ID: 1184088458

View in Genome Browser
Species Human (GRCh38)
Location 22:42279987-42280009
Sequence TCTAGGCTCAGGGACCGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 116}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184088458_1184088469 14 Left 1184088458 22:42279987-42280009 CCCTCTCGGTCCCTGAGCCTAGA 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1184088469 22:42280024-42280046 AGCAGGGACAGGAGGAGAAATGG 0: 1
1: 0
2: 17
3: 182
4: 1522
1184088458_1184088468 6 Left 1184088458 22:42279987-42280009 CCCTCTCGGTCCCTGAGCCTAGA 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1184088468 22:42280016-42280038 GAGTTACTAGCAGGGACAGGAGG 0: 1
1: 0
2: 1
3: 12
4: 136
1184088458_1184088470 15 Left 1184088458 22:42279987-42280009 CCCTCTCGGTCCCTGAGCCTAGA 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1184088470 22:42280025-42280047 GCAGGGACAGGAGGAGAAATGGG 0: 1
1: 0
2: 7
3: 73
4: 898
1184088458_1184088471 24 Left 1184088458 22:42279987-42280009 CCCTCTCGGTCCCTGAGCCTAGA 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1184088471 22:42280034-42280056 GGAGGAGAAATGGGAAAGCTAGG 0: 1
1: 0
2: 2
3: 75
4: 600
1184088458_1184088465 -2 Left 1184088458 22:42279987-42280009 CCCTCTCGGTCCCTGAGCCTAGA 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1184088465 22:42280008-42280030 GACCAGGTGAGTTACTAGCAGGG 0: 1
1: 0
2: 0
3: 2
4: 71
1184088458_1184088464 -3 Left 1184088458 22:42279987-42280009 CCCTCTCGGTCCCTGAGCCTAGA 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1184088464 22:42280007-42280029 AGACCAGGTGAGTTACTAGCAGG 0: 1
1: 0
2: 1
3: 6
4: 61
1184088458_1184088467 3 Left 1184088458 22:42279987-42280009 CCCTCTCGGTCCCTGAGCCTAGA 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184088458 Original CRISPR TCTAGGCTCAGGGACCGAGA GGG (reversed) Intronic
900485783 1:2922042-2922064 TCTGGGCTCTGGGGCCGAGTTGG + Intergenic
901656861 1:10774387-10774409 CCTAATCTCAGGGACAGAGAGGG - Intronic
902683271 1:18058744-18058766 GCTAGGCACAGGGTCAGAGAGGG - Intergenic
903481568 1:23657263-23657285 GCTAGGCACAGGGACATAGACGG - Intergenic
903658239 1:24961803-24961825 ACTTTGCTCAGGGACTGAGATGG + Intronic
903780664 1:25818119-25818141 TCGAGGCTCAGGGTGGGAGAGGG + Exonic
903878369 1:26491726-26491748 CCTAGGCTCAGGGTCTGAGTAGG + Intergenic
904410554 1:30322344-30322366 CTGAGGCTCAGGGACCCAGAAGG + Intergenic
906514147 1:46429081-46429103 GCTAGCCTCAGGGGCCCAGAGGG + Intergenic
908959103 1:69672752-69672774 TCTAGAATCATGGACTGAGATGG - Intronic
909724792 1:78821479-78821501 TCTTGCCTCAGGGAGTGAGAGGG + Intergenic
912003283 1:104860686-104860708 TATAGTCTTAGGGACCAAGAGGG + Intergenic
915727848 1:158031459-158031481 TCTAGGCTCAGGGGCCAAGTGGG + Intronic
917831592 1:178895727-178895749 TCTAGGTTTGGGGACTGAGATGG + Intronic
920305937 1:205018127-205018149 CCTAGCCTCAGAGACAGAGAAGG + Exonic
920405921 1:205710602-205710624 TCTGGGGTCAGGGAGTGAGAGGG - Intergenic
922475424 1:225904111-225904133 TCTAGGCACAGGGACATAGCAGG - Intronic
923603881 1:235425925-235425947 TCTGTGCTCAGGGACAGAGCAGG - Intronic
924950625 1:248879423-248879445 TCAAGGCTGAGTGACAGAGAAGG - Intergenic
1068262732 10:54603825-54603847 TCTAGGCTCAGGGACCATCTTGG - Intronic
1074196174 10:111187409-111187431 ACTGGACTCAGGGACAGAGAAGG - Intergenic
1076438851 10:130465354-130465376 TCGAGGCTCAGGGCCTGAGTGGG + Intergenic
1077529579 11:3088889-3088911 TCCAGCCTCCGGGACCGCGAGGG + Intronic
1077582123 11:3423234-3423256 GCTGGGCTCAGGGGCCGAGAGGG + Intergenic
1084239038 11:67806051-67806073 GCTGGGCTCAGGGGCCGAGAGGG + Intergenic
1084780327 11:71404025-71404047 TGGAGGCTCAGAGACGGAGATGG - Intergenic
1084833393 11:71786789-71786811 GCTGGGCTCAGGGGCGGAGAGGG - Intergenic
1085345746 11:75767353-75767375 TGGAGGCTCAGGGAACGAGTGGG - Intronic
1085455376 11:76662452-76662474 TCTAGGCTCAGGGAGGGGAAGGG + Intronic
1091310406 11:134571359-134571381 TCTTGGCTCTGGGACCCTGAAGG - Intergenic
1091368245 11:135039344-135039366 TCTAGGCTCAAGGGCCGTTAGGG - Intergenic
1091974632 12:4814541-4814563 AAGAGGCTCAGGGTCCGAGAGGG - Intronic
1091978953 12:4850280-4850302 TGCAGGCTGAGGGTCCGAGAGGG + Intronic
1092481604 12:8864090-8864112 TCTAAGCCCCTGGACCGAGAAGG - Intronic
1092678704 12:10952796-10952818 TATAGGCTCTTGGACCGGGATGG - Intronic
1095655747 12:44667887-44667909 GCTAGGCTCAGGGCCTGTGAGGG - Intronic
1096785278 12:54013709-54013731 TGAAGGCTCAGGGACCCAGGGGG + Intronic
1102921716 12:116796512-116796534 TCTAAGCACAGGGACGGGGAGGG + Intronic
1103617378 12:122162894-122162916 TCTAGAAGCAGGGACCAAGATGG - Intergenic
1104952999 12:132450892-132450914 TCCAGCCTCAGGGACTGAGATGG - Intergenic
1104972705 12:132539236-132539258 GCTAGGATCAGGGTCAGAGAGGG + Intronic
1113292532 13:108922357-108922379 TCATGGCACAGGGACAGAGAGGG + Intronic
1116783180 14:49259001-49259023 TCTATGCTGAGGGACTGAGAGGG - Intergenic
1117285849 14:54285215-54285237 CCTAGGATCAGGGACCCTGATGG + Intergenic
1121120819 14:91374878-91374900 TCTGGGCTCAGAGACAAAGAGGG + Intronic
1124216928 15:27815307-27815329 TCTGGGCACAGGCACCAAGAGGG - Intronic
1126698425 15:51345250-51345272 TCTAGGGTCAAGCACCCAGAGGG + Intronic
1127948179 15:63776371-63776393 TTTTGGCTCAGGGAACTAGAAGG - Intronic
1128535467 15:68486934-68486956 TCCAGGCTCAGGGTCAGAGCTGG - Intergenic
1129296265 15:74602037-74602059 TCCAGGCCCAGGGGCCCAGATGG + Intronic
1129920855 15:79318043-79318065 TCTGGGATCAGGGACTGACATGG - Intronic
1130897593 15:88183191-88183213 TCTAGGACCAGGGGCTGAGAGGG - Intronic
1133182911 16:4072190-4072212 TAAAGGCTCAGGGACCATGAAGG + Intronic
1135537980 16:23309104-23309126 TCCAAGCTCCAGGACCGAGAGGG - Intronic
1138301598 16:55934830-55934852 TCTAAGCGCAGGGCCTGAGACGG + Intronic
1138676048 16:58652187-58652209 TCTAGGCTCAAGAACCGAGAAGG - Intergenic
1139606698 16:68023712-68023734 TCTGGGCTCACAGACAGAGAGGG - Intronic
1144030599 17:11318853-11318875 TCTAGGAGCAGGGACAGAAAAGG - Intronic
1145370571 17:22303440-22303462 GCTAGACACAGGGACAGAGAAGG + Intergenic
1146647143 17:34582940-34582962 TCCAGGCTCAGGGATCGGGAAGG - Intronic
1147268926 17:39253196-39253218 ACTCTGCTCAGGGACAGAGATGG - Intergenic
1148681486 17:49476428-49476450 CCTAGACCCAGGGACAGAGAAGG - Intronic
1150628144 17:66856885-66856907 GTTAGGGTCAGGGACAGAGAGGG - Intronic
1153701047 18:7693628-7693650 TCTTGGTTCAGGGACTGAGTTGG + Intronic
1155367648 18:25064378-25064400 TCTAGGCCAAGGGACCCACATGG + Intronic
1156347272 18:36269165-36269187 TTTATGCTCAGGGGCCCAGAGGG + Exonic
1160782192 19:882841-882863 TCAAGGCTCTGTGACCGTGATGG - Intronic
1162145202 19:8609058-8609080 GAGAGGCTCAGGGACAGAGACGG + Intronic
1162344247 19:10110474-10110496 TCTTGGCTCAGTGAGCAAGACGG + Exonic
1165628945 19:37293274-37293296 GCTAGACGCAGGGACGGAGAAGG - Intergenic
1167233318 19:48298443-48298465 TCAAGGCTCAGAGACCAAAAGGG + Intronic
1167876784 19:52420568-52420590 TCAAGGTGCAGGGACCGATAAGG - Intergenic
1168335146 19:55593121-55593143 GCCAGGCGCAGGGCCCGAGACGG - Exonic
926155339 2:10450347-10450369 TCTTGGCTCAGGGAGCCAGGAGG + Intergenic
926456087 2:13070082-13070104 TGTTGGCTCAGGGACTGAAAGGG + Intergenic
935720491 2:105974845-105974867 TCTGGGCTCAGGTACAGAGGAGG - Intergenic
946192148 2:218013314-218013336 TCTCTGCTCAGGGACCTGGAGGG - Intergenic
1172760272 20:37316500-37316522 TCCAGGCTCAGGGTCTGAGGAGG + Exonic
1180958442 22:19751466-19751488 TCTGGGCACAGGGACCCAGTGGG + Intergenic
1183531128 22:38353897-38353919 TCAAGGCCCAGGGACAGAGCTGG + Intronic
1183713439 22:39520090-39520112 TATTGGCTCAGGGCCCTAGATGG - Intronic
1184088458 22:42279987-42280009 TCTAGGCTCAGGGACCGAGAGGG - Intronic
949401420 3:3668879-3668901 CCTAGGCTCTGGGATTGAGATGG + Intergenic
949948199 3:9207049-9207071 TCAAGGCTCAGGGATGGAGGGGG + Intronic
954631914 3:52052384-52052406 TCCAGACTCAGGGACTGACAGGG + Intronic
954651611 3:52167665-52167687 TCTAGGCCCAGGGACTGTCATGG + Intergenic
960785997 3:121373335-121373357 ACTAGGCTCAGGGCCCAAGAGGG - Intronic
961299874 3:125915864-125915886 GCTGGGCTCAGGGGCCGAGAGGG - Intergenic
966878624 3:184337334-184337356 CCGAGGCTCAGGGATAGAGACGG + Intronic
966927019 3:184651286-184651308 TCTTGGCTCAGGGACAGATGTGG - Intronic
968997782 4:3956116-3956138 GCTGGGCTCAGGGGCCGAGAGGG + Intergenic
969816545 4:9691704-9691726 GCTGGGCTCAGGGGCCGAGACGG - Intergenic
970058300 4:12000332-12000354 CCCAGGCTCAGAGACCTAGAAGG - Intergenic
972925665 4:44003105-44003127 TCTAGGCACAGGCACAGGGAGGG + Intergenic
975346200 4:73295265-73295287 TCTAGGCCCAGGGACTGTCATGG + Intergenic
976016139 4:80557248-80557270 TCTAGGCCCAGGGACTGTCATGG - Intronic
987311518 5:16685681-16685703 TCTAGGGGCAGGGACGGGGAGGG - Intronic
991023461 5:62005461-62005483 ACTAGGCTAAGGGAAGGAGAGGG + Intergenic
992667476 5:79025340-79025362 GCTAGGCGCAGGGACAGAAACGG - Intronic
998518554 5:142779121-142779143 TCCAGGCTCAGGGACTAGGAAGG + Intronic
998856644 5:146400654-146400676 TCTAGACTCAGAGGCTGAGATGG - Intergenic
1001524464 5:172418734-172418756 TCCAGGCTCAGAGTCCCAGATGG - Intronic
1002841064 6:907747-907769 AGTAGGCTCAGGGAGAGAGATGG - Intergenic
1009842486 6:69093723-69093745 CCTAGGTTCAGGGAAAGAGAGGG + Intronic
1018209556 6:161467943-161467965 TGTAGGCTAAGGGAGTGAGAAGG - Intronic
1018390204 6:163336021-163336043 TCTCCGCTCAGGGAGCGAAACGG + Intergenic
1018754329 6:166836860-166836882 TCCCGGCTCAGGGACCGAGGTGG - Intronic
1019513946 7:1431606-1431628 TCTGGGCTCAGGGACCGGTGTGG - Intronic
1019858030 7:3628877-3628899 TCTAGGCTGTGGCACAGAGAAGG + Intronic
1021436030 7:20616483-20616505 TCTAGGTTCATGTACCAAGATGG - Intronic
1023148921 7:37181311-37181333 TCCAGGCTAAGTCACCGAGAAGG + Intronic
1024699248 7:51889382-51889404 TCTAGTCTCAGGGACACCGAAGG + Intergenic
1025101647 7:56140518-56140540 TCCAGCCTCAGTAACCGAGAGGG - Intergenic
1032732425 7:134656903-134656925 TCTAGGCTCATAGGCAGAGAGGG - Intronic
1033810143 7:145002316-145002338 TGTAGGCTCAGGGTCTGGGAGGG + Intergenic
1035468213 7:159093579-159093601 GCTGGGCTCAGGATCCGAGATGG + Intronic
1036295392 8:7530754-7530776 TCTAGGCTCAGGGACTGTCTTGG - Intergenic
1036327177 8:7790265-7790287 TCTAGGCTCAGGGACTGTCTTGG + Intergenic
1036493823 8:9251613-9251635 TTTAGGCTGAAGGACAGAGAAGG + Intergenic
1037128900 8:15384253-15384275 TATAGGCACAGGCACAGAGAAGG - Intergenic
1040067732 8:43161861-43161883 TCAGGGCTCAGGGCCAGAGAGGG - Intronic
1045074182 8:98544187-98544209 ACTAGGGTCAGGGAACTAGAGGG + Intronic
1046004736 8:108464963-108464985 TCCAGACTCAGGGACCCAGAAGG - Intronic
1052850201 9:33373553-33373575 TGTAGGCTGAGGGACTGACATGG - Intergenic
1057075876 9:92137936-92137958 CCTGGGCGCAGGGACTGAGAAGG - Intergenic
1060520540 9:124291736-124291758 TGTAGGCTCAGGGAGGGACAAGG - Intronic
1186834077 X:13420156-13420178 TTCATGCTCAGGGACCGAGTTGG - Intergenic
1192132896 X:68569393-68569415 TGTAGGCTCAGGGTCTGATATGG - Intergenic
1194518443 X:94888333-94888355 ACTAGGCTCAGAGCCTGAGAGGG + Intergenic
1196517657 X:116631840-116631862 TCTAGCCTCAGACACCCAGATGG + Intergenic