ID: 1184085788

View in Genome Browser
Species Human (GRCh38)
Location 22:42263170-42263192
Sequence GAGGATGTGCAACCTCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184085788_1184085791 9 Left 1184085788 22:42263170-42263192 CCAGGATGAGGTTGCACATCCTC 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1184085791 22:42263202-42263224 CTCTGCTGCCTTCCATCACGTGG 0: 1
1: 1
2: 0
3: 11
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184085788 Original CRISPR GAGGATGTGCAACCTCATCC TGG (reversed) Intronic
900861551 1:5236432-5236454 GAGGTTGTTCTGCCTCATCCAGG - Intergenic
902037757 1:13469968-13469990 GGGTATATGCACCCTCATCCTGG - Intergenic
902621763 1:17654890-17654912 TGGGAGGTGCAACCTCATCTGGG + Intronic
902819805 1:18936920-18936942 GAGGATGTGCAAACACAAACTGG + Intronic
904785669 1:32980752-32980774 GAGGAAGTGAGAGCTCATCCAGG + Intergenic
907752107 1:57272601-57272623 GAGGATTTGGAACCTGCTCCAGG + Intronic
915314656 1:155021524-155021546 GAGGATGAGCTAGATCATCCTGG - Intronic
915989528 1:160499784-160499806 GAGGAAGTGCAAGCTCACCCAGG - Intronic
919786950 1:201264207-201264229 GAGGACGTGCAGCCTCAGCCAGG + Intergenic
1064215536 10:13397293-13397315 GAAGATGTGGAGCCTCAGCCAGG + Intergenic
1064824075 10:19375514-19375536 GAGGATGTGTGTCCTTATCCAGG - Intronic
1067090318 10:43263032-43263054 GATGATGTGCATCGTCACCCGGG + Intronic
1070247126 10:74743428-74743450 TAGCATATGCAGCCTCATCCAGG + Intergenic
1070566275 10:77605890-77605912 GAGGATGTGCAACTTCCCCAAGG + Intronic
1075540818 10:123312279-123312301 GAGGATGTGAAGACTCATCTTGG - Intergenic
1077422231 11:2458061-2458083 GAAGATGTGCAAGCTAAGCCTGG + Intronic
1080432172 11:32209297-32209319 GAGGATGTGCCATCACAGCCAGG - Intergenic
1081909515 11:46692013-46692035 GAGGAGGTGCAGCTCCATCCCGG + Intronic
1090514718 11:127412602-127412624 GAGCATGTGCACCCCCAGCCAGG + Intergenic
1093038863 12:14356913-14356935 GAGTATGTGCACACTGATCCAGG - Intergenic
1093566206 12:20607068-20607090 CAGGATGTCCTACCTAATCCTGG - Intronic
1100019392 12:90051111-90051133 GTGGATGTGCAACATCATATAGG - Intergenic
1101521404 12:105485618-105485640 GAGGGTGTGCAAACTCACGCGGG - Intergenic
1102062616 12:109945133-109945155 GAGGAAGTGCTGCCTCATGCAGG + Intronic
1103836876 12:123828817-123828839 GAGCAGGAGCAACCTCATCTTGG - Intronic
1106741931 13:32653545-32653567 GAGGATGTGCAACCTGTTTTGGG + Intronic
1112514379 13:100039299-100039321 GAGGATGTGTAGCAGCATCCCGG - Intergenic
1114063526 14:19039960-19039982 GAGGGTCTGCATCCTCATTCAGG + Intergenic
1114098730 14:19360036-19360058 GAGGGTCTGCATCCTCATTCAGG - Intergenic
1118195947 14:63626373-63626395 AAAGATGTTCAACCTCAGCCGGG + Intronic
1119646340 14:76351145-76351167 GATGGTGTGCTCCCTCATCCAGG - Intronic
1119689040 14:76656204-76656226 CAGGATGTGTAATCTCCTCCTGG - Intergenic
1124925273 15:34064367-34064389 GAGGATGAGCAAGCTGATTCTGG + Exonic
1125381660 15:39092679-39092701 GAGGATGTGCACACCCAGCCAGG + Intergenic
1125675031 15:41497301-41497323 GAGGATGTTCAAGCTTCTCCCGG + Intronic
1128586258 15:68852926-68852948 GAGGCTCTGAAACCTCACCCAGG - Intronic
1130305250 15:82709151-82709173 GAGGCTGTGCAAGTACATCCAGG + Intronic
1132465753 16:76782-76804 GAGGGTGTGGAATCACATCCAGG + Intergenic
1134235128 16:12459341-12459363 GAGGGTGTTCCACCCCATCCAGG - Intronic
1136275932 16:29179609-29179631 GAGGATGTGAAAGCCCAGCCAGG - Intergenic
1136931494 16:34421842-34421864 GAAGATGTGGAGCCTCAGCCAGG - Intergenic
1136973078 16:34989977-34989999 GAAGATGTGGAGCCTCAGCCAGG + Intergenic
1140957029 16:79875366-79875388 GAGCATGGGCAACCTCAGTCTGG - Intergenic
1141109725 16:81262345-81262367 CAGGCTGAGCAACCTCACCCCGG - Intronic
1141279335 16:82616802-82616824 CAGGAAGTGCCACCTCCTCCAGG - Intergenic
1141441717 16:84033546-84033568 GTGGATGTCCAACCCCAGCCAGG - Intronic
1142155450 16:88530914-88530936 GAGGAAGAGCCACCTCACCCAGG + Intronic
1143258435 17:5581586-5581608 GGTGATGTGTAACCCCATCCAGG + Intronic
1145901266 17:28491816-28491838 GAGGATCTGCAGCCACAACCAGG - Exonic
1148857940 17:50589218-50589240 GATCATGAGCAACCTCAGCCTGG - Intronic
1149510971 17:57241214-57241236 GACTATATGCAACATCATCCTGG + Intergenic
1150971213 17:70030161-70030183 GAGGATTTGCAACATCCTCCTGG - Intergenic
1151395775 17:73821860-73821882 GAGGATGAGCCACCTCCTCTGGG - Intergenic
1151675125 17:75593472-75593494 TGGGATGTGCCACCACATCCAGG - Intergenic
1152305115 17:79515770-79515792 GAAGCGGTGCAACCTCAGCCGGG - Intronic
1152329991 17:79667195-79667217 GGGGATGTGGACCCTCATCCTGG - Intergenic
1154450563 18:14472753-14472775 GAGGGTCTGCATCCTCATTCAGG - Intergenic
1157396499 18:47346014-47346036 GTGGATGTGCACCCTTAACCAGG - Intergenic
1161771981 19:6235788-6235810 GAGGATGTGGAGCCTCCTCCAGG - Intronic
1162678807 19:12322427-12322449 GAGGATGTACAACTTCTTTCAGG + Intronic
1163190877 19:15675594-15675616 GAGGATGTGTTTTCTCATCCTGG - Intronic
1163202151 19:15777258-15777280 GAGGATGTGTTTTCTCATCCTGG + Intergenic
1165049161 19:33130710-33130732 GAGAATGTGCACCCACAGCCTGG + Intergenic
1165267863 19:34676951-34676973 GAGGATGGAGACCCTCATCCTGG - Intergenic
925251707 2:2444678-2444700 GAGGATTTGCCATCCCATCCAGG + Intergenic
925496594 2:4457056-4457078 GAGGATGTGCAAATGTATCCCGG + Intergenic
930842212 2:55860098-55860120 GAGGGTGTGCTTCCTCATACTGG - Intergenic
932219191 2:69987006-69987028 GAGGATGTGCACCTTCCTCTGGG + Intergenic
933854054 2:86396320-86396342 GAGCCTGTGCCACCTGATCCAGG - Intergenic
934526423 2:95054701-95054723 GAGCATCTGCAACCTCTTGCTGG + Intergenic
935059615 2:99596015-99596037 GAGGATGCGGAAGCCCATCCTGG + Intronic
937839670 2:126512654-126512676 CAGGGCGGGCAACCTCATCCTGG - Intergenic
938140608 2:128791675-128791697 GAGGATGAGCCCCTTCATCCAGG - Intergenic
938480860 2:131660125-131660147 GAGGGTCTGCATCCTCATTCAGG + Intergenic
939048587 2:137279974-137279996 GAGAATGTGTAACCTCAAGCCGG - Intronic
943742758 2:191428227-191428249 AAGCATGTGCCACCTCATCAAGG - Intergenic
944531879 2:200675138-200675160 GAGGATGGGCTCCCTCCTCCAGG + Intronic
948970376 2:241421114-241421136 GTGACTGTGCAACCTCACCCAGG + Intronic
1170367364 20:15612363-15612385 GAGGATGTGGAACAGCATCAGGG - Intronic
1170604478 20:17865398-17865420 GAGGATGTTCAGCAGCATCCTGG + Intergenic
1175186023 20:57180073-57180095 GAGGATGTGGCAGATCATCCAGG - Intronic
1175265975 20:57703715-57703737 GAGGATGGGCAACCTTTTTCTGG + Intronic
1176445630 21:6817630-6817652 GAGGGTCTGCATCCTCATTCAGG + Intergenic
1176823797 21:13682663-13682685 GAGGGTCTGCATCCTCATTCAGG + Intergenic
1179189355 21:39109519-39109541 GAGGATGTCCAAGGGCATCCAGG - Intergenic
1179899312 21:44380779-44380801 GAGGGTGGGCAACTTCTTCCTGG - Intronic
1180482020 22:15762594-15762616 GAGGGTCTGCATCCTCATTCAGG + Intergenic
1182249232 22:28986613-28986635 GAGGATCTGGAAACACATCCCGG - Intronic
1183862692 22:40681205-40681227 GACCATGTGCACCCTCATCACGG + Exonic
1184050025 22:41997534-41997556 GAGGATGTACAACCGCACTCTGG - Exonic
1184085788 22:42263170-42263192 GAGGATGTGCAACCTCATCCTGG - Intronic
1185347724 22:50317719-50317741 GAGGATGGGCCAGCTCTTCCAGG - Intronic
953535487 3:43773979-43774001 GAGTTAGTGCAAGCTCATCCTGG + Intergenic
953829753 3:46285742-46285764 GTGCATGTGCATCCTCATTCTGG + Intergenic
955867451 3:63400045-63400067 GAGGATGAGCAAGCTCAACCAGG + Intronic
956738257 3:72255612-72255634 GAGAAAGTGCAGCCTCTTCCGGG + Intergenic
956771248 3:72527822-72527844 GAGGATGTGCAGCCTCACCTGGG + Intergenic
958979847 3:100708660-100708682 GAGGATGAGGAACCCCATCAAGG - Intergenic
962128762 3:132650344-132650366 GAGGATGGGCAACCACTTCTAGG - Intronic
965061450 3:163789131-163789153 GAGGGACTGCAACCTTATCCTGG + Intergenic
966515956 3:180821132-180821154 GAAGCTGTGCTACCTCACCCTGG + Intronic
968187492 3:196643339-196643361 GAGGAAGTGGAACCTCGTCATGG + Intronic
969162713 4:5275494-5275516 GAGGAGGTGCACCCTCTTTCGGG + Intronic
969333015 4:6490912-6490934 GAGGTTAAGCAACCTCAGCCAGG + Intronic
973135426 4:46700217-46700239 GAGGGTCTGCAGCTTCATCCTGG + Intergenic
983316121 4:166134567-166134589 GTGGCTGTGCCACCTCACCCAGG - Intergenic
983806576 4:172000782-172000804 GAGGAGCTGCCACCTCATCAGGG + Intronic
985129437 4:186725542-186725564 GACGAAGTGCAACTTCTTCCAGG - Intronic
988653382 5:33178861-33178883 TAGGATGTGCAACATCATCTTGG + Intergenic
990714745 5:58624269-58624291 GAGGATGCCCAACACCATCCTGG + Intronic
992457040 5:76925391-76925413 GAGGATGGGAAACTTCCTCCTGG + Intergenic
992543324 5:77785523-77785545 GAAGCTGTGCTACCTCGTCCTGG + Intronic
999965704 5:156807072-156807094 GAGGATGTTCAAACCCATCGTGG + Intergenic
1001168419 5:169392803-169392825 GAGGATGACCAAGCTCATCTAGG + Intergenic
1002345723 5:178546484-178546506 CAGGGTCTGCACCCTCATCCTGG - Intronic
1005795430 6:29355938-29355960 GAGGAGGTGCACCATCATCTGGG + Exonic
1005824386 6:29623889-29623911 TAGGATGTGGAACCTCATTGTGG - Exonic
1005860816 6:29898548-29898570 GGCTATGTGCAACCTCAGCCTGG + Intergenic
1005980195 6:30830634-30830656 CAGGATGTGCAAACGCTTCCTGG + Intergenic
1007409421 6:41653365-41653387 GACGCTGTGCAACATCGTCCTGG + Exonic
1007619706 6:43204488-43204510 GTGCATGTGGAACCTCCTCCTGG + Exonic
1008911692 6:56740429-56740451 GAGAAGGACCAACCTCATCCAGG + Intronic
1010024848 6:71203300-71203322 CAGGATGAGCGACCTCATCAAGG - Intergenic
1011723344 6:90182415-90182437 AAGGATTTCCTACCTCATCCAGG + Intronic
1015848970 6:137552109-137552131 CAGGCTCTGCAACCTCAGCCAGG + Intergenic
1016256107 6:142107484-142107506 GAGTATGTGCATCATCACCCTGG - Intergenic
1016929836 6:149393678-149393700 GAGAATGCTCAACCTTATCCTGG + Intronic
1021315692 7:19145005-19145027 GCGGATGTTCAACCTCAACGAGG - Exonic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1024475937 7:49811249-49811271 GATGATGCTCAACCTCAACCTGG + Intronic
1026148446 7:67768483-67768505 GAGGTTATGCAGCCTCCTCCAGG + Intergenic
1031542325 7:123009334-123009356 GAAGATGTGCTACCTCTTACAGG - Intergenic
1032753429 7:134865277-134865299 GAGGATCTCCAGCCCCATCCTGG + Intronic
1039255649 8:35716014-35716036 GATGCTATGCAACCTCACCCAGG - Intronic
1039510708 8:38089862-38089884 GGAGATGGCCAACCTCATCCTGG + Intergenic
1039709629 8:40042743-40042765 GGGGATATAAAACCTCATCCAGG - Intergenic
1039861998 8:41467170-41467192 GAGGCTGTGCAAGGTCATCCAGG + Intergenic
1042467927 8:69149505-69149527 GACAATTTGCAACCTCATGCAGG + Intergenic
1044730662 8:95226322-95226344 GAGGATGCACAACCTGATCCAGG + Intergenic
1049311936 8:141938023-141938045 AAGGATGTGCATCCACCTCCGGG - Intergenic
1049558230 8:143294290-143294312 CAGGCTGAGCAACCCCATCCAGG - Intronic
1052376013 9:27718218-27718240 AAGTATGTGAAACCTGATCCTGG - Intergenic
1056557783 9:87704156-87704178 GAGAATCTGCCAACTCATCCAGG + Intronic
1056759638 9:89405432-89405454 GAGGATGTGCACCCCCATTAGGG - Exonic
1062067738 9:134537789-134537811 GAGGATAGGCAACCTCACCAAGG + Intergenic
1062351981 9:136143784-136143806 GGGGATGGGAACCCTCATCCTGG - Intergenic
1203523565 Un_GL000213v1:66895-66917 GAGGGTCTGCATCCTCATTCAGG - Intergenic
1185461815 X:336375-336397 GAGGATGTTCTCCCTCTTCCTGG - Intronic
1192501893 X:71660047-71660069 GAGGTTGTCCAAGTTCATCCAGG + Intergenic
1196209497 X:112980127-112980149 AAAGATGTTCAACATCATCCGGG - Intergenic