ID: 1184075925

View in Genome Browser
Species Human (GRCh38)
Location 22:42177908-42177930
Sequence ACTCTTGGTGGTTCCTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184075914_1184075925 26 Left 1184075914 22:42177859-42177881 CCTAAACCCTTGGAATTTCCTGG No data
Right 1184075925 22:42177908-42177930 ACTCTTGGTGGTTCCTGGATGGG No data
1184075917_1184075925 20 Left 1184075917 22:42177865-42177887 CCCTTGGAATTTCCTGGATAGGA No data
Right 1184075925 22:42177908-42177930 ACTCTTGGTGGTTCCTGGATGGG No data
1184075918_1184075925 19 Left 1184075918 22:42177866-42177888 CCTTGGAATTTCCTGGATAGGAG No data
Right 1184075925 22:42177908-42177930 ACTCTTGGTGGTTCCTGGATGGG No data
1184075919_1184075925 8 Left 1184075919 22:42177877-42177899 CCTGGATAGGAGCACTTTTTGTT No data
Right 1184075925 22:42177908-42177930 ACTCTTGGTGGTTCCTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184075925 Original CRISPR ACTCTTGGTGGTTCCTGGAT GGG Intronic