ID: 1184079964

View in Genome Browser
Species Human (GRCh38)
Location 22:42212385-42212407
Sequence GAATCATGGGTTGCTGCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184079955_1184079964 26 Left 1184079955 22:42212336-42212358 CCGCCGCATTGGCGTGGGTCTGC 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1184079964 22:42212385-42212407 GAATCATGGGTTGCTGCTCCAGG 0: 1
1: 0
2: 1
3: 7
4: 121
1184079956_1184079964 23 Left 1184079956 22:42212339-42212361 CCGCATTGGCGTGGGTCTGCTGT 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1184079964 22:42212385-42212407 GAATCATGGGTTGCTGCTCCAGG 0: 1
1: 0
2: 1
3: 7
4: 121
1184079954_1184079964 27 Left 1184079954 22:42212335-42212357 CCCGCCGCATTGGCGTGGGTCTG 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1184079964 22:42212385-42212407 GAATCATGGGTTGCTGCTCCAGG 0: 1
1: 0
2: 1
3: 7
4: 121
1184079961_1184079964 -8 Left 1184079961 22:42212370-42212392 CCATAGTCTGAAAGGGAATCATG 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1184079964 22:42212385-42212407 GAATCATGGGTTGCTGCTCCAGG 0: 1
1: 0
2: 1
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184079964 Original CRISPR GAATCATGGGTTGCTGCTCC AGG Exonic
903917540 1:26775111-26775133 GAATCATGGGGGGCTGCACAGGG - Exonic
904838911 1:33357860-33357882 AAATCATGGATTCCTGCTCCTGG + Intronic
906526588 1:46496837-46496859 GAGCCCTGGCTTGCTGCTCCCGG + Intergenic
906567986 1:46814094-46814116 GAAGCCTGGGTTCCTCCTCCTGG + Intronic
907250281 1:53133593-53133615 GTATAATGAGTGGCTGCTCCAGG - Intronic
910499103 1:87868824-87868846 AAATCATGGGTTGCAGCTAAAGG + Intergenic
910581450 1:88830207-88830229 GCATTATGCTTTGCTGCTCCAGG + Intronic
912472394 1:109914652-109914674 GAATCAGTGGTTGATGTTCCTGG - Intronic
912524758 1:110273320-110273342 AAATCATGAGTTTCTGCTCATGG + Intronic
912834781 1:112986495-112986517 GAGGCTTGGGCTGCTGCTCCAGG - Intergenic
912932161 1:113973534-113973556 GAATCATGGCTACCTTCTCCTGG + Exonic
913460491 1:119080903-119080925 GAATTGTAGGTTGATGCTCCAGG - Intronic
915457573 1:156051018-156051040 GAAACAGGAGTTCCTGCTCCTGG - Intronic
916433950 1:164759456-164759478 GAATCCTGGGTGGCTGGTTCAGG + Intronic
916624873 1:166544519-166544541 TATTCTTGGTTTGCTGCTCCTGG - Intergenic
917307398 1:173640469-173640491 GAATCATGGGTTGCTGTACCAGG + Intronic
917703122 1:177601215-177601237 TAAGCATGGGTTACTGTTCCTGG - Intergenic
1063017404 10:2092724-2092746 GAATAGTGAGTTGCTGCTCCTGG - Intergenic
1063503620 10:6577151-6577173 GAATCATAGATTTTTGCTCCTGG - Intronic
1064796205 10:19014307-19014329 TCATCATGGCTTGCTGTTCCAGG + Intergenic
1068113329 10:52707375-52707397 CAATCATGGGTTGCCGCTTAAGG + Intergenic
1070409011 10:76122208-76122230 GCCTCCTGGGATGCTGCTCCTGG - Intronic
1076120324 10:127931586-127931608 GAGAAATGGCTTGCTGCTCCTGG - Intronic
1076245550 10:128944968-128944990 GGACCATGGGTTGGTGTTCCAGG - Intergenic
1076245884 10:128947315-128947337 GGACCATGGGTTGGTGTTCCAGG - Intergenic
1077232735 11:1465350-1465372 GAATCAAGGTGTGCTCCTCCTGG + Intergenic
1077713019 11:4554623-4554645 GAGTCATAGGTTCCTGCCCCTGG + Intergenic
1079683954 11:23332491-23332513 GAAGCATGGACTGCTGCCCCAGG - Intergenic
1086137806 11:83460128-83460150 GAATCATTTGTTACTGATCCAGG - Intronic
1087320471 11:96651982-96652004 TAATCATAGGTTGATACTCCTGG + Intergenic
1089153875 11:116385821-116385843 CAATCAAGAGTTGCTTCTCCAGG + Intergenic
1089945001 11:122461706-122461728 GAAACATGGACTGCTGCTGCTGG + Intergenic
1092630370 12:10370055-10370077 GAATCATGGGTTACTGTACTAGG + Intergenic
1095254705 12:40020868-40020890 AATTCATGAGTTGCTGCTCAGGG - Intronic
1099184963 12:79505872-79505894 AGATCATGGCTTGGTGCTCCTGG - Intergenic
1101414765 12:104499444-104499466 CAATCACCAGTTGCTGCTCCAGG - Intronic
1103954771 12:124569772-124569794 GAATCACGGGCTGCTGCTGGAGG - Intergenic
1111626244 13:90791358-90791380 GAATCATGTCTTGCTGTTACAGG - Intergenic
1112675667 13:101698897-101698919 GACTCATGGGTAGCTATTCCAGG - Intronic
1121627031 14:95393259-95393281 TAATCAGGGGCTACTGCTCCAGG - Intergenic
1121671688 14:95714794-95714816 GAATCATGGGTTTTTGCCCTTGG + Intergenic
1126953490 15:53909372-53909394 GAATCATGTCTTGGTGCTTCAGG - Intergenic
1127931513 15:63600360-63600382 GAGTCAAGGGTTGTGGCTCCTGG + Intronic
1128890982 15:71331596-71331618 AAATCAGGGGTTCCTCCTCCCGG - Intronic
1130541940 15:84826756-84826778 GAAACATGGTTGGCTGCTCCAGG - Intronic
1132225009 15:100133608-100133630 GAGGCAGGGGCTGCTGCTCCTGG - Intronic
1135960948 16:26994141-26994163 GAATCATGTGTGACTGCTCTTGG + Intergenic
1137374161 16:47937865-47937887 GGGTCATGGGTTTCTGCTCCGGG + Intergenic
1138392740 16:56682334-56682356 GGCTCACGGGTTGCTGCACCCGG + Intronic
1139337889 16:66245769-66245791 GCTTCAAGGGTTTCTGCTCCCGG - Intergenic
1140860833 16:79016386-79016408 GAAACAGGAGTTGCTGCTCGTGG - Intronic
1145826502 17:27880908-27880930 GAATCTTAGGTTGCTTCTCAAGG - Intronic
1147324628 17:39664380-39664402 GCACCATGAGTTGCTACTCCTGG + Exonic
1153993566 18:10420795-10420817 GAGTCATGAGTTGTTGGTCCAGG + Intergenic
1162189966 19:8937227-8937249 GACTCATGGGTCGCTCATCCTGG - Exonic
1162681552 19:12347330-12347352 AAAACATGGGTTTCTTCTCCTGG - Intergenic
1162972406 19:14188559-14188581 GAGTCAAGGGTTTCAGCTCCTGG - Intronic
1163004370 19:14388473-14388495 GAGTCCTGGGTTTCAGCTCCCGG - Exonic
1163063093 19:14774261-14774283 GAGTCCTGGGTTTCAGCTCCCGG + Exonic
1164907455 19:31978751-31978773 GAATCCTGGGTGCCTGCCCCAGG + Intergenic
1167068821 19:47207402-47207424 GAATGATGGGACGGTGCTCCTGG + Intronic
1167906856 19:52668322-52668344 GAATCATGGGCCACTGTTCCTGG + Intronic
1168611216 19:57802156-57802178 GAATCATGGGTTACTGTACTAGG - Intronic
925766232 2:7238356-7238378 GATTCATGAGTGGCTGCTTCTGG + Intergenic
927491795 2:23525845-23525867 GGATCCTGTGTTGCTGCCCCAGG + Intronic
928344483 2:30478601-30478623 CAATCATGGCTTACTGCTCCTGG - Intronic
928656530 2:33457761-33457783 GAATCCTGGTTTCCTGTTCCTGG + Intronic
930716151 2:54595851-54595873 GATTCATGGGTAGATGCTACTGG - Intronic
940893044 2:159054008-159054030 GCAGCATGGGATGCTGCTCTAGG + Intronic
942372093 2:175295988-175296010 GAATCATGGTTTCCTAATCCTGG - Intergenic
943064524 2:183072132-183072154 GCATCTTGTTTTGCTGCTCCAGG + Intergenic
945402042 2:209394833-209394855 GAATCTTAGGTTGCTGATCTTGG + Intergenic
946353815 2:219172516-219172538 GAATCAAGCTTTGCTCCTCCAGG + Exonic
1169268819 20:4183536-4183558 GAAGTAAGGGTTGCTGCCCCAGG - Exonic
1169358614 20:4928579-4928601 GAATCATGGGATGGAGCTGCTGG - Intronic
1174574943 20:51530650-51530672 GATTCAGAGGTTGCTGCTCAAGG + Intronic
1177317198 21:19477384-19477406 GAAACATGGTTTGCTGGGCCAGG - Intergenic
1181417586 22:22771703-22771725 GAGTCAGGGGTTGCTGCTGGAGG - Intronic
1182033800 22:27181678-27181700 GATTCATGGGCAGCTGCTTCCGG + Intergenic
1183480923 22:38065156-38065178 GAAACATGTGTTGCTGCCTCTGG - Intronic
1183946594 22:41329820-41329842 GAAGCATGGGATGGTGGTCCTGG + Intronic
1184079964 22:42212385-42212407 GAATCATGGGTTGCTGCTCCAGG + Exonic
1184676757 22:46047373-46047395 GTATCAGCGGCTGCTGCTCCAGG + Intergenic
949609929 3:5693574-5693596 GAATCATGGGCAGCTATTCCTGG - Intergenic
953960747 3:47263976-47263998 GTTTCCTGGGGTGCTGCTCCTGG - Intronic
954263353 3:49455700-49455722 GAAGCATGTGTTTCTGCTCTTGG - Intergenic
954898109 3:53994807-53994829 GAAACCAGGGTGGCTGCTCCAGG + Intergenic
959840259 3:110967032-110967054 GAATCATGGGTTACTATACCAGG - Intergenic
961259246 3:125587060-125587082 GTAACATGGGTTCCTGCTACTGG + Intronic
969266346 4:6066590-6066612 GAAGCATGAGCTGCTGCTGCTGG - Intronic
969645674 4:8427495-8427517 GAGGCACCGGTTGCTGCTCCCGG + Intronic
970606340 4:17685593-17685615 GAACCATGGGTTGGTTCACCAGG - Intronic
973887919 4:55341549-55341571 GAATCATGGGCCACTGTTCCTGG + Intergenic
974142643 4:57907591-57907613 GCATAATGGGTTGCTTCTGCTGG - Intergenic
975189941 4:71448703-71448725 GGATCATTAGTTTCTGCTCCTGG + Intronic
975837813 4:78442776-78442798 AACTCTGGGGTTGCTGCTCCAGG - Intronic
979190356 4:117849424-117849446 GAAGCACAGGCTGCTGCTCCTGG + Intergenic
979822677 4:125192754-125192776 GACTCAAGGGTTGCCGCTGCTGG - Intergenic
980503122 4:133682484-133682506 GAAGCAAGGGCTGCTGCCCCTGG - Intergenic
981396136 4:144252268-144252290 TAATCATGGCTTGATCCTCCTGG - Intergenic
986289894 5:6391261-6391283 GAATGATGGGTATCTGCTCGGGG + Intergenic
991410375 5:66339505-66339527 GAATCACAAGTTGCTGGTCCAGG + Intergenic
992474451 5:77088260-77088282 GAATCACGGGATCCTGCCCCTGG - Intergenic
993055124 5:82972015-82972037 GAATCATGGGTCATTGTTCCTGG - Intergenic
994570435 5:101506998-101507020 GACCCATGGGTTGCTGCTGCTGG - Intergenic
994592697 5:101791901-101791923 GCATCTTGGGTCTCTGCTCCTGG - Intergenic
994710055 5:103255870-103255892 GAACCATAGGTGGCAGCTCCAGG + Intergenic
997613162 5:135229294-135229316 GAAGCCTGGGTTGCTGGTTCTGG - Intronic
999117453 5:149176230-149176252 GAAGCAGTGATTGCTGCTCCAGG - Intronic
1001814492 5:174656780-174656802 GAAGCATGGGCTGCAGCGCCTGG - Intergenic
1006380289 6:33693315-33693337 GAGTCCTCGGTTGCTGCTGCGGG + Intronic
1006928057 6:37669692-37669714 GAATCAGGAGATGCTGCTGCAGG - Intronic
1012325775 6:97915110-97915132 GAATCATGGTAGGCTACTCCGGG - Intergenic
1012990556 6:105921746-105921768 TCATCATGGCTTGATGCTCCAGG - Intergenic
1013869776 6:114742957-114742979 CACTCATGTGTTGCTGCTCATGG + Intergenic
1022236609 7:28467559-28467581 TGAAAATGGGTTGCTGCTCCTGG + Intronic
1024784193 7:52887070-52887092 GATTCATGGCTGGCTGCTCTAGG + Intergenic
1034364280 7:150533307-150533329 AGATCATGGTTTGGTGCTCCTGG + Intergenic
1037215490 8:16446308-16446330 GATTCATGGGTTGATGAGCCTGG - Intronic
1050238876 9:3613264-3613286 GAAGCATAGTTTGCAGCTCCAGG - Intergenic
1052332339 9:27282501-27282523 GTAGCATGGGCTGCTGCTCCAGG + Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1057381577 9:94572087-94572109 GAATCAGGGCTTCCTGCTGCTGG - Intronic
1057907606 9:98994537-98994559 GAATCATGGTTTGTTGCGTCTGG + Intronic
1060933237 9:127502034-127502056 GAGTCAGTGGCTGCTGCTCCGGG + Intronic
1061257888 9:129463416-129463438 AAATCATGGGTGCCTGATCCAGG + Intergenic
1189893881 X:45633382-45633404 GCATCTTGGTCTGCTGCTCCAGG + Intergenic
1190279265 X:48918709-48918731 GAATGATGGGTTGCAGCGCGGGG - Intronic
1196874560 X:120145854-120145876 GAATCATGGGTTACTGTACTAGG + Intergenic
1199502425 X:148522186-148522208 GAAACATGGGTTGCACCTACTGG + Intronic