ID: 1184078168

View in Genome Browser
Species Human (GRCh38)
Location 22:42197235-42197257
Sequence TCAAGTAGCCTCCTTGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184078168 Original CRISPR TCAAGTAGCCTCCTTGGTGG AGG (reversed) Intronic
900374912 1:2349284-2349306 TTAAGCAGCCTCCTTGGAGGTGG - Intronic
902401848 1:16162344-16162366 TCAAATTGCCTCCTTGTTGGGGG - Intergenic
904425669 1:30421369-30421391 TCAAATGACCTCCTTGGTGTGGG + Intergenic
905638202 1:39570119-39570141 TCTCTGAGCCTCCTTGGTGGTGG - Intronic
905946001 1:41901942-41901964 TCAAGCATCCTCCTAGGTGCTGG - Intronic
906545559 1:46617042-46617064 TGAGGCTGCCTCCTTGGTGGAGG - Intergenic
906774820 1:48519724-48519746 GCAAGTAGCGTCCATCGTGGGGG - Intergenic
907047136 1:51306155-51306177 TCAGGTAAACTCCCTGGTGGTGG + Intronic
908137324 1:61146574-61146596 TCAGGAAGGCTCCTTGGAGGAGG - Intronic
917087253 1:171316243-171316265 TCAAGTATTCTTATTGGTGGAGG + Exonic
921276864 1:213529290-213529312 GCATGGAGCCTCCATGGTGGTGG + Intergenic
921304308 1:213780619-213780641 TCAAATAGCCTTCATGGTGCTGG - Intergenic
1069717235 10:70529170-70529192 TCAAGCAACCTCCTTGGTCAAGG - Intronic
1070867886 10:79719038-79719060 TCAGGAAGCCTCCATCGTGGTGG + Intergenic
1070919615 10:80176217-80176239 TTAACCAGCCTCATTGGTGGAGG - Intronic
1071634797 10:87241239-87241261 TCAGGAAGCCTCCATCGTGGTGG + Intergenic
1071675448 10:87651466-87651488 TTAAGTATCCTCCTTAGTCGAGG + Intergenic
1076184717 10:128437364-128437386 TCCAATAGCCTCCTTGAAGGAGG - Intergenic
1076329375 10:129653581-129653603 TCACGTGGCCTCCCTGATGGTGG + Intronic
1077007480 11:365118-365140 ACAAGCATCCTCCATGGTGGAGG - Intergenic
1078618001 11:12882717-12882739 CCAAGTAGACCCCTTGGTGCAGG + Intronic
1079096155 11:17511624-17511646 GAAACTAGCCTCCTTGGTCGGGG - Intronic
1084444408 11:69195441-69195463 CCCAGTAGGCTCCTTGGAGGAGG + Intergenic
1085220455 11:74869962-74869984 TGAAGTGGCCTCATTGTTGGGGG - Intronic
1086333598 11:85777967-85777989 AAAAGTAGCCTGCATGGTGGTGG - Intronic
1089341176 11:117758904-117758926 TCAAGTCTCCTCCTCGATGGAGG - Intronic
1099014913 12:77332813-77332835 TGAAGGAGCCACCTTGGTAGAGG + Intergenic
1101968933 12:109299226-109299248 GCAAGAAGCGTCCTTGGGGGCGG - Intronic
1103017095 12:117503493-117503515 TCCTGGAGCCTCCTTGGTCGTGG - Intronic
1111815800 13:93150672-93150694 TCAAGCAGCCTCCTAGGAGGAGG - Intergenic
1112328027 13:98456688-98456710 TCTGGAAGCCTCCTTGGTAGGGG - Intronic
1113343254 13:109447425-109447447 TCCCGTAGCCTGCCTGGTGGTGG + Intergenic
1116390928 14:44388430-44388452 TGAACTAGTCTCCCTGGTGGAGG - Intergenic
1116423676 14:44764021-44764043 TCTATTAGCATCCTTGGAGGGGG - Intergenic
1120860278 14:89249008-89249030 TCAAGTAGCCTGGTTTGTGCAGG - Intronic
1125516840 15:40325351-40325373 ACAAGAAGCCTCTTTGGTGGGGG - Intergenic
1128945336 15:71816125-71816147 TGGAGTAGCCTCCTTGATGCTGG + Intronic
1133465179 16:6020783-6020805 CCAAGTGGCCTCCTGGGCGGTGG - Intronic
1134259468 16:12639324-12639346 TCAAGTAGCCTGCTCATTGGTGG + Intergenic
1140197185 16:72865007-72865029 TAAAATAGCCTCATTGGTAGAGG - Intronic
1146393536 17:32444229-32444251 TCAAGAAGCCTCTTTTGGGGTGG + Intergenic
1149429855 17:56588944-56588966 CCATGTAGCCTCCTGGGTGCTGG - Intergenic
1151268951 17:72978355-72978377 TCAAGGAGCCTACATTGTGGTGG + Intronic
1151453990 17:74215300-74215322 TCAAGAAGACCCCTAGGTGGGGG + Intronic
1152943807 17:83187164-83187186 ACAAGTGTCCTCCTTGGTGGGGG + Intergenic
1157452271 18:47797744-47797766 TCAAGTAGCTTACATGCTGGTGG + Intergenic
1166160672 19:40950529-40950551 TCAAAAAGCCTCCTTGGCGCAGG + Intergenic
925439585 2:3872938-3872960 TCACGTTGCCTCCATGGTGCCGG - Intergenic
931902073 2:66800766-66800788 TCATGGAGCCTCCTTGATGTGGG + Intergenic
934554213 2:95278835-95278857 TCAACAAGCCTCCCTGGTAGGGG - Intronic
936839723 2:116754641-116754663 TAAATTTGTCTCCTTGGTGGAGG + Intergenic
939247711 2:139646431-139646453 TCAAATAGCCCCCATGATGGTGG - Intergenic
942031321 2:171963412-171963434 TCAAGTAGCACTTTTGGTGGCGG - Intronic
948644301 2:239393987-239394009 TCCACTGGCCTCCCTGGTGGTGG - Intronic
1173933777 20:46843982-46844004 TTGAGTAGCCTTCTTGGTTGGGG - Intergenic
1178604634 21:34025080-34025102 TCAAGTGACCTCATGGGTGGTGG + Intergenic
1180986118 22:19904720-19904742 ACAGGGAGCCTCCTTGGTGGAGG + Intronic
1182681384 22:32082610-32082632 TCACTCTGCCTCCTTGGTGGGGG + Intronic
1183848975 22:40567188-40567210 TCAAGCAGCCTTTTTGGAGGTGG - Intronic
1184078168 22:42197235-42197257 TCAAGTAGCCTCCTTGGTGGAGG - Intronic
956898077 3:73684162-73684184 TCACTTTGCCTCCTGGGTGGAGG + Intergenic
961911324 3:130319335-130319357 TGAAGTAGTCTCCCTGGTGAGGG - Intergenic
966213000 3:177471815-177471837 TCAAGAAGCCTCCCTGGAGAAGG + Intergenic
968224775 3:196966875-196966897 TCCAGTAGCCTCCTGGGGGTCGG + Intronic
973819455 4:54650046-54650068 TCAAGTTTCCTGATTGGTGGGGG - Intergenic
979844968 4:125496469-125496491 TCAAGTACCCCCCTAGGTCGTGG + Intergenic
983807771 4:172017138-172017160 TAAGGTAGCCTCCTTGATGAAGG + Intronic
997757057 5:136409225-136409247 TCCAGTAGACTCCCTGCTGGAGG - Intergenic
997866651 5:137469831-137469853 TGAAATAGCCTCTTGGGTGGGGG - Intronic
998449799 5:142225532-142225554 CCCAGAAGCCTTCTTGGTGGAGG - Intergenic
999672665 5:153971440-153971462 TCAAGTAGACTCCAGGGTTGAGG - Intergenic
1006250689 6:32781050-32781072 TCATATAGCTTTCTTGGTGGTGG + Intergenic
1006542039 6:34748024-34748046 TCAAGAATCCTCCTTGGTTGGGG - Intergenic
1007289545 6:40775046-40775068 TCAACTAGACTCCTTGAAGGCGG - Intergenic
1010409054 6:75539911-75539933 TTAAGTCAGCTCCTTGGTGGGGG - Intergenic
1011073319 6:83409608-83409630 TTAATTAGCCTCCTGGGTTGAGG + Intronic
1012465134 6:99509063-99509085 TCAAGTATCTTGATTGGTGGTGG + Intronic
1013796434 6:113894379-113894401 TCAGGTAGCCACCATTGTGGAGG + Intergenic
1013925792 6:115470070-115470092 TCAAGAAAGCTCCCTGGTGGAGG + Intergenic
1014692014 6:124573492-124573514 TTAAGTGGTCTTCTTGGTGGTGG + Intronic
1015804047 6:137090587-137090609 TGAAGATGCCTCCTTGGTGGAGG - Intergenic
1016261301 6:142173999-142174021 TAAAGTAGCGTCTTTGTTGGTGG + Intronic
1023376998 7:39566430-39566452 TCAAGCAGCCTCCTTGATCCAGG + Exonic
1026176467 7:68002001-68002023 TCAGGTAGCATCCCTGGGGGTGG - Intergenic
1026290366 7:69000673-69000695 TCAAGGAGCCTCCCTGGAGAAGG + Intergenic
1034489812 7:151387226-151387248 CCAGGAAGCCTCCTTGGTGCAGG - Intronic
1036622492 8:10433892-10433914 CCAAGTGGCCCCCTTGGAGGTGG + Intergenic
1039449383 8:37659486-37659508 TAAAGTATCCTCCCTGTTGGGGG - Intergenic
1041503341 8:58563931-58563953 TCAGGGAGATTCCTTGGTGGTGG + Intronic
1042993878 8:74671680-74671702 TCAAGTAGTGTGCTTTGTGGTGG + Intronic
1043576591 8:81665935-81665957 TCTAGTAGATTCCTTGGGGGAGG - Intronic
1045332401 8:101166598-101166620 TCAAGCAGATCCCTTGGTGGGGG - Intergenic
1045540129 8:103076201-103076223 TCATGTGGCCTGCTTGGAGGAGG - Intergenic
1048310430 8:133318365-133318387 TCATGTAGCCTTATGGGTGGTGG - Intergenic
1048317340 8:133371894-133371916 TCCAGTAGGCTCTTTGCTGGTGG + Intergenic
1049388984 8:142358529-142358551 TCAGGTGGTCTCTTTGGTGGCGG - Intronic
1050943320 9:11487107-11487129 TCAAGTAGGCTCCATTTTGGGGG - Intergenic
1052904032 9:33817910-33817932 TGAAGTAGCCGCCTTCGTAGAGG - Exonic
1056691400 9:88811526-88811548 TCAAGTTGCCTCATTAGTGGGGG - Intergenic
1059803728 9:117776017-117776039 TCAAGAAGGCTCCATGGAGGAGG - Intergenic
1061602540 9:131680882-131680904 GCAAGTAGCGTCCATCGTGGGGG + Intronic
1062411212 9:136425646-136425668 CCAAATAGCCTGCTTGGGGGAGG - Intergenic
1186666287 X:11720665-11720687 TGAGGTAGCCACCTGGGTGGGGG - Intergenic
1187194012 X:17064059-17064081 TTAAGTGGCCTCCTTGGGGAGGG + Intronic
1189147274 X:38667907-38667929 TGAAGTAGACTCCTCAGTGGTGG + Intronic
1190909043 X:54755520-54755542 TGAAGTAGCCTGCTTGGGGGAGG + Intronic
1192040626 X:67617312-67617334 TAAGGTAGCTTCCATGGTGGTGG - Intronic
1198093114 X:133351375-133351397 TCAAAAAGCTTTCTTGGTGGCGG - Intronic
1199197352 X:145047277-145047299 TAAATTAGCATCCTTGCTGGGGG - Intergenic
1200211390 X:154348222-154348244 TCAGGAAGGCTCCCTGGTGGAGG - Intergenic