGAAGCTGCTGG + Intronic
1166777055 19:45319464-45319486 ATGGGGGCTCTGGAGGCTGCCGG - Intronic
932054622 2:68432014-68432036 TTGCAGACTCCAGAAGCTGCAGG + Intergenic
933571695 2:84021600-84021622 TTGGGTTCTCTAGAAGGTATTGG + Intergenic
933880450 2:86664196-86664218 GTGGGGTCTACAGAAGCAGCAGG - Intronic
934976872 2:98808951-98808973 TTTATGTCTCTAGAACCTGCAGG - Intronic
935172939 2:100624761-100624783 CTGGGGTCTCTCAAAGCAGCAGG - Intergenic
935476327 2:103528061-103528083 ATGGGGGCTCCAGAAGCTTCTGG + Intergenic
935856380 2:107279080-107279102 TTGGGATCTTTAGCAGCAGCTGG - Intergenic
937253166 2:120536844-120536866 TTGGGGTCCCTAGGGGCTGGTGG - Intergenic
937495301 2:122412926-122412948 TTGGCATGTCCAGAAGCTGCAGG - Intergenic
937728851 2:125202098-125202120 TTGTGGTCTCCTGGAGCTGCAGG - Intergenic
938541754 2:132288743-132288765 TAGGGGTCCCTGGGAGCTGCAGG - Intergenic
938552713 2:132395656-132395678 TGGGGGTGTCTAGGAGCAGCAGG - Intergenic
941099553 2:161281509-161281531 TGGGGGTCCCTGGGAGCTGCAGG + Intergenic
943918879 2:193676612-193676634 TTGTGGTCTCTGGATGCTGTTGG + Intergenic
1169388596 20:5171386-5171408 CAGGAGCCTCTAGAAGCTGCAGG - Intronic
1169984208 20:11423523-11423545 TTGGTCTCTCTGGGAGCTGCAGG + Intergenic
1171869841 20:30515841-30515863 TAGGGGTCCCTGGGAGCTGCAGG - Intergenic
1171870629 20:30521619-30521641 TAGGGGTCCCTGGGAGCTGCAGG - Intergenic
1172036933 20:32017859-32017881 TGGCGGTGTCTAGCAGCTGCAGG - Exonic
1174254719 20:49246090-49246112 TTGGAGCCTGCAGAAGCTGCTGG + Exonic
1174363066 20:50040430-50040452 TTGGGGTCTCTAGGCACTGGGGG + Intergenic
1175205750 20:57309882-57309904 CTGGGCTCTCTAGGAGCTGGTGG + Intergenic
1176083114 20:63283853-63283875 TTGGGGTCACAAGCAGCAGCCGG + Exonic
1176611764 21:8990515-8990537 TTGGGGTCCCTGGGAGCTTCAGG + Intergenic
1181626617 22:24126463-24126485 TTGGTGTGACTAGAATCTGCTGG + Intronic
1182081320 22:27530920-27530942 TGGGGGTTTCTAGGAGCTGAAGG + Intergenic
1183773671 22:39948332-39948354 TTGGGGTCTTACGAAGCTCCTGG + Intronic
1184074501 22:42167606-42167628 TTGGGGTCTCTAGAAGCTGCAGG - Intronic
1184470596 22:44693488-44693510 TTGGAGTCACCAGAAGCTGAAGG - Intronic
1184940284 22:47759978-47760000 AGGTGGTCTCTAGGAGCTGCAGG + Intergenic
1185372026 22:50465388-50465410 TTGGGGTGTGGAGAAGCTCCTGG - Intronic
950083833 3:10242399-10242421 TTTGTGTCTCTAAAAGCTGAGGG - Exonic
955680813 3:61499692-61499714 TTGGGGTCTTTAGAGGATGGAGG - Intergenic
955769848 3:62375755-62375777 TTCGGGTCTTGAGATGCTGCAGG - Intergenic
956409001 3:68959308-68959330 GTGGGGGCTTAAGAAGCTGCTGG - Intergenic
956580736 3:70809434-70809456 TTGGAGTATCTAGTAACTGCTGG - Intergenic
957795288 3:84996978-84997000 TTGTTGTCTATAGAAGATGCAGG - Intronic
957845086 3:85721692-85721714 TTGGAGACTCTAGGAACTGCAGG + Intronic
959571870 3:107893380-107893402 TTGGGGTTTGTAGAAGTGGCAGG + Intergenic
959710396 3:109380142-109380164 TTGGAGTCCCAAGAAGATGCTGG - Intergenic
960146568 3:114210099-114210121 TTGGGGGTTCTAGATGCTGAAGG + Intergenic
962695617 3:137944558-137944580 TTGGGTTCTCTGGAAGCAGATGG + Intergenic
967358356 3:188599469-188599491 TTGGGGTCTCTAGAAGTCCAGGG + Intronic
968605371 4:1532720-1532742 TGGGGGTCCCTGGAGGCTGCTGG - Intergenic
969404797 4:6983632-6983654 TTGGGGTTTAGAGAAGCAGCAGG + Intronic
971193300 4:24447849-24447871 ATGAAGTCTCTAGATGCTGCAGG - Intergenic
973718718 4:53702544-53702566 CTGGGGTCTCCTGAGGCTGCAGG + Intronic
975493718 4:75015297-75015319 TTGGGGCCTCTTGACCCTGCTGG - Intronic
978761703 4:112360087-112360109 TGGGGGTTACTAGAAGATGCAGG - Intronic
981279201 4:142937605-142937627 TTTAGGTCTCTAGATACTGCAGG - Intergenic
991098572 5:62765876-62765898 TTGGAGCATCCAGAAGCTGCCGG + Intergenic
992787261 5:80182469-80182491 TTGGGGCCTCTGGGAGTTGCTGG - Intronic
999302235 5:150498482-150498504 CTGGGCTTTCTAGGAGCTGCAGG + Intronic
1000377738 5:160599034-160599056 TTGGGACCTCTGGGAGCTGCTGG + Intronic
1000417582 5:160998652-160998674 TTGATCTCTCTAGGAGCTGCAGG + Intergenic
1001298829 5:170518837-170518859 TTGGACTCTCCAGAAGCAGCCGG - Intronic
1002612705 5:180431970-180431992 TTGGTGTCTCCTGAAGCTGCTGG + Intergenic
1003266425 6:4568506-4568528 TGGGGGACTCTGGAAGCTCCTGG - Intergenic
1004348548 6:14870500-14870522 TTTGAGTCTCTAGAGGCTGGTGG - Intergenic
1004743749 6:18489817-18489839 TTAGGGCCTCAAGAAGCTGCAGG + Intergenic
1006787435 6:36678146-36678168 TTGGGGTGTCTAGGTGCTCCAGG + Intronic
1009909353 6:69905853-69905875 TTGGGGGCTTTAGAAGATTCTGG + Intronic
1010442688 6:75916253-75916275 TTAGGGTCTCTAAAAACTGGGGG - Exonic
1014653794 6:124073933-124073955 TTGGGGTCTCTACGAACTCCAGG + Intronic
1014924595 6:127255572-127255594 TTGGAGTCTACAGAAGCAGCAGG - Intergenic
1015373261 6:132480230-132480252 TTCTGTTATCTAGAAGCTGCTGG + Intronic
1015575176 6:134663727-134663749 TTTGGGTTTCTAGAAGATGGTGG - Intergenic
1018907506 6:168084049-168084071 TGGGAGTTGCTAGAAGCTGCAGG - Intergenic
1019948088 7:4346132-4346154 TTGAGGTCTGCAGAAGCTTCAGG + Intergenic
1020104009 7:5412790-5412812 TGGGGGTCCCTGGAAGCTCCTGG - Intronic
1023847776 7:44132402-44132424 TTGGGGGCTCAAGAGGTTGCAGG + Intergenic
1027131072 7:75591853-75591875 CTGGGGTCTCTGGACGCTTCAGG - Intronic
1029707431 7:102283208-102283230 CTGGGGCCTCTGGCAGCTGCTGG - Intronic
1031517471 7:122718913-122718935 TTGGCTTCTCTAGAACCTGCTGG + Intronic
1032463830 7:132131031-132131053 TTGGGGCCTCAAGGAGCTGATGG - Intronic
1034829815 7:154299261-154299283 CTGAGGTCCCTGGAAGCTGCTGG - Intronic
1035103310 7:156419215-156419237 TTGGAGTCTCTGAAAGCTTCTGG + Intergenic
1035945077 8:3953827-3953849 TTAGGCTCTCTAGGAACTGCAGG - Intronic
1035985973 8:4432484-4432506 TTGGGGTGTCTACTAACTGCTGG + Intronic
1037145346 8:15565185-15565207 TTGCAGTTTCTAGAGGCTGCTGG + Intronic
1037931095 8:22880844-22880866 TTGAGGTCTATAGAAGCTCCTGG - Intronic
1038349363 8:26762379-26762401 CTGGGCTCTCTGGAAGCTGTGGG + Intronic
1039421169 8:37442411-37442433 TTGGGGACTCTAGAAGGAGATGG - Intergenic
1040500789 8:48003263-48003285 TTGATTGCTCTAGAAGCTGCTGG + Intergenic
1040594483 8:48824258-48824280 ATGGTGTCTCTAGCAGCTGCAGG - Intergenic
1043396533 8:79842897-79842919 TTGGGCTCTCCAAAGGCTGCAGG - Intergenic
1048604712 8:135955740-135955762 TTGGAGTCTCTACCAGGTGCTGG + Intergenic
1050222385 9:3408048-3408070 TTGGCGTCTTGAGAAGCTGCAGG - Intronic
1052019166 9:23506527-23506549 TGGTGGTTTCCAGAAGCTGCAGG - Intergenic
1056225076 9:84486794-84486816 TTGTGGTTGCCAGAAGCTGCAGG - Intergenic
1056511025 9:87305851-87305873 TTGGGTTGTTTAGAAGCTGGAGG - Intergenic
1056925121 9:90828064-90828086 TTGGTTTCTCTAGCAGCTGCAGG + Intronic
1058708777 9:107660430-107660452 TTGGGGTTTCCAGGAGCAGCTGG + Intergenic
1062613220 9:137384140-137384162 TGGGGGGCTGTGGAAGCTGCTGG + Intronic
1203568681 Un_KI270744v1:111939-111961 TAGGGGTCTCTGGGAGCTGCAGG - Intergenic
1186446546 X:9635003-9635025 GTGGGGTCTTTCGAGGCTGCAGG + Intronic
1188026933 X:25219772-25219794 GTGCAGTCTCTAGAAACTGCAGG + Intergenic
1188661454 X:32764466-32764488 TGGTGGCCTCTAGAAGCTGGGGG - Intronic
1188681574 X:33014513-33014535 TTGGGGTTACTAGTTGCTGCAGG + Intronic
1189220995 X:39371796-39371818 TTGGCTTCTCTAAAAGCTCCTGG - Intergenic
1193712312 X:84894472-84894494 TTGGGTTCTCCAAAACCTGCAGG + Intergenic
1194298488 X:92156272-92156294 TTGTTGTCTCTTGAAGCTGCTGG + Intronic
1194690193 X:96974902-96974924 TAGGGTTCTCTAGAGGCTTCAGG + Intronic
1198585271 X:138113881-138113903 CTGGGGTCTCTAAAGGCTGCTGG - Intergenic
1200616098 Y:5381233-5381255 TTGTTGTCTCTTGAAGCTGCTGG + Intronic