ID: 1184080221

View in Genome Browser
Species Human (GRCh38)
Location 22:42214096-42214118
Sequence GCACACTGCCTTGCCCACAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184080221 Original CRISPR GCACACTGCCTTGCCCACAC TGG Exonic
900186404 1:1335136-1335158 GCACGCCGCCAGGCCCACACAGG + Exonic
901089604 1:6632584-6632606 ACACCCTGCCTCGGCCACACAGG - Intronic
901592151 1:10353544-10353566 GCACACTGCCTTCCCACCACAGG + Intronic
902893148 1:19459596-19459618 GCACAGTGCCCGGCCCACAGTGG - Intronic
903501555 1:23802854-23802876 GCACAGGGCCTGGCCCACAGAGG + Intronic
903587267 1:24425642-24425664 GCACTCAGCCTGGGCCACACAGG - Intronic
903834409 1:26193607-26193629 GCACAGTGCCTGGCACGCACAGG + Intronic
904032501 1:27541968-27541990 ACACAGTGCCCTGCCCCCACAGG - Intronic
904439769 1:30522649-30522671 GCACACGGCATTTCCCAAACTGG + Intergenic
904791258 1:33023369-33023391 TCTCACTGTGTTGCCCACACTGG - Intronic
904799666 1:33083445-33083467 GCTCACTGCCTTCCAAACACAGG - Intronic
906485182 1:46229171-46229193 TCTCACTGTGTTGCCCACACTGG - Intergenic
907310215 1:53534789-53534811 GCACACTGCCAGGCACACAGAGG - Intronic
907392433 1:54167008-54167030 GCTCAGTGCCTAGCCCACAGGGG - Intronic
909490042 1:76216049-76216071 ATCCACTGCCTTGGCCACACTGG + Intronic
909962782 1:81868033-81868055 ACACACAGCCTTGCCCAAAGTGG - Intronic
909966059 1:81912099-81912121 TCTCACTCCCTTGCCCACGCTGG + Intronic
913057959 1:115179450-115179472 GCTTGCTGCCTTGCCCACAGAGG - Intergenic
914095591 1:144541901-144541923 TCTTGCTGCCTTGCCCACACTGG - Intergenic
914302930 1:146391993-146392015 TCTTGCTGCCTTGCCCACACTGG + Intergenic
915247675 1:154568010-154568032 GCTCGCTGCCTCGCCTACACCGG - Exonic
915292683 1:154897158-154897180 CCACGCTTCCTTTCCCACACTGG + Intergenic
916040556 1:160957609-160957631 GCACAATGCCTGGCACACAGTGG + Intergenic
916313967 1:163427143-163427165 GCCCACTGCCTTTCCTAGACTGG - Intergenic
916730832 1:167565261-167565283 GAACAGTGCCTGGGCCACACAGG + Intergenic
916813869 1:168331893-168331915 TCTCACTACCTTGCCCAGACTGG + Intergenic
917949471 1:180015564-180015586 TCGCACTGTGTTGCCCACACTGG + Intronic
918528784 1:185494590-185494612 TCTCACTGTCTTGCCCAGACTGG + Intergenic
919848369 1:201655765-201655787 ACACGCTGCTGTGCCCACACTGG - Intronic
920742468 1:208594540-208594562 GCACACTGCCTTGCACAGGTAGG - Intergenic
922727223 1:227928077-227928099 ACCCACCGCCTTGCCCACACTGG + Intronic
922974399 1:229771496-229771518 GCCCACAGCCTTGCCCCCACTGG - Intergenic
923091441 1:230744163-230744185 GCACACTTCCTCACCCACACTGG - Intergenic
923664330 1:235985955-235985977 TCTCACTGTCTTGCCCACTCTGG + Intronic
1063768220 10:9167596-9167618 GCACAGAGCCTTACCCACAGTGG - Intergenic
1064364084 10:14691480-14691502 GCTCACTGCCTGGCTCATACTGG - Intronic
1065407785 10:25388801-25388823 GCCCCCTCCCTTGCCCACACAGG + Intronic
1067009274 10:42694262-42694284 GCTCACTCTCTTGCCCAGACTGG - Intergenic
1067943736 10:50677639-50677661 GCCCCCAGCCTCGCCCACACAGG - Intergenic
1069619231 10:69826244-69826266 TCACACTGCCTGCCCCACCCTGG - Intronic
1070456951 10:76626821-76626843 GCACACAGCCTGGCCCAAAATGG - Intergenic
1071022020 10:81068679-81068701 GCACCCTGCCTTGGGCAAACAGG - Intergenic
1071135897 10:82454027-82454049 GCACAATGCCATGCCCAGAAAGG - Intronic
1071931271 10:90473832-90473854 TCTCACTGTGTTGCCCACACTGG + Intergenic
1072618706 10:97066222-97066244 GGACAGTGCCTGGCCCACAGTGG + Intronic
1072703113 10:97659227-97659249 TCTCACTGCGTTGCCCAGACTGG + Intronic
1074849031 10:117423988-117424010 GCACACTGCCTTGCCAGCTTTGG + Intergenic
1075098692 10:119490546-119490568 GCACAGTGCCTTGCGCACAGCGG - Intergenic
1075423556 10:122324424-122324446 GCACATGGCCTCGCCCACCCTGG - Intronic
1075757131 10:124821711-124821733 ACCCACAGCCTTGCCAACACTGG - Intronic
1076878302 10:133227644-133227666 GCAGACTGTCTAGCCCACAGTGG - Intergenic
1077140794 11:1023975-1023997 GCACACACCCTTGTCCAGACAGG + Exonic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1079391967 11:20029637-20029659 GCACAGTGCCTGGCACACAGGGG + Intronic
1080393815 11:31871868-31871890 ACACACTGCCTAGCCCAGAAAGG - Intronic
1080445031 11:32330916-32330938 GCACAATGCCTGGCACACAGTGG - Intergenic
1081267391 11:41042532-41042554 GCACACTTCCTTGCCGCAACTGG + Intronic
1081474398 11:43411490-43411512 GCTCACTGACATCCCCACACTGG + Intronic
1081799229 11:45846536-45846558 GTACAGTGCTTTGCACACACTGG + Intergenic
1081859128 11:46322180-46322202 GCACAGTGCCTGGACCACAGTGG - Intergenic
1083636848 11:64125402-64125424 GCACAGTGCCTGGCACACAGGGG + Intronic
1084489067 11:69468455-69468477 GCACAGCGCCTGGCCCACAGTGG - Intergenic
1084535402 11:69753393-69753415 GCACACTGCGTTTCTCACCCTGG + Intergenic
1084734833 11:71097883-71097905 ACACACAGCCATGCACACACAGG - Intronic
1085831262 11:79903358-79903380 CCACAGTGCTTGGCCCACACTGG + Intergenic
1085958219 11:81427349-81427371 TCTCACTGCATTGCCCAGACTGG + Intergenic
1086952928 11:92909347-92909369 GAACACTGTCTTGCCCACCTAGG - Intergenic
1087386901 11:97483155-97483177 GCCCACTGCCTCCCCCACACTGG + Intergenic
1088214122 11:107489290-107489312 GCACAATGCCTGGCACACAGTGG + Intergenic
1089372363 11:117970474-117970496 GCCCACTGCCTAGCACACAGTGG + Intergenic
1090882516 11:130846471-130846493 TCCCACTGCATTGCCCAGACAGG - Intergenic
1093236243 12:16611067-16611089 GCACACACACTTGCACACACAGG - Intergenic
1093394745 12:18667648-18667670 GCACAATGCCTTGTACAAACTGG - Intergenic
1094533829 12:31303507-31303529 TTTCACTGCATTGCCCACACTGG + Intronic
1094677827 12:32638164-32638186 TCTCACTACATTGCCCACACTGG - Intronic
1095927607 12:47594435-47594457 GCACCCTGCCTTGCCCATAGTGG - Intergenic
1097260868 12:57719443-57719465 GCACTCTGCCTGGCACACAATGG + Intronic
1097400479 12:59122479-59122501 GCACAGTGCCTTGCACATAATGG + Intergenic
1098293125 12:68977993-68978015 GCACACAGCCTAGCACACAGAGG - Intergenic
1101388211 12:104276653-104276675 GCACAGTGCCTTTCCCATAATGG - Intronic
1101877213 12:108603717-108603739 GCACAGTTCCTGGCACACACAGG - Intergenic
1101981092 12:109407372-109407394 GCACAGTGCCTGGCACACATGGG + Intronic
1102206645 12:111095427-111095449 TCTCACTCTCTTGCCCACACTGG - Intronic
1102765714 12:115431287-115431309 TCTCACTGCCTTGCCCAGGCAGG - Intergenic
1103118872 12:118363711-118363733 ACACACTGCCTTGACCAGACTGG - Intronic
1103276833 12:119718816-119718838 GGACCCTGCTTTACCCACACAGG - Exonic
1103323210 12:120103467-120103489 GCGAAGTGCCTTGCCCACCCAGG - Intronic
1103483423 12:121266126-121266148 TCTCACTACATTGCCCACACTGG + Intronic
1105789798 13:23787321-23787343 GCAAACTGCCATCTCCACACTGG - Intronic
1108162896 13:47661228-47661250 TCATACTTCCTTGCCCCCACTGG + Intergenic
1110431045 13:75424065-75424087 TCTCACTGTGTTGCCCACACTGG - Intronic
1112553218 13:100442592-100442614 GAACACTGCCTAGGCCATACTGG - Intronic
1112802868 13:103131913-103131935 TCACATTGCCTTGGCCAAACTGG + Intergenic
1113800790 13:113085401-113085423 GCACACAGCCCAGCCCACATGGG + Intronic
1113833268 13:113313511-113313533 GCACACTGGCATCTCCACACTGG - Intronic
1113833319 13:113313703-113313725 GCACACTGACATCTCCACACTGG - Intronic
1113833344 13:113313799-113313821 GCACACTGACATCTCCACACTGG - Intronic
1113833528 13:113314471-113314493 GCACACTGGCATCTCCACACTGG - Intronic
1113833627 13:113314855-113314877 GCACACTGGCATCTCCACACTGG - Intronic
1113833652 13:113314951-113314973 GCACACTGGCATCTCCACACTGG - Intronic
1114659713 14:24336300-24336322 GACAACTGCCTTGCCCACATGGG - Exonic
1115750180 14:36481619-36481641 GCACAATGCCTGGCACACAGTGG + Intronic
1115878445 14:37888436-37888458 GCACACTGCCAGGCCCCCAGAGG - Intronic
1116666195 14:47778944-47778966 CAACACTGCCTTGCATACACAGG + Intergenic
1117538263 14:56721894-56721916 GCATCCTCCCTTGCCCACAGTGG - Intronic
1118719899 14:68586537-68586559 TCACACTGCTTTGCCAACATGGG - Intronic
1118935384 14:70283319-70283341 GCACACTGCCATTGCCACTCAGG - Intergenic
1119311731 14:73652469-73652491 TCTCACTGCCTTGCCCAGGCTGG + Intronic
1119608008 14:76037326-76037348 TCACACAGCCCTGCCCCCACTGG - Intronic
1119891522 14:78186053-78186075 GGACACTGCCTGGCTGACACTGG + Intergenic
1120226667 14:81798154-81798176 TCTCACTGTCTTGCCCAGACTGG + Intergenic
1121947445 14:98136719-98136741 GCACACACCCATGCACACACAGG + Intergenic
1122899090 14:104774747-104774769 GCACAGCCCCTAGCCCACACTGG + Intronic
1127850217 15:62905334-62905356 GCCCACTGCCCTGGTCACACGGG + Intergenic
1128179905 15:65593057-65593079 TCTCACTGTGTTGCCCACACTGG - Intronic
1128534733 15:68481895-68481917 GCACACTGCCTGGCACCCAGTGG + Intergenic
1133150780 16:3827885-3827907 TCTCACTGTGTTGCCCACACTGG + Intronic
1133421839 16:5653064-5653086 GCACCCCACCTTGCTCACACAGG - Intergenic
1133526149 16:6607680-6607702 GCACACTCACATGCCCACATAGG - Intronic
1134373042 16:13643475-13643497 ACACACAGCCATGCACACACAGG - Intergenic
1134373050 16:13643599-13643621 GCACACAGGCATGCACACACAGG - Intergenic
1136225116 16:28855162-28855184 ACACCATGCCTTTCCCACACTGG + Intronic
1137735693 16:50721292-50721314 GCACAACGCCTGGCCCAGACAGG - Intronic
1138352000 16:56350945-56350967 GCACACAGGCATGCACACACAGG + Intronic
1138489732 16:57369736-57369758 CCACATTGCCTGGCACACACCGG + Intergenic
1138542172 16:57695079-57695101 TAAGACTGCCTTCCCCACACTGG + Intronic
1138583514 16:57956544-57956566 GGACACAGCCTTGCAGACACAGG + Intronic
1138601588 16:58058264-58058286 CCACATTGCCTTGCCCACTGGGG + Intergenic
1139371386 16:66471479-66471501 GGACACTGCCTTGAGCCCACGGG - Intronic
1140347701 16:74230266-74230288 TCTCACTGCATTGCCCAGACTGG + Intergenic
1140470886 16:75213708-75213730 CCAGACTCCCTCGCCCACACGGG - Intergenic
1141002109 16:80317838-80317860 CCAGGCAGCCTTGCCCACACTGG - Intergenic
1141204720 16:81924949-81924971 GCACACTGGCGTTCCCTCACTGG + Intronic
1141726017 16:85788934-85788956 GCTCACTTCCTCGCCCACAGAGG + Intronic
1141786414 16:86203716-86203738 GGACCCTGCCCTGGCCACACAGG - Intergenic
1144753065 17:17663364-17663386 GCACACTGCCTTGAACACGCAGG + Intergenic
1145108113 17:20137127-20137149 GCACACGGCCATGGCCAAACAGG - Intronic
1145229035 17:21157662-21157684 TCTCACTTTCTTGCCCACACTGG - Intronic
1145779278 17:27551713-27551735 CCACAGGGCCTTGCCCACACAGG - Intronic
1146516971 17:33497013-33497035 GCACTTTGCCTAGCCCACAGTGG + Intronic
1146592229 17:34137477-34137499 GCTCTCTGCCTTGCCTCCACAGG - Intronic
1146703257 17:34980660-34980682 GCCCGCTGCCTTCCCCACGCCGG - Intronic
1146915404 17:36675284-36675306 ACACACTGTCATGCACACACAGG - Intergenic
1147008127 17:37421183-37421205 TCTCACTGTGTTGCCCACACTGG - Intronic
1147184056 17:38704295-38704317 TCACCCCCCCTTGCCCACACAGG + Intergenic
1148678661 17:49460079-49460101 GCACAGTGCCTGGCCCACAGAGG + Intronic
1148847493 17:50537937-50537959 GCACACTGCTTGGCCCACGGGGG + Intronic
1148886817 17:50779821-50779843 TCTCACTGCCTTGCCCAGGCTGG - Intergenic
1149882789 17:60309570-60309592 TCTCACTTCATTGCCCACACTGG - Intronic
1151912936 17:77096090-77096112 TCTCACTGTCTTGCCCAGACTGG + Intronic
1152257343 17:79247939-79247961 GCACAGTGCCTGGCCCACAATGG + Intronic
1152257353 17:79247983-79248005 GCACAGTGCCTGGCCCACAATGG + Intronic
1152599588 17:81255304-81255326 GCACACAGCCTTCTCCACAACGG + Intronic
1152803333 17:82342320-82342342 GCACACAACGTTCCCCACACGGG - Intergenic
1152875912 17:82786106-82786128 GGACACTGCTTTGGCCCCACGGG - Intronic
1154489575 18:14909292-14909314 TGTCACTGCCTTCCCCACACTGG - Intergenic
1154927294 18:20949426-20949448 CCACTCTGCATTGCCCACATGGG - Exonic
1155826135 18:30445672-30445694 GCACACTCACTTTCTCACACTGG - Intergenic
1157446389 18:47749479-47749501 TCACACTGGCTGGCCCACGCAGG + Intergenic
1158987385 18:62832142-62832164 GCACAGTGCCTTCCCCAAAGAGG - Intronic
1160452602 18:78975677-78975699 GCTAACTGCCCTGTCCACACTGG - Intergenic
1160482422 18:79254397-79254419 ACACACTGCACTGCCCTCACAGG + Intronic
1161271057 19:3389542-3389564 CCACACTGCCTGGAGCACACAGG - Intronic
1161336320 19:3715686-3715708 GCACCCTGCATTGCCCAGAATGG - Intronic
1161643012 19:5436066-5436088 GCACAATCACTTGCCCATACGGG - Intergenic
1161744597 19:6047997-6048019 GCACCCTGCCGTGCCCAGAATGG - Intronic
1162712814 19:12608803-12608825 TCTCACTACATTGCCCACACTGG + Intronic
1163685573 19:18710023-18710045 CCACACTTCTTTGCCCACCCTGG + Intronic
1163696718 19:18768056-18768078 GCCCAAAGCCTTGCCCACTCTGG - Intronic
1164932210 19:32184590-32184612 TCTCACTGTCTTGCCCAGACTGG + Intergenic
1165776932 19:38410175-38410197 GAACACTTCCCTGCCCAGACTGG + Intronic
1165868580 19:38954230-38954252 GCACACACCCTTGCCCACTTTGG - Intronic
1166773352 19:45297847-45297869 GCCCCCTGCCTCTCCCACACTGG + Exonic
1167061415 19:47149456-47149478 CCACCGTGCCCTGCCCACACTGG + Intronic
1167077776 19:47259675-47259697 GAACGCTGCCTGGCCCACAAGGG - Intronic
1168635799 19:57995787-57995809 TCACACTGCATTGCCCATACTGG - Intronic
925700617 2:6633706-6633728 GCTCACTGCCTTGTCCTCACAGG + Intergenic
926468762 2:13226661-13226683 GCAGACTGCCTTTCCCAGAATGG - Intergenic
926867549 2:17376126-17376148 GCACTCTAGCTTGCCTACACAGG - Intergenic
927036940 2:19187808-19187830 ACACACTGCTGTGCACACACAGG - Intergenic
927074953 2:19568201-19568223 GCACACTGCATTTCCCTCACTGG + Intergenic
927466422 2:23340215-23340237 GCACATAGCCTGGCACACACTGG - Intergenic
927505027 2:23607275-23607297 GCACACTGCCCAGACCACACAGG + Intronic
927549448 2:23985131-23985153 TCTCACTGTGTTGCCCACACTGG + Intronic
928216667 2:29367193-29367215 GCACAGAGCCTGGCACACACTGG - Intronic
928323397 2:30301577-30301599 CCAGACAGCCTTGCCCACAGTGG - Intronic
929329623 2:40665579-40665601 TCACAATTCCTTGCCCTCACAGG + Intergenic
929675883 2:43928730-43928752 TCACACTGTGTTGCCCAGACTGG - Intronic
930629715 2:53738999-53739021 GAACACTGCTTTTCCCACAATGG + Intronic
930735306 2:54772789-54772811 GAACACTGCCTTTCTCACACAGG + Intronic
930758171 2:55000538-55000560 GCACAGTGCCTTGCTCAGACTGG - Intronic
932657264 2:73620875-73620897 GCAGAGAGCCTTGGCCACACAGG + Intergenic
932663941 2:73681123-73681145 GCAGAGAGCCTTGGCCACACAGG + Intergenic
933842526 2:86298857-86298879 GCACTCTGCCTTGCTGACCCAGG - Intronic
934712106 2:96523035-96523057 GGCCGCTGCCTTGCCCCCACAGG - Intergenic
935641669 2:105296566-105296588 ACACACTGCTTTCCCCAAACTGG + Intronic
935694140 2:105756576-105756598 GCACACTGACTGGCCCACTGGGG + Intronic
936466278 2:112754023-112754045 GCACAGTGCCTAGCACACATAGG + Intronic
936608239 2:113978377-113978399 TCACCCTCCCTAGCCCACACAGG - Intergenic
937060639 2:118978024-118978046 GAGCACTGCCTTGCCCTCAGTGG - Intronic
937396458 2:121540440-121540462 TCTCACTATCTTGCCCACACTGG - Intronic
937399224 2:121567236-121567258 GGACAGTGCCTGGCCCACAGCGG - Intronic
937880428 2:126860259-126860281 TCACAATGCCTGGCACACACTGG + Intergenic
939224246 2:139344910-139344932 TCTCACTGTCTTGCCCAGACTGG - Intergenic
943289454 2:186050075-186050097 GCACAATGCCTTGCACATAGTGG - Intergenic
943341232 2:186684506-186684528 TCTCACTGTCTTGCCCAGACTGG - Intergenic
943432171 2:187817403-187817425 ACACAGTGGCTTGCCCACATTGG - Intergenic
944606939 2:201360497-201360519 GAACACTGTCTTTTCCACACTGG - Intergenic
946354778 2:219177974-219177996 GCCCACTTCCTGCCCCACACGGG + Exonic
948426075 2:237887158-237887180 ACCCACTGCCCTCCCCACACAGG - Intronic
948634143 2:239323542-239323564 GCACAGTGCCTTCCACACACAGG - Intronic
1168956722 20:1839350-1839372 GCAAGCTGCCTGGACCACACAGG - Intergenic
1170812578 20:19686168-19686190 CCAAGCTGCCTTGCCCACACGGG - Intronic
1171023643 20:21609344-21609366 GCACAGTGACTAGCACACACAGG - Intergenic
1172234568 20:33361924-33361946 GCTCACTCTGTTGCCCACACTGG - Intronic
1173518642 20:43682897-43682919 GGACAGTGCCTTGCACACAGTGG + Intronic
1173892183 20:46521123-46521145 GCAGACTGGCAAGCCCACACTGG + Intergenic
1174202929 20:48819806-48819828 GCACAGTGCCTGGCACACAGTGG + Intronic
1174485589 20:50859333-50859355 GAACAGTGCCTAGCTCACACAGG - Intronic
1175949496 20:62575822-62575844 GCACACTGGCTTGTGCACACAGG + Intergenic
1175986991 20:62768973-62768995 GCTCCCTGCCTTCCCCTCACCGG - Intergenic
1176305187 21:5119505-5119527 GCACAGTGCCTGGCACACAGGGG - Intronic
1178580092 21:33831230-33831252 GCTCCCTGGCTTGCCCACATGGG + Intronic
1179851867 21:44142525-44142547 GCACAGTGCCTGGCACACAGGGG + Intronic
1180787635 22:18555880-18555902 GCCCACTGCCTGGCCCTGACAGG + Intergenic
1181234104 22:21439426-21439448 GCCCACTGCCTGGCCCTGACAGG - Intronic
1181234478 22:21441365-21441387 GCCCACTGCCTGGCCCTGACGGG - Intronic
1181244543 22:21495405-21495427 GCCCACTGCCTGGCCCTGACAGG + Intergenic
1181368791 22:22399892-22399914 GGACACAGCCATGCCCATACAGG + Intergenic
1181446984 22:22984682-22984704 CAACACAGCCTTGTCCACACTGG - Intergenic
1181784891 22:25219871-25219893 GCACAGTGCCTGGCACACAGTGG + Intronic
1182173727 22:28261037-28261059 TCCCACTGCCTGGCCCACTCAGG + Intronic
1182542185 22:31049727-31049749 TCTCACTGTGTTGCCCACACTGG + Intergenic
1182558703 22:31142683-31142705 GCACCCTGCCTCACCCAGACAGG - Intergenic
1183108860 22:35633796-35633818 GCACACACTCTTGCACACACGGG - Intronic
1183262696 22:36806088-36806110 GCACAGTGCCTGGCACACAGTGG + Intronic
1183337895 22:37261095-37261117 GGACACTGCCATGGCCCCACCGG - Intergenic
1183349506 22:37326981-37327003 GCACAATCCCTGCCCCACACTGG + Intergenic
1183954524 22:41371391-41371413 CCACACTGCCTTGCCTAGAAAGG - Intronic
1183974174 22:41501031-41501053 TCTCACTCTCTTGCCCACACTGG + Intronic
1184080221 22:42214096-42214118 GCACACTGCCTTGCCCACACTGG + Exonic
1184248813 22:43248937-43248959 GCACAGGGCCTTGCCCAGAGCGG - Intronic
1184310212 22:43636409-43636431 ACACAGTGCCTGGCACACACGGG - Intronic
1185056963 22:48586165-48586187 GCACCCTCCCTTGACCTCACTGG - Intronic
1185074645 22:48676680-48676702 CCACACTGGCTAGTCCACACTGG - Intronic
952504825 3:33998364-33998386 CCACACTTCCTTGCACACCCTGG - Intergenic
952981592 3:38740536-38740558 CCACACTGACTTGCCTACAAGGG - Intronic
953134594 3:40171773-40171795 GCACAGTGCCTTGCACATAGTGG - Intronic
954287280 3:49627920-49627942 GCATACTACCCAGCCCACACAGG - Intronic
956468419 3:69541687-69541709 GCACACTGCCTCTCCAACATAGG + Intronic
957885626 3:86283180-86283202 GCAGGCTGCCTAGCCCACAGTGG + Intergenic
958644393 3:96851096-96851118 ACACACTGCCTTTCCCACCATGG - Intronic
960027874 3:113029448-113029470 GGACACTGATTTACCCACACCGG + Intergenic
960337449 3:116435599-116435621 GCACACTGTCTTCACCACTCAGG + Intronic
961817368 3:129558129-129558151 TCATACTGGCTTTCCCACACCGG + Intronic
962149642 3:132879350-132879372 GCACAGTGCCTGGCACACAGAGG + Intergenic
962565245 3:136651167-136651189 GCTCACTGCGTTGCCCATGCTGG - Intronic
962759822 3:138499965-138499987 TCTCACTGCCTTGCTCAGACTGG + Intronic
963138740 3:141930791-141930813 GCACAGTGCCTAGCACACAGTGG - Intergenic
963741440 3:149085997-149086019 GCACAATGCCTGGCGCACAGTGG + Intronic
964502996 3:157369014-157369036 GCACAGTGCTTGGCACACACAGG + Intronic
964548069 3:157857107-157857129 GTACCCTGCCTTTCCCAAACAGG + Intergenic
964852500 3:161109898-161109920 GCAAACTGCATTTCCCAAACTGG + Intronic
967370221 3:188735904-188735926 CCAAACTACCTTGTCCACACAGG - Intronic
967775861 3:193385136-193385158 GCACACTGCCCTGGGCACTCTGG - Intergenic
968446761 4:656030-656052 CCCCACAGCCTTGCCCTCACTGG + Intronic
969237083 4:5873180-5873202 GCCCTCTGCATTTCCCACACTGG - Intronic
969449284 4:7264006-7264028 GCACTCGGCCTGGCACACACTGG - Intronic
969871545 4:10107843-10107865 GCACCCAGCCCTGCCAACACAGG + Intronic
970372603 4:15423344-15423366 GCACAGTGCCTGGCACACACAGG + Intronic
972010372 4:34172253-34172275 GCAAACTGCCATATCCACACTGG + Intergenic
974912424 4:68138670-68138692 CCACCATGCCTAGCCCACACTGG + Intergenic
976402081 4:84618779-84618801 CCCCACTGCCCTGCACACACTGG - Intronic
977999583 4:103540694-103540716 GCAAACTGGTTTGACCACACTGG - Intergenic
978436913 4:108695474-108695496 TCACACTGTCTTGCCCAGGCTGG + Intergenic
979342524 4:119543455-119543477 GCACAATGCCTATCCCACAGTGG - Intronic
980121906 4:128736091-128736113 TCACACTGTCTTGCCCAGGCTGG + Intergenic
989628605 5:43457926-43457948 TCTCACTGTGTTGCCCACACTGG + Intronic
989755479 5:44948150-44948172 GCACACTGCCTTCCCAACATAGG - Intergenic
990548773 5:56851277-56851299 GCACAATGCCTGGCACACAGGGG - Intronic
991703576 5:69337085-69337107 GCTCACTGCATTGCCCAGGCTGG - Intergenic
998130666 5:139649687-139649709 GCACGCTGCGTGGCCCACGCGGG - Intronic
998633634 5:143928363-143928385 TCACACTGTCTTGCCAAGACTGG - Intergenic
999046185 5:148472267-148472289 GCACAATGCCTGGCACACAGTGG + Intronic
999212220 5:149899757-149899779 ACACACTGCCTGACACACACTGG - Intronic
999232218 5:150068396-150068418 GCACACTGCCTGGAACACAGTGG + Intronic
999770125 5:154769406-154769428 GCAGACTGCCTAGCTCACAGAGG + Intronic
1000171675 5:158708398-158708420 GCACACTGCCTGGCACACAGTGG - Intronic
1000255393 5:159533444-159533466 GAACAGTGCCTTGCCCTCAGGGG + Intergenic
1001234067 5:170014707-170014729 GCACACTGCTTTTCCCACCTTGG - Intronic
1001248094 5:170120715-170120737 GAGCACTGACTTGCCCTCACTGG - Intergenic
1001740853 5:174051616-174051638 GCACAGTGCCTGGCTCACAGAGG - Intronic
1001930300 5:175668194-175668216 CCACAGTGCTTGGCCCACACTGG - Intronic
1002536207 5:179877187-179877209 TCTCACTGTCTTGCCCAGACTGG - Intronic
1002548066 5:179965274-179965296 GCACAGTGCCTGGCACACAGTGG + Intronic
1002585065 5:180240290-180240312 GCACAGTGCCTTGTCCATAATGG - Intronic
1003768804 6:9273770-9273792 TCTCACTGTGTTGCCCACACTGG - Intergenic
1004527120 6:16419535-16419557 GCACACTGCCATACCCACCCTGG - Intronic
1006023296 6:31130741-31130763 TCACACTATGTTGCCCACACTGG + Intronic
1006395221 6:33782785-33782807 GCACAGTGCCCAGCCCACAGCGG + Intronic
1006583170 6:35088247-35088269 CCAAACTGATTTGCCCACACTGG - Intronic
1007683590 6:43651138-43651160 GCACATTGCCTAGCACACCCAGG - Intronic
1010808482 6:80267517-80267539 TCAGACTTCCTTCCCCACACTGG - Intronic
1013548474 6:111183450-111183472 GCGCAGTGCCTAGCACACACTGG + Intronic
1016386264 6:143533646-143533668 GCACAGTGCCTGGCCCAAAAAGG + Intergenic
1018981157 6:168602783-168602805 GCACCCTGACCTGCCCTCACTGG - Intronic
1019411921 7:910444-910466 GCTCACTGCGTTGCCCAGGCTGG + Intronic
1019623648 7:2004349-2004371 GCACACTGTCCTGGGCACACAGG + Intronic
1019948089 7:4346162-4346184 ACACACTTCTTTGACCACACTGG + Intergenic
1021606348 7:22413128-22413150 GCACAGTGCCTGGCACACAGAGG + Intergenic
1023162224 7:37308649-37308671 GCACAGTACCTGGCACACACTGG + Intronic
1023190421 7:37574499-37574521 TCTCACTTCCTTGCCCAGACTGG - Intergenic
1024198940 7:47087560-47087582 CCACAGTGCCCTTCCCACACTGG - Intergenic
1025782452 7:64613848-64613870 TGCCAGTGCCTTGCCCACACGGG + Intergenic
1025854314 7:65264600-65264622 GCTGACTGCTTTGCACACACGGG - Intergenic
1026771386 7:73202747-73202769 GCACAGTGCCTGGCACACATGGG + Intergenic
1027012252 7:74756144-74756166 GCACAGTGCCTGGCACACATGGG + Intronic
1027075788 7:75189910-75189932 GCACAGTGCCTGGCACACATGGG - Intergenic
1029258560 7:99285969-99285991 GGACACTGTCTTGCCCACACTGG - Intergenic
1029906979 7:104102204-104102226 GCACAGTGCCTTGCTCACAGTGG + Intergenic
1030291808 7:107880433-107880455 GGACACTACCTTGCCACCACTGG + Intergenic
1032022488 7:128416716-128416738 GCACAGTGCCTTGCCCATAGTGG - Intergenic
1032105152 7:129022100-129022122 GTAAACTGCCTTGCCCAACCAGG - Intronic
1033454732 7:141492489-141492511 GCACAATGCCTGGCACATACTGG + Intergenic
1034005728 7:147469997-147470019 TCACTCTGCCTTGTCCACAACGG - Intronic
1034446904 7:151118410-151118432 ACACACAGCCTTGCTCTCACTGG - Intronic
1035582044 8:746542-746564 GGACACTGCCATGACCACAGTGG - Intergenic
1035651746 8:1271356-1271378 GCACAATGCATGGCACACACTGG + Intergenic
1036709822 8:11071136-11071158 CCTCACTGCTTTGCCCACCCAGG - Intronic
1037401832 8:18501755-18501777 TCTCACTGCATTGCCCAGACTGG - Intergenic
1037460933 8:19108727-19108749 TCTCACTACATTGCCCACACTGG + Intergenic
1037886914 8:22600108-22600130 GCCCACTTCCTTGCCCAGAGGGG + Intronic
1038165934 8:25085104-25085126 GCACACTGCCCTGCCTAGACTGG - Intergenic
1038332251 8:26618225-26618247 GCAAAATGCCTGGCACACACTGG - Intronic
1038416904 8:27403709-27403731 GCACCCAGACGTGCCCACACAGG + Intronic
1039316603 8:36380252-36380274 GCACACTCCCTTCCCAACCCAGG - Intergenic
1040520792 8:48174356-48174378 GCACAATGCTTTGGCAACACTGG + Intergenic
1041086139 8:54258434-54258456 GGACACTCTCTTGCCCAGACTGG + Intergenic
1041360340 8:57046352-57046374 GCACAGTGCCTTTCCAATACAGG - Intergenic
1046401591 8:113712086-113712108 TCTCACTGCATTGCCCACACTGG - Intergenic
1046794674 8:118357946-118357968 TCTCACTACATTGCCCACACTGG - Intronic
1047770767 8:128028193-128028215 GCACCCTGCCTTGCGCGCTCGGG - Intergenic
1048383301 8:133887852-133887874 GCACAATGCCTGGCTCACAGTGG - Intergenic
1048997932 8:139805527-139805549 GCACAGTGCCAAGCCCACACTGG - Intronic
1054328216 9:63728568-63728590 GCACACTGGCTTTCCCAGCCTGG + Intergenic
1055775642 9:79764470-79764492 GCTCACTGCCTTGGTCACAGGGG - Intergenic
1057283412 9:93728496-93728518 GCTCACACCCTTGCCCACCCTGG - Intergenic
1058603011 9:106691416-106691438 CCACACTCCCTTGCCCCGACAGG - Intergenic
1059728932 9:117037094-117037116 GCACAGTGCCTTGTCCATAATGG - Intronic
1059950729 9:119459942-119459964 GCATAATGCCTGGCCCACAGTGG - Intergenic
1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG + Intergenic
1060093423 9:120765122-120765144 TCTCACTGTGTTGCCCACACTGG + Intronic
1060317138 9:122522731-122522753 GCACACTGCCTGGCACAGACAGG - Intergenic
1060547976 9:124471749-124471771 GCACAGTGCCTGGCACACACTGG - Intronic
1060578106 9:124716830-124716852 CCATGTTGCCTTGCCCACACTGG + Intronic
1061267057 9:129512393-129512415 GCACAGTGCCTGGCCCACACAGG - Intergenic
1061383762 9:130276227-130276249 GCACCCTGCCTGGCCCCCAGGGG - Intergenic
1062365404 9:136205847-136205869 GACCACTGCCCTGCCCCCACTGG + Intergenic
1062499758 9:136847384-136847406 GAACCCTGCCCTGCCCACTCAGG + Exonic
1186191700 X:7073104-7073126 GCACCCTGCCTGGCACACAGTGG + Intronic
1187500146 X:19832738-19832760 GCCTGCTGCCATGCCCACACTGG + Intronic
1187701951 X:21971164-21971186 GCACTCTGTCTTGCCCAGGCTGG - Intronic
1189269274 X:39739474-39739496 ACACACAGCCTTACCCACAAAGG + Intergenic
1189350530 X:40272417-40272439 GCCATCAGCCTTGCCCACACAGG + Intergenic
1190151591 X:47954477-47954499 GCACCATGCCCTGCCCACAGTGG - Intronic
1192259736 X:69498076-69498098 CCACCATGCCTGGCCCACACTGG - Intergenic
1192860681 X:75067161-75067183 TTACACAGCCTTGCCCAAACTGG + Intronic
1199853249 X:151740078-151740100 ACCCACTTCCTTGCCCACAGTGG - Intronic
1200793825 Y:7322610-7322632 TCTCACTGTGTTGCCCACACTGG - Intergenic
1200901023 Y:8432261-8432283 TCACAATGCCTTCCCAACACAGG + Intergenic