ID: 1184080815

View in Genome Browser
Species Human (GRCh38)
Location 22:42218780-42218802
Sequence CAGGGAAAACAGATACAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184080805_1184080815 25 Left 1184080805 22:42218732-42218754 CCACTTTAAACATCAGGGTATCA 0: 1
1: 0
2: 0
3: 18
4: 145
Right 1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG No data
1184080808_1184080815 0 Left 1184080808 22:42218757-42218779 CCTGAGGCTGCCCTATCTCCAGA No data
Right 1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG No data
1184080811_1184080815 -10 Left 1184080811 22:42218767-42218789 CCCTATCTCCAGACAGGGAAAAC 0: 1
1: 0
2: 0
3: 15
4: 191
Right 1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184080815 Original CRISPR CAGGGAAAACAGATACAGGA AGG Intronic
No off target data available for this crispr