ID: 1184081119

View in Genome Browser
Species Human (GRCh38)
Location 22:42220952-42220974
Sequence CAGGGTTTGGGGAAGCCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184081119 Original CRISPR CAGGGTTTGGGGAAGCCAAC AGG (reversed) Intronic
900220816 1:1508527-1508549 CAGGGTGTGGGGACCCCCACTGG - Intergenic
900225818 1:1533239-1533261 CAGGGTGTGGGGACCCCCACTGG - Intronic
900228656 1:1544796-1544818 CAGGGTCTGGGGATGCCTGCAGG - Intronic
900716784 1:4150157-4150179 CAGGGTTTGTGTAAGCGGACTGG - Intergenic
901370028 1:8789194-8789216 CAGCATTTGGGGAAGCCGATGGG + Intronic
901646607 1:10720211-10720233 GAGGGTTTGGGGAAGCGATGAGG + Intronic
903000260 1:20260428-20260450 CAGGGTTAAGGGAAGCCATAAGG + Intergenic
903353553 1:22732365-22732387 CAGGGTTTGGGGAAGCGCGTGGG + Intronic
904447490 1:30586969-30586991 CGGCGTTTGGGGAAGGCACCTGG - Intergenic
904900019 1:33849678-33849700 CAGGGTTTTGAGAGGCCAAGCGG + Intronic
904921827 1:34014020-34014042 CAGGGTTTGGGGGGATCAACGGG - Intronic
905790381 1:40786236-40786258 CAGGGCCTGGGGAAGCCAATAGG + Intronic
907301682 1:53490805-53490827 CAGGGTTGGGGGAGGGCAAGAGG - Intergenic
907460874 1:54604723-54604745 CAGGGATCGGGGCAGCCAGCAGG + Intronic
908322065 1:62987911-62987933 CAAGTTTTGGGGAGGCCAAGCGG + Intergenic
915169526 1:153968251-153968273 TAGTGTTTGGGGAGGTCAACGGG + Intronic
915543096 1:156581361-156581383 CAGGGTTGGGGGAAGACATAGGG - Exonic
916320229 1:163497368-163497390 CAGGGGTTGAGGTAGCAAACAGG + Intergenic
918403698 1:184191138-184191160 CAAGGTTTTGCGAAGTCAACAGG + Intergenic
919881677 1:201905152-201905174 TAGGGTTAGGGGAAGCCCGCAGG + Intronic
919971669 1:202584346-202584368 CATGGTTTGGGGAAGGGAAATGG - Exonic
920182295 1:204139592-204139614 CAGGGTATGGGGAAGGCCAGAGG - Intronic
920741188 1:208582710-208582732 AATGGTTTGGGGAATACAACAGG + Intergenic
920813367 1:209307707-209307729 CAGGGAGTGGGGAAGAGAACTGG + Intergenic
921479129 1:215643776-215643798 CAGCGCTTTGGGAAGCCAATGGG - Intronic
922038599 1:221873956-221873978 CAGAGTTTGGGGCATCCATCAGG + Intergenic
922360699 1:224818902-224818924 CAGGGCTTGGGGAAGAGAAAGGG - Intergenic
924455014 1:244212384-244212406 CAGGGGATGGGGGAGCCAAGAGG + Intergenic
1064640244 10:17408170-17408192 TAGGGTTTGTGCAAGCAAACTGG + Intronic
1067090560 10:43264132-43264154 CAGGGTTTGGGAAGGTCAGCTGG - Intronic
1069961421 10:72081433-72081455 CAGGTGTTGGGGAAGACAGCAGG + Intronic
1070559964 10:77558869-77558891 CATTGTTTGGGGAGGCCAACAGG - Intronic
1073088518 10:100912630-100912652 GAGGGTTTGCTGAAGCAAACCGG - Intronic
1073324182 10:102632985-102633007 CAGGGACTGGAGAAGCCAAGGGG + Exonic
1074862256 10:117519289-117519311 CAGGCTTTGGGCCACCCAACAGG - Intergenic
1075564659 10:123494671-123494693 AAGGGTTTGGGGATGGCTACAGG - Intergenic
1076361867 10:129895236-129895258 CAGGAGTTTGGGAAGCCACCTGG + Intronic
1076674148 10:132139703-132139725 CAGGGTGTGGGGAGGCACACAGG + Intronic
1076887258 10:133268453-133268475 CAGGGTATGGGGGACCCCACCGG + Intronic
1077332941 11:1991281-1991303 CAGGGCTGAGGGAAGCCAGCGGG - Intergenic
1077394540 11:2314667-2314689 AAGGGTCTGGGGAGGCCAAGGGG - Intronic
1077632449 11:3819976-3819998 CAGAGTTTGGGGAAGGCCTCAGG - Intronic
1078742055 11:14075846-14075868 CAGGGGATGGGGATGCCAAGGGG + Intronic
1079434117 11:20428739-20428761 CTGAGTTTGGGGAACCCAATGGG + Intronic
1080162296 11:29191590-29191612 CAGCATTTTGGGAGGCCAACGGG - Intergenic
1081254088 11:40871121-40871143 CAGGGTTTGAGGCAGACAACCGG - Intronic
1083299965 11:61735159-61735181 CAGGGTCTGGGGAAGAGAAGGGG - Intronic
1083608559 11:63993781-63993803 CAGTGTTTTGGGAGGCCAAGGGG - Intronic
1084703513 11:70802678-70802700 CAGGATTTGGGGCAGACACCTGG + Intronic
1085055994 11:73404251-73404273 CAGGGTTCTGGGAAGCCTAGCGG + Intronic
1085155165 11:74286618-74286640 AAGGGTTTTGGGAAGCAAAGTGG + Intronic
1085281880 11:75336331-75336353 CAGGGTGTGGGGAGGACATCAGG - Intronic
1085345157 11:75763903-75763925 CAGCATGTGGGGAAGCCACCAGG + Intronic
1085399714 11:76228505-76228527 CAGGGTCTGAGGAAGACCACAGG + Intergenic
1086124432 11:83335593-83335615 GAGGATTTGGGGGAGCTAACAGG - Intergenic
1086820998 11:91436030-91436052 CAGGGTCTGGGGAATACAGCGGG - Intergenic
1087154998 11:94893919-94893941 CTGTGTTTGTGGAAGCCATCAGG + Intergenic
1087203716 11:95372303-95372325 CAGGGTTGGGGGAAGCAGACAGG + Intergenic
1088177503 11:107070531-107070553 AAGGGAAAGGGGAAGCCAACTGG + Intergenic
1089756179 11:120689099-120689121 CAGGGCTTGGGTAAGCCACAGGG + Intronic
1090755991 11:129792487-129792509 CAGGGTTTGGGGGTGCACACAGG - Intergenic
1091272419 11:134327001-134327023 ATGGGATTTGGGAAGCCAACTGG - Intergenic
1202815924 11_KI270721v1_random:46457-46479 CAGGGCTGAGGGAAGCCAGCGGG - Intergenic
1092140733 12:6181795-6181817 CAGGGCATGGGGAAGCCAGCAGG + Intergenic
1092206080 12:6614835-6614857 CAGGGTTTGGGGAATCCCAAAGG - Intergenic
1092217188 12:6691711-6691733 CAGGGAATGGGGAAGCCCCCAGG - Intergenic
1100433652 12:94552315-94552337 CAGGGCGTGGGAAAGACAACCGG + Intergenic
1101603126 12:106227530-106227552 CAGGGATGGGGGAAGTCACCTGG - Intergenic
1102283894 12:111639640-111639662 CAGGGTTTGGGGGAGGCCAGTGG + Intergenic
1103881664 12:124170953-124170975 CAGGGTATGGGTTAGCCAGCCGG - Intronic
1104367111 12:128187762-128187784 CAGAATTAAGGGAAGCCAACGGG - Intergenic
1104390332 12:128386445-128386467 GAGGATTTGGGGAAGCCCAACGG - Intronic
1104515910 12:129426459-129426481 CAGAGTTTGGGGAAAGCAATTGG + Intronic
1106080371 13:26495752-26495774 CAGGGTTGAGGAAAACCAACAGG + Intergenic
1106657526 13:31762238-31762260 CAGGGAATGGGGAAGCCCATTGG + Intronic
1107583821 13:41822015-41822037 CAGGAGTTGGGGATGTCAACGGG + Intronic
1108097915 13:46924023-46924045 CAGTGTTAGGGGAAGCCACGTGG - Intergenic
1108294650 13:49001745-49001767 CAGGGTTTGAAGCAGACAACCGG - Intronic
1108523386 13:51264317-51264339 CAGGTTTTGAGGAATCCTACAGG - Intronic
1109803518 13:67406302-67406324 CATGTTTTGGGGGAGCCAACAGG - Intergenic
1110237254 13:73229815-73229837 CAGCGCTTTGGGAAGCCAAGTGG + Intergenic
1113064266 13:106358071-106358093 CAGGGTTTGGGGAAACATCCAGG + Intergenic
1115564884 14:34616612-34616634 CAGTGGTTCGGGAAGCCAAACGG - Intronic
1116103804 14:40474719-40474741 GAGGGTTTGGGGGAGGCAAAAGG + Intergenic
1122031732 14:98917250-98917272 AAGGGTGGGGGGAAGGCAACCGG - Intergenic
1122265184 14:100543402-100543424 CAGGGTCTGTGGAGGGCAACTGG + Intronic
1122365489 14:101192620-101192642 CAGGGGCTGGGGAAGGCAAGAGG + Intergenic
1122538943 14:102485982-102486004 CAGGGGCTGGTGGAGCCAACTGG - Intronic
1124322055 15:28721438-28721460 CAGGGTTTGGGCAAAGCAAGTGG - Intronic
1124366009 15:29072045-29072067 CAGGGGTTGGGGGACACAACAGG - Intronic
1124484838 15:30104443-30104465 CAGCATTTTGGGAGGCCAACCGG + Intergenic
1124518742 15:30392795-30392817 CAGCATTTTGGGAGGCCAACCGG - Intronic
1124523155 15:30423280-30423302 CAGGGTTTGGGCAAAGCAAGTGG - Intergenic
1124535511 15:30542936-30542958 CAGGGTTTGGGCAAAGCAAGTGG + Intergenic
1124539914 15:30573451-30573473 CAGCATTTTGGGAGGCCAACCGG + Intergenic
1124758737 15:32434131-32434153 CAGCATTTTGGGAGGCCAACCGG - Intergenic
1124763143 15:32464660-32464682 CAGGGTTTGGGCAAAGCAAGTGG - Intergenic
1124775484 15:32584399-32584421 CAGGGTTTGGGCAAAGCAAGTGG + Intergenic
1124996809 15:34731651-34731673 TAGGGTTTGAGGAAGGCTACTGG + Intergenic
1125284779 15:38080699-38080721 CAAGGTTTCTGGAAGCCATCTGG - Intergenic
1125819320 15:42614580-42614602 CAGCTTTTGGGAAAGCCATCTGG + Intronic
1129487503 15:75889287-75889309 CAGGGTTTGGGCAAAGCAAGTGG + Intronic
1129833395 15:78685374-78685396 GAGAGTTTGGGGAAGCCTTCAGG + Intronic
1130267225 15:82418051-82418073 CAGGGTTTGGGCAAAGCAAGTGG + Intergenic
1130504794 15:84528799-84528821 CAGGGTTTGGGCAAAGCAAGTGG - Intergenic
1130994609 15:88896927-88896949 CAGGGGTAGGGGTAGCCAGCAGG + Intergenic
1131720187 15:95159706-95159728 CAGAGTTTTGGGAAGCCATAAGG + Intergenic
1132993093 16:2807509-2807531 CTGGGATTGGAGGAGCCAACTGG + Intergenic
1133028026 16:2997106-2997128 CAGGGTTTGGGGGAGGCAGAGGG - Intergenic
1133571781 16:7048125-7048147 CAGAATTTTGGGAAGCCAAGCGG - Intronic
1133731275 16:8580532-8580554 CAGGGCTTGGGGTGGCCAAGAGG - Intronic
1134024415 16:10942903-10942925 CAGAGTTTGGAGAAGCGAAGGGG - Intergenic
1135952406 16:26927426-26927448 AGGGATTTAGGGAAGCCAACTGG - Intergenic
1136061476 16:27729683-27729705 CAGGGTTTGGGTGTGCCAAGTGG - Intronic
1136867073 16:33767330-33767352 CAGCGCTGGGGGAAGCCCACAGG - Intergenic
1138788647 16:59875780-59875802 CAGCGTTTTGGGAGGCCGACGGG + Intergenic
1140024359 16:71271076-71271098 CAGTGCTTTGGGAAGCCAACAGG + Intergenic
1142194579 16:88733510-88733532 CTGGGCTTGGGGAGGCCAGCTGG + Intronic
1142398731 16:89848140-89848162 CGGGGTGTGAGGAAGCCGACTGG - Intronic
1142431275 16:90029182-90029204 CAGGCTATGGGGCAGCCTACGGG + Exonic
1203105091 16_KI270728v1_random:1348873-1348895 CAGCGCTGGGGGAAGCCCACAGG + Intergenic
1203128423 16_KI270728v1_random:1613495-1613517 CAGCGCTGGGGGAAGCCCACAGG - Intergenic
1142866483 17:2794546-2794568 GAGGGTTGGGGGAAGCCTCCGGG + Intronic
1145888208 17:28397092-28397114 GAGGGGCTGGGGAAGCCAGCTGG - Exonic
1146956463 17:36938902-36938924 CCGGGTTTGGGGAAGACCCCCGG - Intronic
1147310962 17:39596013-39596035 CAGGGTCTGGGGGACCCAGCAGG - Intergenic
1149269106 17:54957072-54957094 CAGGGTTTGGGGAAAAAAGCAGG + Intronic
1149494572 17:57109118-57109140 CAGGGTTTGGAGAAACCATGTGG + Intronic
1150285615 17:63952139-63952161 CAGGGTTTAGGGAGGCCTGCTGG + Intronic
1150479494 17:65498449-65498471 CACAGTTTGGGAAAGCTAACTGG - Intergenic
1151459215 17:74244739-74244761 CTGGGGTTGCGGAAGCCAAGAGG + Intronic
1151597754 17:75088411-75088433 AAGGGTTTGGGACAGGCAACTGG - Intronic
1152220003 17:79058466-79058488 CAGCGCTTTGGGAAGCCAAGTGG + Intergenic
1152531151 17:80920002-80920024 CTGGGTTTGGAGATGCAAACTGG - Intronic
1152741043 17:82018469-82018491 CAGGGGTTGGGGCAGCCACGGGG - Intergenic
1156132141 18:33988947-33988969 CAGCATTTTGGGAAGCCAACTGG + Intronic
1156639995 18:39081890-39081912 CAGGGTTTGGGGTAGGAAAATGG + Intergenic
1157203474 18:45679073-45679095 GCAGGTTTGGGGAAGCCAAGAGG - Intronic
1159198768 18:65155086-65155108 CAGTGTTTGGGGAATCCAGGAGG - Intergenic
1160240683 18:77120219-77120241 CAGCGTTGGGAGAAGCCTACGGG - Intronic
1160549002 18:79681122-79681144 CAGGGTCAGGGCAAGCCAAAGGG - Intronic
1161464869 19:4423490-4423512 CTTGGTTTGGGGAAACCAAATGG + Intronic
1161585782 19:5104784-5104806 CAGGGTCTGGGGAAGAGAAGAGG - Intronic
1161727754 19:5940006-5940028 CAGGGTGTGGGCCAGCCAACAGG + Intronic
1163121464 19:15220727-15220749 CAGAGTTTGGGGAAACCAACAGG - Intergenic
1164031270 19:21407984-21408006 CAGGGTTTTGGGATGCCCTCTGG + Intronic
1165083463 19:33325856-33325878 CAGCGTTTGGAGAGGCCAAGGGG - Intergenic
1165463849 19:35960258-35960280 AAGGGTTTGGGGAGGTGAACCGG + Intergenic
1166366123 19:42279377-42279399 CTGAGTCTGGGGAAGCCAAGGGG + Intronic
1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG + Intronic
1167054514 19:47101091-47101113 CAGCATTTTGGGAGGCCAACAGG + Intronic
925224708 2:2172931-2172953 CAGGGTTTGAAGATGCCCACTGG + Exonic
926198754 2:10778714-10778736 CAGGGTCTGGGGGAGCTATCGGG + Intronic
927316556 2:21689818-21689840 GAGGGTTTGGGGCAGCAACCTGG + Intergenic
928327134 2:30328365-30328387 CAGGGTTTGGGCAGGACAATGGG + Intergenic
928342818 2:30460155-30460177 GAGGGTTTGGGGAGTCCAGCGGG + Intronic
928398434 2:30960870-30960892 AAGGGTGTGGGGAAGGCAGCTGG - Intronic
929712257 2:44277354-44277376 CAGAGTTTTGGGAGGCCAAGGGG - Intronic
929980857 2:46678915-46678937 CAGTGTTTAGGGATGCCAATTGG + Intergenic
930843950 2:55880795-55880817 CAAAGTATGAGGAAGCCAACTGG - Intronic
931854003 2:66282507-66282529 CAAGTTTTGAGGAAGCCAATTGG - Intergenic
933349630 2:81137087-81137109 CAGCATTTGAGAAAGCCAACAGG + Intergenic
933812665 2:86042768-86042790 CAGGGTTTGGGGGGACTAACTGG - Intronic
936471158 2:112799671-112799693 CTGGGTTTGAGGAAGGAAACTGG + Intergenic
936657540 2:114505720-114505742 CAGGGTGTGGGGCAGGCAGCTGG - Intronic
936853998 2:116935129-116935151 GAGGGTCTGGGAAAGACAACAGG + Intergenic
937236984 2:120437028-120437050 CAGGGCTGGGGGAAGGCAGCAGG + Intergenic
937295418 2:120807139-120807161 CAGGGCTTGGGCAAGCCCCCTGG + Intronic
939060753 2:137419154-137419176 CAGCACTTTGGGAAGCCAACAGG - Intronic
942076046 2:172358081-172358103 CAGGGTTTGGGGAGGAGAGCGGG + Intergenic
943394739 2:187320261-187320283 CAGGGTTTGGGGAAAGAATCTGG - Intergenic
945957864 2:216102997-216103019 CTGGGGTTGGGGAAACCAATGGG + Intergenic
947343021 2:229159880-229159902 TAGGGTTTGGAGTTGCCAACAGG + Intronic
948127335 2:235574010-235574032 CAGGGTCTGGTGAAGCCAGTGGG - Intronic
948301107 2:236908294-236908316 CAGGATTTGGGGGAGCCACTGGG + Intergenic
948504572 2:238419813-238419835 CAGTGTTTTGGGAGGCCAAGGGG - Intergenic
948751348 2:240135203-240135225 CTGGGTTGGGGGATGCCGACTGG - Intronic
1169525212 20:6417069-6417091 TTGGGTTTGGGGAAACCAAATGG - Intergenic
1170166863 20:13368760-13368782 CAGGGGTTGGGGAAGGGGACAGG - Intergenic
1171947668 20:31392792-31392814 CAGGGCTTTGGGAGGCCAAGGGG + Intergenic
1172259032 20:33545694-33545716 CAGCATTTTGGGAGGCCAACAGG - Intronic
1172666141 20:36601657-36601679 CAGGGGTAGGGGAAGCCATCAGG - Intronic
1173788524 20:45812692-45812714 CGCGGTTTTGGGAAGCCATCCGG - Exonic
1174400784 20:50274811-50274833 CAGGGTGCGGGGAAGCCCTCTGG - Intergenic
1175048457 20:56129559-56129581 CAGGGTTAGGGGAAGAAAGCAGG + Intergenic
1175283506 20:57821067-57821089 CAGGGTCTGGGGGAGACAATGGG - Intergenic
1175727504 20:61329641-61329663 CAGGGTCTGCGGAATCCAAGTGG - Intronic
1176256619 20:64156379-64156401 CGTGGTTTGGGGAAGCCAGGAGG - Intronic
1182537672 22:31017352-31017374 CAGTGCTTGGGGAGGCCAAGGGG - Intergenic
1184081119 22:42220952-42220974 CAGGGTTTGGGGAAGCCAACAGG - Intronic
1184741344 22:46430586-46430608 AAGGTTTTGGGGAAGACGACAGG - Intronic
1185339759 22:50286016-50286038 CAGGGTTGGGCGAAGCCTCCCGG + Exonic
949633268 3:5952872-5952894 AAGGCTTTGGGGAGGCCCACGGG + Intergenic
950878457 3:16300852-16300874 AATGATTTGGGGAATCCAACTGG - Intronic
951692454 3:25410842-25410864 CAGGGGTTGGGGCAGCGAGCAGG - Intronic
952181183 3:30918130-30918152 CAGGGTTTGGGGAAACTACAAGG - Intergenic
954141577 3:48609496-48609518 CAGGGCTTCGGGAAGCGGACAGG - Intronic
954323547 3:49848411-49848433 CAGCTTTTGGCCAAGCCAACAGG - Intronic
954711747 3:52508321-52508343 CAGGGGTTGGAGAAGCCCCCAGG - Exonic
954845107 3:53548614-53548636 CAGGGTTTGGGGGATCCAGATGG - Intronic
956859941 3:73312826-73312848 CAGGATTTTGGGAGGCCAAGGGG - Intergenic
959960432 3:112292389-112292411 TAGAGGTTGGGGAAGCCAAATGG - Intronic
960472730 3:118087454-118087476 CAGGTTTTGGGGAAAACCACAGG + Intergenic
963673742 3:148282499-148282521 CTGTTTCTGGGGAAGCCAACTGG + Intergenic
965391814 3:168113783-168113805 CAGAGTTTGGGAAAGCCACTGGG - Intergenic
966399146 3:179530300-179530322 CAGCACTTTGGGAAGCCAACAGG + Intergenic
967224425 3:187277093-187277115 AAGGGTTTGGAGAGGCCAGCTGG + Intronic
968428370 4:537743-537765 GAGTGTTTGGAGAAGCCAAGAGG + Intronic
970413883 4:15837466-15837488 CAGGGGTTGGGGAGGCCTCCTGG + Intronic
973547494 4:51996146-51996168 CAGGGAGTGAGGAGGCCAACGGG - Exonic
976691861 4:87876954-87876976 CAGCACTTTGGGAAGCCAACTGG - Intergenic
979601015 4:122586511-122586533 CAGGGGTTTGAGCAGCCAACAGG + Intergenic
983349020 4:166563013-166563035 CAGGGTCGGGGGAGGCCAACTGG + Intergenic
983766850 4:171494654-171494676 CTGGGTTTACGGAAGCCATCTGG + Intergenic
985438200 4:189954840-189954862 CTGTGCTTTGGGAAGCCAACGGG - Intronic
986494152 5:8325113-8325135 CAGCATTTTGGGAAGCCAAGTGG - Intergenic
992649444 5:78843306-78843328 CATGGTTTGAGGAAGCCTCCCGG + Intronic
993386455 5:87268240-87268262 CTGGGTTACGGGAAGCCAAGTGG - Exonic
993904357 5:93606094-93606116 CAGGGTCTGGGGAAACAAAACGG + Intergenic
994734351 5:103533829-103533851 CAGGGTTTGAAGCAGACAACTGG - Intergenic
994740070 5:103606724-103606746 CAGGCTTTGGGCAAGCCATATGG - Intergenic
999171514 5:149599219-149599241 CAGGGGCTGGGGGAGCCAGCAGG + Intronic
1000093305 5:157949004-157949026 CGGGCTTTGGGGAAGCGAGCAGG + Intergenic
1002759412 6:190209-190231 TAGGGGCTGGGGAAGCCAGCCGG - Intergenic
1003337162 6:5185057-5185079 CAGGGGCTGGGGAAGACAAAGGG - Intronic
1004051262 6:12081880-12081902 CAGGGTATGGGGAAGCCTGGAGG - Intronic
1004220437 6:13742313-13742335 CAGCGTTTTGGGAGGCCAAGAGG - Intergenic
1006340892 6:33446443-33446465 AAGGGGTTGGGGAAGGCAGCTGG + Intronic
1007621791 6:43219937-43219959 CAGGGTTTGGGGGACGCAATGGG + Intronic
1007798892 6:44375234-44375256 CAGGGTTGGGGGAACCCACATGG + Intronic
1012007777 6:93736043-93736065 CAGTGTTTGGGGAAGTCTCCAGG - Intergenic
1013454059 6:110314081-110314103 CAGGGTTAGGGGCAGACATCTGG - Intronic
1013599904 6:111693983-111694005 CAGGGTTTCAGAAAGCCAACAGG - Intronic
1020135436 7:5585587-5585609 CAGGGCTTGGGGCAGGCATCTGG - Intergenic
1021121223 7:16797950-16797972 CTGTGTTTGGGGAAGACATCTGG + Intronic
1021498474 7:21303091-21303113 CAGAGTGAGGGGAAGCCAGCAGG - Intergenic
1022422088 7:30232870-30232892 CAGGGGCTGGGGGAGCCAGCAGG - Intergenic
1022484255 7:30765785-30765807 CAGGGTTTGGGGCTGGGAACAGG - Intronic
1025805342 7:64826083-64826105 TAGGGTTTTGGGAGGCCAAGGGG - Intronic
1028191936 7:87863847-87863869 AAGGTTTTGGGGAAGGAAACTGG - Intronic
1028803710 7:94999001-94999023 CAGGACTTTGGGAAGCCAAGCGG - Intronic
1029441530 7:100589640-100589662 CATGGTGTGGGAAAGCCAGCAGG + Exonic
1031147630 7:118014546-118014568 CAGCGATTGGGAAAGACAACTGG + Intergenic
1031976168 7:128094958-128094980 CAGGGCTTGGGAAAGCCACCAGG + Intergenic
1034107699 7:148504566-148504588 CTGGGTTTGGGCAAGTCACCTGG + Intergenic
1034482404 7:151332611-151332633 CAGTCTTGGGGGAAGGCAACAGG + Intergenic
1034554897 7:151844114-151844136 CAGGGGTTGGGGAAGCCCTTGGG + Intronic
1035195565 7:157217586-157217608 CAGCACTTGGGGAAGCCGACGGG + Intronic
1035742300 8:1937660-1937682 CAGGGGCTGGGGCAGCCCACAGG + Intronic
1037881037 8:22573620-22573642 AAGGATTTGGGGAGGCCAAGAGG + Intronic
1038450452 8:27635993-27636015 TAGGACTTGGGGAGGCCAACGGG - Intronic
1038529782 8:28308974-28308996 CAGGGTAGGGGGAAGCCATGGGG + Intergenic
1038849456 8:31261134-31261156 CAGGACTTTGGGAAGCCAAGTGG - Intergenic
1044618194 8:94163586-94163608 CAGGGTTAAGGGAAACCAACAGG - Intronic
1046750852 8:117924909-117924931 CAGGGTTTGGGGCATTCTACAGG - Intronic
1048132132 8:131709674-131709696 CAGGCTTTGGGGAAGACAGATGG - Intergenic
1048319531 8:133387693-133387715 CAGGGTGTGGTCAAGGCAACTGG - Intergenic
1049367314 8:142246630-142246652 CAGGGCTCAGGGAAGCCAAGAGG - Intronic
1050962478 9:11752773-11752795 AAGGGTCTGGGGAAGACCACAGG - Intergenic
1051721195 9:20039338-20039360 CTGGAATTGGGGATGCCAACTGG + Intergenic
1055438078 9:76312260-76312282 CAGCATTTTGGGAGGCCAACCGG + Intronic
1055986704 9:82061191-82061213 GAGGATCTGGGGAAGCTAACAGG + Intergenic
1057953618 9:99389531-99389553 CTGGGTGTGGGGAAGCACACAGG - Intergenic
1058803070 9:108563596-108563618 CAGCACTTTGGGAAGCCAACAGG + Intergenic
1061071147 9:128311455-128311477 CCAGGTTTGGGGGAGCCTACGGG + Intronic
1061819920 9:133221516-133221538 CAAGACTTTGGGAAGCCAACTGG + Intergenic
1061861190 9:133469506-133469528 CAGGGCTTGGGCAGGCCAGCAGG - Exonic
1062240734 9:135536432-135536454 CAAGGCTTTGGGAAGCCAACTGG - Intergenic
1062360069 9:136183428-136183450 CAGGTGTGGCGGAAGCCAACGGG - Intergenic
1185978620 X:4749849-4749871 AAGGGGTGGGGGTAGCCAACAGG - Intergenic
1186664572 X:11704357-11704379 CAGTGTTTGGGGAAGGAAATCGG + Intergenic
1189104855 X:38224857-38224879 CAGGGTATGGGGAAGTCAGTAGG + Intronic
1189344926 X:40233526-40233548 CAGGGTTTGGGCAGGCAAAGGGG - Intergenic
1192054600 X:67760357-67760379 CAGGGTGAGTGGAAGCCCACTGG - Intergenic
1192550499 X:72049537-72049559 GGGGGTTTGGGGAAGCAAAATGG - Intergenic
1195006294 X:100688991-100689013 CAGGGTTGGGGAAAGTCAAATGG - Intronic
1196685063 X:118503842-118503864 CAGGGTGTGGGGAAACGATCTGG + Intronic
1198223488 X:134624217-134624239 AAGGGGTTGGGGAAGCCCACTGG - Intronic
1198675327 X:139124837-139124859 CAGGATTTGGGGAAGAAAGCAGG + Intronic
1199449730 X:147965978-147966000 CATGGTTTGGGGTAGCAAAGAGG + Intergenic
1199709264 X:150457000-150457022 CAGAGTTTGGGGAGACCCACTGG - Intronic
1200344560 X:155435633-155435655 CAGGCTTTGGAGAATCCAAATGG + Intergenic
1201464034 Y:14260315-14260337 TAGCATTTGGGGAAGCCAAAAGG - Intergenic
1202161547 Y:21940446-21940468 CAGGGTTGCGGGGAGCCAGCTGG + Intergenic
1202229809 Y:22645927-22645949 CAGGGTTGCGGGGAGCCAGCTGG - Intergenic
1202313347 Y:23550238-23550260 CAGGGTTGCGGGGAGCCAGCTGG + Intergenic
1202557456 Y:26120357-26120379 CAGGGTTGCGGGGAGCCAGCTGG - Intergenic