ID: 1184080191

View in Genome Browser
Species Human (GRCh38)
Location 22:42213843-42213865
Sequence CTCTTGGAGGTCTTCTTCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184080184_1184080191 22 Left 1184080184 22:42213798-42213820 CCTTCAGAATTTGTGCAGCTATC 0: 1
1: 0
2: 1
3: 11
4: 120
Right 1184080191 22:42213843-42213865 CTCTTGGAGGTCTTCTTCTGAGG 0: 1
1: 0
2: 1
3: 24
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184080191 Original CRISPR CTCTTGGAGGTCTTCTTCTG AGG Exonic
900181339 1:1312330-1312352 CTCTTTGAGGGCTTGCTCTGAGG + Exonic
901360594 1:8695937-8695959 CACTTGTATGTCTTCTTTTGAGG - Intronic
901491400 1:9598127-9598149 TTCTTGGAGCTCTGCATCTGGGG + Intronic
907021012 1:51066870-51066892 CTCATGGAGATCTTCTGCTAGGG - Intergenic
907285923 1:53379521-53379543 CTCTTGGATTTCTTCAGCTGAGG + Intergenic
907632199 1:56093877-56093899 CTTTTAGGGGTCTACTTCTGAGG + Intergenic
908026958 1:59962398-59962420 CTATTGGAGCTCTTCTCCTCTGG - Intergenic
909373463 1:74913903-74913925 CTCATGGAGAACTTCTGCTGGGG - Intergenic
911679465 1:100698226-100698248 CACTTGTATGTCTTCTTTTGAGG + Intergenic
914331631 1:146676797-146676819 ACTTTGGAGGGCTTCTTCTGCGG + Intergenic
915547273 1:156607561-156607583 CTCCTGAAGGTCTTCCCCTGGGG - Intergenic
915649277 1:157295883-157295905 GTCTTGGAGTTGTTCTTCTCAGG - Intergenic
916802980 1:168231763-168231785 CTCTGGGAGCTCTGCTTGTGTGG + Intronic
917076962 1:171215451-171215473 GACTTGGAGGTTTTCTTTTGGGG - Intergenic
919075734 1:192810361-192810383 CTCTTGCAGGCCTTCTCCTGAGG + Exonic
1063207108 10:3843331-3843353 CATTTGTATGTCTTCTTCTGGGG + Intergenic
1063317064 10:5016759-5016781 CTCATGGAGAACTTCTTCTAGGG - Intronic
1064469220 10:15618273-15618295 CTGTTGTAAGTCTTCTTCTGTGG - Intronic
1067239504 10:44478520-44478542 TTCTTGGAGATTATCTTCTGGGG + Intergenic
1067242704 10:44509478-44509500 CTCTTGGAGCTCTTATCTTGTGG - Intergenic
1069870939 10:71532533-71532555 CTCTGGGAGGGCTTCTGCCGTGG - Intronic
1070436080 10:76395133-76395155 CTCCTGTAGTTATTCTTCTGTGG - Intronic
1071186013 10:83046297-83046319 ATTTTGGAGTTTTTCTTCTGTGG + Intergenic
1071460173 10:85886192-85886214 CTCTTCTAGGTCTTCTTCTTAGG - Intronic
1073629053 10:105129822-105129844 CTCTTGGAGATCTCTATCTGTGG + Intronic
1075241757 10:120785763-120785785 TTCTGGGAGGTCACCTTCTGTGG + Intergenic
1075705490 10:124497779-124497801 CTCTTGGATGCCTTCTGCTGTGG + Intronic
1076465739 10:130680495-130680517 CTCTGAGTGGTTTTCTTCTGTGG - Intergenic
1076602414 10:131667392-131667414 CTCTTGGTGGTTGTGTTCTGGGG + Intergenic
1076813528 10:132901744-132901766 CTCTAGCATGTCCTCTTCTGAGG + Intronic
1077553568 11:3215107-3215129 CTCATGGAGCTCATCTTCTAGGG + Intergenic
1077696230 11:4395308-4395330 CACTTGTATGTCTTCTTCTGAGG + Intergenic
1078482232 11:11687621-11687643 CTCATGGAGAACTTCTGCTGGGG + Intergenic
1078674957 11:13401995-13402017 CCCTTGAATGTCTTCTTCTCAGG + Intronic
1078723793 11:13909431-13909453 CTTTTGGATTTCTTGTTCTGGGG + Intergenic
1078896992 11:15605561-15605583 CTCTTGGACTTCTTGTCCTGGGG - Intergenic
1079749419 11:24178618-24178640 CTTTTGCAGGTGTTCTTCAGTGG + Intergenic
1080144472 11:28964250-28964272 CTCTTGGAGGTCACCTTCAAAGG + Intergenic
1080904014 11:36522523-36522545 CTCATGGAGGACTTCTGCTAGGG + Intronic
1082222811 11:49661979-49662001 CTCTTGAATATATTCTTCTGAGG + Intergenic
1082710947 11:56553522-56553544 GTCTTGGAGTTGCTCTTCTGGGG + Intergenic
1083818669 11:65152999-65153021 CTCTTGGATCTCTTGCTCTGGGG + Intergenic
1084499854 11:69529128-69529150 CTCATGGAGTTGATCTTCTGCGG + Intergenic
1085191377 11:74627162-74627184 CACTGGAAGGTCTTCTTCAGGGG - Intronic
1086626237 11:88957232-88957254 CTCTTGAATATATTCTTCTGAGG - Intronic
1087006765 11:93479146-93479168 TCCTTGGAGGTCTCCTTCTTGGG + Exonic
1087821809 11:102720721-102720743 TCCTTGGAGCTCTTCTTCAGTGG - Intronic
1091361859 11:134984135-134984157 CTGTTGTAGATCTTCTCCTGGGG + Intergenic
1091982710 12:4879396-4879418 CTCATGGAGAACTTCTGCTGGGG - Intergenic
1095040506 12:37435496-37435518 CTGTTTGAGGTCTTCCCCTGAGG + Intergenic
1096410970 12:51376988-51377010 CTCTTGGAGCTCTTTGGCTGAGG + Intronic
1096462326 12:51828953-51828975 ATCTTGGGGGTCTCCTTCGGGGG - Intergenic
1096704937 12:53414765-53414787 CTTTTTGAGGGGTTCTTCTGGGG + Intronic
1100580199 12:95931679-95931701 CTCTTGAAGATCTTATACTGAGG + Intronic
1101912129 12:108867905-108867927 CTCTTGGATTTCTCATTCTGGGG + Intronic
1103252509 12:119512438-119512460 CACTTGCAGGTCTTCTCCTCAGG - Intronic
1103951456 12:124553859-124553881 CTCTTGGACGTCTCCTCCCGTGG - Intronic
1104543123 12:129685677-129685699 CTGTTGGTGGTCTTCTTCTAGGG - Intronic
1104564541 12:129868937-129868959 TTCTTGGAGGTCTGCGGCTGGGG - Intronic
1108260010 13:48646738-48646760 GGCTTGGAGGTCTTCATTTGGGG + Intergenic
1110647617 13:77906524-77906546 CTCTTGGAACACTTATTCTGGGG + Intronic
1111263330 13:85773221-85773243 CTCTTGGAACACTTGTTCTGTGG + Intergenic
1111656637 13:91162149-91162171 CTCTGGGAAGTCTTCTGCAGAGG + Intergenic
1111705158 13:91739689-91739711 CTCTTAGATTTCTTGTTCTGAGG - Intronic
1112806561 13:103169366-103169388 CTCATGTATGTCTTCTTTTGGGG + Intergenic
1113989210 13:114346348-114346370 CTCCTGGGGGTGCTCTTCTGAGG - Intergenic
1116375360 14:44192529-44192551 CTGTTGGAGGTGCTCTTCTTAGG - Intergenic
1118970281 14:70630832-70630854 CTCTTAGATCTCTTGTTCTGGGG + Intergenic
1119635876 14:76273098-76273120 CTCTTGTATCTCTTCTTCTAAGG + Intergenic
1121420071 14:93806961-93806983 CTCTTGGAGATCTTACTCTGGGG + Intergenic
1122386345 14:101350904-101350926 CTCTTGGCGGTGCTGTTCTGGGG - Intergenic
1127902671 15:63352532-63352554 TTCTTGGAGGTCATACTCTGAGG + Intronic
1129666494 15:77582268-77582290 CTCTCCACGGTCTTCTTCTGTGG + Intergenic
1129879193 15:78995981-78996003 CTGTGGGAGGTCCCCTTCTGGGG + Intronic
1132363208 15:101235443-101235465 ATCATGAAGGACTTCTTCTGGGG + Exonic
1133336918 16:5012285-5012307 CTCTGGGAGGGCTGATTCTGAGG + Intronic
1133525600 16:6602501-6602523 CTCTTGGAGGTCAGCTGTTGGGG - Intronic
1134230457 16:12425152-12425174 CTCTTGGAGGTTGTCCTCTGGGG + Intronic
1135015684 16:18923160-18923182 CTGTTGGAGGTATGCTTCTATGG + Intronic
1135321301 16:21498964-21498986 CTGTTGGAGGTATGCTTCTATGG + Intergenic
1135374134 16:21930466-21930488 CTGTTGGAGGTATGCTTCTATGG + Intergenic
1135437652 16:22440255-22440277 CTGTTGGAGGTATGCTTCTATGG - Intergenic
1136332780 16:29592090-29592112 CTGTTGGAGGTATGCTTCTATGG + Intergenic
1136341223 16:29644829-29644851 CTCTTGGAGGTAGCCTTCTCCGG - Intergenic
1136447473 16:30332177-30332199 CTGTTGGAGGTATGCTTCTATGG + Intergenic
1138540177 16:57683044-57683066 CCCTTGGAGGTTTCCTTCTGGGG - Intronic
1140001923 16:71034103-71034125 ACTTTGGAGGGCTTCTTCTGCGG - Intronic
1141036195 16:80628372-80628394 TTCTTGGAGTTCTTGCTCTGAGG + Intronic
1141677926 16:85527373-85527395 CTCTGGGAGAGGTTCTTCTGAGG - Intergenic
1142608652 17:1096176-1096198 CTTGTGGGGGTCATCTTCTGGGG - Intronic
1142608727 17:1096517-1096539 CACTCTGAGGTTTTCTTCTGAGG + Intronic
1145840285 17:27988823-27988845 CTCTTGGCGGTCTGAATCTGGGG - Intergenic
1151167434 17:72217483-72217505 CTCTTAGAGTTCTTTTTCAGAGG + Intergenic
1151188134 17:72378875-72378897 CTCCTGGAGGACTCCTGCTGGGG + Intergenic
1151867967 17:76817145-76817167 CTGTTAGATGTTTTCTTCTGAGG - Intergenic
1152172951 17:78765688-78765710 CTCTTGGTGTTTGTCTTCTGGGG - Intronic
1155371776 18:25109733-25109755 CACTTGTATGTCTTCTTTTGAGG + Intronic
1155676482 18:28435409-28435431 CACTTGTATGTCTTCTTTTGAGG + Intergenic
1156258943 18:35426773-35426795 CTCTTGGAGAGCTTATTATGAGG + Intergenic
1156515533 18:37676284-37676306 CTCTTGGAGGTGCTCTTTTTTGG - Intergenic
1156520368 18:37717215-37717237 CTCATGGAGGTCTTCTACCAGGG - Intergenic
1161302948 19:3551720-3551742 ATCTTAGGGGTTTTCTTCTGAGG - Intronic
1161348269 19:3778531-3778553 CTCTGGGAGGTCTTCTCATATGG - Exonic
1164708385 19:30337040-30337062 CTCTTGCAGGTCTTGTTCTTGGG + Intronic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1167905994 19:52661289-52661311 CCCTTGTAGGTCTTCCTGTGGGG - Intronic
1167945005 19:52981125-52981147 CACTTGTAGGTCTTCCTGTGGGG - Intergenic
1168101167 19:54141853-54141875 ATCTCAGAAGTCTTCTTCTGAGG + Exonic
926172975 2:10565016-10565038 CTCTTGGATGGCTTGCTCTGGGG + Intergenic
928979750 2:37125491-37125513 CTTTTGGATGACTTGTTCTGGGG + Intronic
929648968 2:43658704-43658726 CTCTTGGATGACTTGCTCTGGGG - Intronic
930444323 2:51451219-51451241 CTCATGGAGATCCTCTGCTGTGG + Intergenic
930627086 2:53709884-53709906 CTCTTAGACCTCTTCCTCTGAGG + Intronic
930800877 2:55441368-55441390 CTTTTTGAGGACTTCTGCTGTGG - Intergenic
931154682 2:59614857-59614879 CTCATGGAGAACTTCTTCTAGGG - Intergenic
931573578 2:63696522-63696544 CTCTTGGAGCTCTATTCCTGTGG - Intronic
932701957 2:73998157-73998179 CTCTTGGAAGTCTTCTGCTGGGG + Intronic
933036754 2:77409842-77409864 CTCGTGAAGCTCTTCTCCTGTGG + Intronic
934070039 2:88375350-88375372 CTCTTGGATCACTCCTTCTGGGG - Intergenic
935350729 2:102149969-102149991 CTGCTGGAGGTCCACTTCTGGGG - Intronic
935694602 2:105760583-105760605 CTCTTGGATCTCTCCATCTGAGG + Intronic
936570701 2:113612046-113612068 CTCCTGGGGGTGCTCTTCTGAGG + Intergenic
936939140 2:117865257-117865279 CTCTTGGACGGCTTGCTCTGGGG - Intergenic
937234305 2:120421289-120421311 CTGTTGCAGATCTTCATCTGTGG - Intergenic
939090476 2:137774627-137774649 CGCTTGGATGTCTTCTTTTGAGG + Intergenic
939193612 2:138945513-138945535 CTCTTGGAGTTTATCTTCTCAGG - Intergenic
940348850 2:152658570-152658592 CTCTTGCAGTTCTTATTCTTAGG - Intronic
941523435 2:166577703-166577725 CACTTGTATGTCTTCTTTTGAGG + Intergenic
941661619 2:168201335-168201357 TTCTCAGAGGTCTTTTTCTGTGG - Intronic
941841460 2:170089062-170089084 CTCTTGGGTCACTTCTTCTGTGG - Intergenic
945631098 2:212277610-212277632 CACTTTGTGGTCTTCCTCTGTGG - Intronic
948623387 2:239250836-239250858 CTCTGGCAGCTCTTCTGCTGGGG - Intronic
948681946 2:239641040-239641062 ATCTTGGAGGTCTTCTGTAGGGG + Intergenic
1169405033 20:5315703-5315725 CTCTTGGAGGTTTTCACCTTGGG - Intergenic
1170567200 20:17614011-17614033 CTCTGGAAGGTCTACTTCTGTGG + Exonic
1170571577 20:17635751-17635773 CTTTTGGGGGTTTTCTTTTGTGG - Intronic
1170669224 20:18415343-18415365 CTCTGGGAGGCGTCCTTCTGCGG - Exonic
1171142286 20:22753730-22753752 CTCCTGAAGCTCTGCTTCTGAGG - Intergenic
1171318134 20:24213949-24213971 GTTTTTGAGGTCTGCTTCTGAGG - Intergenic
1172998770 20:39090751-39090773 CTCCTGGATGGCTTCTTCTGGGG + Intergenic
1174078544 20:47955002-47955024 CTTTTGGAGGTCTCCTGTTGGGG + Intergenic
1176929920 21:14796933-14796955 CTCTTGGTGGTGTCCTTATGTGG - Intergenic
1178691614 21:34754713-34754735 CTCTTGGAGGCATTTTTATGGGG + Intergenic
1181119168 22:20654004-20654026 ATCTTCAAGGTCATCTTCTGGGG + Intergenic
1181165082 22:20979005-20979027 CTCTGGAAGGTCTGCTTCTTGGG - Intronic
1182521066 22:30884748-30884770 CCCTTGGAGGTGTTCTCCTGAGG + Intronic
1183047497 22:35231692-35231714 CTCCTTGAGGCCTTCCTCTGTGG - Intergenic
1183364242 22:37398892-37398914 TTCTTGGAGGTGCTGTTCTGGGG - Intronic
1184080191 22:42213843-42213865 CTCTTGGAGGTCTTCTTCTGAGG + Exonic
950826249 3:15824947-15824969 ATCTTGGAGATCTTTTTCAGTGG - Intronic
951037682 3:17951653-17951675 CTCATGGAGAACTTCTTCTAGGG + Intronic
951100644 3:18684347-18684369 CTCATGGAGAACTTCTACTGTGG + Intergenic
952472380 3:33669623-33669645 CATTTGGATGTCTTCTTTTGTGG - Intronic
954999914 3:54918141-54918163 CTCTTCCAGGTACTCTTCTGTGG - Intronic
957079590 3:75624953-75624975 CTCCTGGGGGTGTTCTTCCGAGG + Intergenic
957168552 3:76707885-76707907 ATTTTGGAGTTCTTTTTCTGTGG - Intronic
957772768 3:84715812-84715834 CACTTGAATGTCTTCTTTTGAGG - Intergenic
958515273 3:95107456-95107478 CTCTTGGATGTTTTATTTTGTGG - Intergenic
958657198 3:97017918-97017940 CTCTTAGATTTATTCTTCTGAGG + Intronic
960418136 3:117410245-117410267 CTTTGGGAGGCATTCTTCTGTGG + Intergenic
963348700 3:144126799-144126821 CTCTTGTGTTTCTTCTTCTGAGG + Intergenic
963850233 3:150203741-150203763 CTCTGGGAAGTCTCCTTCTCAGG - Intergenic
964190247 3:153992718-153992740 CTCATGGAGAACTTCTGCTGGGG + Intergenic
964698442 3:159536420-159536442 CTTTTGAAAGTCTTCTTCTAGGG + Intronic
965468593 3:169062848-169062870 CTGTTGGATGTCTTTTGCTGAGG - Intergenic
966131265 3:176642888-176642910 CTATTGTATGTCTTCTTTTGAGG + Intergenic
967172650 3:186834722-186834744 CACTTGGATGTCTTCTTTTGAGG - Intergenic
967855068 3:194111156-194111178 CTCTGGCATGTCTTCTTATGAGG - Intergenic
970501336 4:16680107-16680129 CTCTTGCCTGTCTTCTTATGTGG - Intronic
970697082 4:18690990-18691012 AACTTGGATGTGTTCTTCTGAGG + Intergenic
971044329 4:22788442-22788464 CTCTTGTATGTATTCTTTTGTGG + Intergenic
973265972 4:48210643-48210665 CTGTTGGGGGTCGTCTGCTGTGG - Intronic
974414816 4:61593936-61593958 CTCTTAGATGTGTTCTTTTGAGG + Intronic
975546385 4:75564394-75564416 CTCTCTGGAGTCTTCTTCTGGGG - Exonic
978701526 4:111652542-111652564 CACTTGGGGGTCGTCTCCTGTGG - Intergenic
979082296 4:116359809-116359831 CTCTTGCAGCTCTGCTTCTAAGG - Intergenic
979182864 4:117753309-117753331 CTCTTGGAGAACTTCTGCTAGGG + Intergenic
979844575 4:125491249-125491271 CCATGGGAGGTCTTCTTCAGAGG + Exonic
980221777 4:129927230-129927252 CTCTTGGAGCTCTTTTTTTGGGG - Intergenic
980253424 4:130347442-130347464 CTCCTGGAGGTCTTATGATGTGG + Intergenic
981052237 4:140320637-140320659 ATCTTGGAGGACATTTTCTGAGG - Intronic
981228808 4:142328738-142328760 ATTTTGGAGTTTTTCTTCTGTGG + Intronic
981385159 4:144121883-144121905 CTCTTGGAGATATTCAACTGAGG + Intronic
983262262 4:165470073-165470095 CTCTTGGTCGAATTCTTCTGAGG - Intronic
983785928 4:171729370-171729392 CTCATGGAGAACTTCTGCTGTGG + Intergenic
983809764 4:172046656-172046678 CATTTGGATATCTTCTTCTGAGG + Intronic
984707576 4:182858980-182859002 CACTTGGTGGTCTTCTTATCAGG - Intergenic
986084849 5:4433940-4433962 CTCTTGGAGAACTTCTGCTAGGG - Intergenic
986753299 5:10810356-10810378 CTCTTGAAAGTCTGCTTCTCAGG - Intergenic
987239103 5:15974810-15974832 CTCTTTGAGTTCATCTTCTTTGG - Intergenic
987510333 5:18828888-18828910 CTCTTGGAGAACTTCTGCTAGGG + Intergenic
988426831 5:31074226-31074248 CTCATGGAGAACTTCTTCTAGGG - Intergenic
988664621 5:33311840-33311862 CTGTTGAAGGTCTTCCTCTTTGG + Intergenic
989986368 5:50703456-50703478 TTCTTGGAGGTCTCCTTAGGGGG + Intronic
990823248 5:59867206-59867228 CTCTTGAAGATCTTCTTCTCTGG - Intronic
990890647 5:60646193-60646215 GTCCTGGTGGTCTTCTACTGGGG + Intronic
994559779 5:101352915-101352937 CGCTTGTATGTCTTCTTTTGAGG - Intergenic
994966385 5:106677712-106677734 CACTTGTATGTCTTCTTTTGAGG + Intergenic
995241755 5:109892838-109892860 CTATTGGTAGTCATCTTCTGGGG - Intergenic
996040296 5:118801740-118801762 CTCTTGAAAGTCTTCTTGTCTGG - Intergenic
996078827 5:119231548-119231570 CTCCTGGAGGTCATCATCAGGGG + Intronic
998295487 5:140966150-140966172 CGCTTGGAGATCTTTTCCTGGGG + Intronic
1007029548 6:38615713-38615735 CTCATGGAGGTTATCTTCTAGGG - Intronic
1007569083 6:42876225-42876247 CTCTAGGAGGTTTTCTTAGGTGG + Intergenic
1009449969 6:63789396-63789418 CTCTTGGTGCTCTGTTTCTGGGG - Intronic
1013626620 6:111943968-111943990 CTCTTGGAGATCTGAATCTGAGG + Intergenic
1013781996 6:113739063-113739085 CTCTTGGATTACTTCCTCTGGGG - Intergenic
1014525011 6:122492036-122492058 CACTTGGAGGTTTTATTCAGAGG + Intronic
1016651059 6:146461480-146461502 CTCTTGAATTTGTTCTTCTGAGG + Intergenic
1016839343 6:148510317-148510339 CTCTTGAAGGTTTTCTGGTGAGG + Intronic
1016998627 6:149979199-149979221 CTCATGGAGGGCTCCTCCTGGGG + Intergenic
1017188514 6:151626735-151626757 CTCTTGGTGGTTTAGTTCTGTGG - Intergenic
1017856212 6:158351344-158351366 CTCTGTGAAGTCTTCTTATGAGG + Intronic
1018476903 6:164151367-164151389 CACTTGAAGTTCTACTTCTGTGG + Intergenic
1019272306 7:157095-157117 GTCCAGGAGGTCTTCATCTGCGG - Intergenic
1019455435 7:1124448-1124470 CTGCTGGAGCTCTTGTTCTGTGG - Intronic
1022267200 7:28768659-28768681 CTCTTCCAGTTCTGCTTCTGTGG + Intronic
1022382563 7:29874060-29874082 CTCTTGGTGGCCTTCCTCTCTGG + Intronic
1022590613 7:31658202-31658224 TTCTGGGAAGTGTTCTTCTGTGG - Intronic
1022641532 7:32189935-32189957 TTCTAAGATGTCTTCTTCTGAGG + Intronic
1024794237 7:53003581-53003603 CTCTGGAAGGTCTACTTCTGTGG - Intergenic
1026441857 7:70451925-70451947 CTCTGAGAGGTCTGGTTCTGAGG + Intronic
1027454656 7:78374346-78374368 CACTTGTATGTCTTCTTTTGTGG + Intronic
1027478027 7:78658111-78658133 CTCTTGGAGGTAATCTTTTCAGG + Intronic
1033869763 7:145737577-145737599 CGCTTGTATGTCTTCTTTTGAGG - Intergenic
1034750029 7:153559955-153559977 CTCATGGAGAACTTCTGCTGGGG - Intergenic
1034876136 7:154726276-154726298 CTCATGGAGATCCTCTACTGGGG - Intronic
1037455317 8:19057663-19057685 GTCTTGGAGGCCCTCTTCTTTGG - Intronic
1038282399 8:26177906-26177928 CTCTTGGATGGCTCCTTCTGGGG - Intergenic
1041197519 8:55415852-55415874 CTCTTGACAGTCTTCTACTGCGG + Intronic
1042052585 8:64727168-64727190 CCCTGGGAGTTCTACTTCTGAGG + Intronic
1043116497 8:76260728-76260750 CTCTTATATGTCTTCTTTTGAGG - Intergenic
1043377558 8:79667596-79667618 AACTTGGAGATGTTCTTCTGAGG - Intergenic
1048484501 8:134833851-134833873 ATCTTGGTGGTCTACTTCTTTGG + Intergenic
1049967658 9:793848-793870 CTCCTGGAAGTCATCCTCTGGGG - Intergenic
1050406872 9:5318387-5318409 CTCTTGGTGGTTTTTTTCTATGG + Intergenic
1050413783 9:5393352-5393374 CTCTTGGTGGTTTTTTTCTATGG + Intronic
1051204047 9:14665514-14665536 GTCTTGGAGTTTTTCTTCTTGGG - Intronic
1052094891 9:24371699-24371721 CATTTGCATGTCTTCTTCTGAGG - Intergenic
1053663214 9:40298934-40298956 CTCTTGGAAATCCTGTTCTGTGG - Intronic
1053664671 9:40309021-40309043 CTCTTGGAAATCCTGTTCTGTGG - Intronic
1053913716 9:42929464-42929486 CTCTTGGAAATCCTGTTCTGTGG - Intergenic
1054375336 9:64445158-64445180 CTCTTGGAAATCCTGTTCTGTGG - Intergenic
1054519945 9:66067263-66067285 CTCTTGGAAATCCTGTTCTGTGG + Intergenic
1054521400 9:66077351-66077373 CTCTTGGAAATCCTGTTCTGTGG + Intergenic
1054745126 9:68846266-68846288 CTCTTGGCATTGTTCTTCTGTGG + Intronic
1055207171 9:73746356-73746378 CACTTGTAAGTCTTCTTTTGAGG + Intergenic
1055264138 9:74476007-74476029 CTCATGGAGAACTTCTTCTAGGG + Intergenic
1056708506 9:88971411-88971433 TACTTGGAGGTCTTTTTGTGTGG - Intergenic
1057479171 9:95430666-95430688 CTCTTGGTGGTCTGCCTCTGTGG + Intergenic
1057878027 9:98772530-98772552 CTCTTGTTGGTCCTCTACTGTGG + Intronic
1057954720 9:99398378-99398400 CTTCTTGAGGTCTGCTTCTGGGG + Intergenic
1059039859 9:110800752-110800774 CTCTGGGAGATCTTCTCCTATGG + Exonic
1060856352 9:126916799-126916821 CTTTTGGGGGTCTTCTTTTGGGG - Intronic
1060902252 9:127270030-127270052 CTCTTGTATGTTTTCTTCTAAGG + Intronic
1061123219 9:128656928-128656950 CTCTTAGAGTGCTTTTTCTGGGG - Intergenic
1061631873 9:131877186-131877208 CTCTTCCAGGCCTTCATCTGTGG + Intronic
1061633130 9:131886312-131886334 CTCATGGAGTTCCTCTCCTGCGG - Intronic
1185611748 X:1397391-1397413 CTTTTGGGGGCCCTCTTCTGGGG - Intergenic
1189443626 X:41060220-41060242 CTCTTGGATCACTTGTTCTGGGG + Intergenic
1189443952 X:41063393-41063415 CTCTTGGATCACTTGTTCTGGGG + Intergenic
1190950638 X:55139798-55139820 CTCATGGAGGACCTCTGCTGGGG + Intronic
1192630933 X:72777382-72777404 CCCTGGGAGCACTTCTTCTGAGG + Intronic
1192650776 X:72943419-72943441 CCCTGGGAGCACTTCTTCTGAGG - Intronic
1193204694 X:78735000-78735022 CTCTTGGATTTGTCCTTCTGAGG + Intergenic
1193593997 X:83423316-83423338 CTCATGGAGAACCTCTTCTGAGG + Intergenic
1194579347 X:95652607-95652629 TTCTTGGTGGTCATCTGCTGGGG - Intergenic
1194926548 X:99832303-99832325 CACATGGATGTCTTCTTTTGAGG - Intergenic
1195062433 X:101209496-101209518 GTCTTGGGGGTCTCCTGCTGGGG - Intergenic
1197837261 X:130708818-130708840 CTTTTGGAGGGTTTCTTTTGAGG + Intronic
1198932416 X:141875735-141875757 TTCATGGAGTTGTTCTTCTGAGG - Intronic
1198937762 X:141916749-141916771 CTCATGGAGCTTTTCTTCTGAGG - Intergenic
1198958803 X:142161710-142161732 CACATGGAGTTGTTCTTCTGAGG + Intergenic
1198961289 X:142186115-142186137 CTCATGGAGCTTTTCTTCTGAGG + Intergenic
1199023010 X:142904586-142904608 CTCTTGGAGCACTTTCTCTGGGG - Intergenic
1199117377 X:144008576-144008598 CTCATGGAGGACTTCTACTAGGG - Intergenic
1199141434 X:144318126-144318148 GTCTTGGATGTTTTCTTCTTTGG + Intergenic
1201289435 Y:12408378-12408400 CTCTTGGAGTGCTGCTTCTGGGG - Intergenic
1201893142 Y:18964600-18964622 CTCTTGGACCTCCTCTACTGAGG + Intergenic