ID: 1184088467

View in Genome Browser
Species Human (GRCh38)
Location 22:42280013-42280035
Sequence GGTGAGTTACTAGCAGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184088462_1184088467 -8 Left 1184088462 22:42279998-42280020 CCTGAGCCTAGACCAGGTGAGTT No data
Right 1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 118
1184088461_1184088467 -7 Left 1184088461 22:42279997-42280019 CCCTGAGCCTAGACCAGGTGAGT 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 118
1184088459_1184088467 2 Left 1184088459 22:42279988-42280010 CCTCTCGGTCCCTGAGCCTAGAC 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 118
1184088454_1184088467 30 Left 1184088454 22:42279960-42279982 CCTCTGGGGAGCTGCTACTGGGC 0: 1
1: 0
2: 0
3: 25
4: 178
Right 1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 118
1184088458_1184088467 3 Left 1184088458 22:42279987-42280009 CCCTCTCGGTCCCTGAGCCTAGA 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG 0: 1
1: 0
2: 0
3: 3
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184088467 Original CRISPR GGTGAGTTACTAGCAGGGAC AGG Intronic
901214956 1:7550099-7550121 GGTGAGTTTCTGGGAGGGGCTGG + Intronic
903974070 1:27137890-27137912 GGAGAGCTGCTAGCAGGGAGGGG - Intronic
904420045 1:30385472-30385494 GGGGAGATACAAGGAGGGACAGG - Intergenic
909315909 1:74218658-74218680 GGTGAGTTAATAGCAGTGCTAGG - Intronic
915249359 1:154577426-154577448 CATGAGTTACTAGCAGGGCCAGG - Exonic
920807577 1:209249728-209249750 GGTGGGTTACCTGCAGGGAGGGG - Intergenic
1062971997 10:1655090-1655112 GGTGAGGTTCCAGCAGGGGCAGG + Intronic
1064713042 10:18145976-18145998 GGTGGGTGTCTAGCAGGTACAGG - Intronic
1065749587 10:28873727-28873749 GGTGACTTCCTAGCATGTACAGG - Intronic
1067340317 10:45396030-45396052 GGTGACTTTCCAGCAGTGACAGG - Intronic
1067777653 10:49175058-49175080 GGTGAGGTGGCAGCAGGGACTGG + Intronic
1071147967 10:82597510-82597532 GGTGAATTAGAAGCAGGGGCAGG + Intronic
1071759211 10:88582180-88582202 GGTGAGTTAGTTGCAAGGAGTGG - Exonic
1074424981 10:113342764-113342786 AGTGAGTCACGAGCAGGGCCAGG - Intergenic
1075054499 10:119207525-119207547 GGTGTGGTACTAGCAGGCTCGGG - Intergenic
1076415504 10:130284671-130284693 GATCAGTTACTTGCAGGTACAGG + Intergenic
1076847503 10:133076454-133076476 GGTGAGTGAGGTGCAGGGACAGG - Intronic
1077004629 11:347458-347480 TGTGTGTTACTAGTAGAGACAGG + Intergenic
1078905583 11:15685335-15685357 GCTGATTTAGTAGCAGGGCCAGG - Intergenic
1079317260 11:19419164-19419186 GGTGAGCTACTTGCAGGCAGGGG - Intronic
1084494341 11:69495408-69495430 TGTGAGTATCTAGCAGGGGCTGG - Intergenic
1084684161 11:70684139-70684161 GAAGAGTGAGTAGCAGGGACAGG - Intronic
1086046437 11:82537544-82537566 CATGAATTACTAGCTGGGACTGG + Intergenic
1089244772 11:117110811-117110833 GGAGAGGTACTAGCGGGAACCGG - Intergenic
1090236422 11:125151652-125151674 GGGGAGTTGCTAGCAAGGCCGGG + Intergenic
1098945757 12:76587879-76587901 TGAGAGTTAGTAGCAGAGACAGG - Intergenic
1101876602 12:108600155-108600177 GGTGAGTTAGTGGCAGGCCCTGG + Intergenic
1106246642 13:27955075-27955097 GGTAAGTTTCTAGGAGGGCCTGG - Intergenic
1123496662 15:20833689-20833711 GGTGAGATGCTAGCAGGGGTGGG + Intergenic
1123553897 15:21407281-21407303 GGTGAGATGCTAGCAGGGGTGGG + Intergenic
1123590141 15:21844646-21844668 GGTGAGATGCTAGCAGGGGTGGG + Intergenic
1126535103 15:49752703-49752725 TATGAGTCACAAGCAGGGACAGG - Intergenic
1127280405 15:57486060-57486082 GGTGAGTCAGGAGCAGGGCCCGG + Intronic
1130992025 15:88881335-88881357 GGTGAGATGCTAACGGGGACTGG - Exonic
1202962243 15_KI270727v1_random:134477-134499 GGTGAGATGCTAGCAGGGGTGGG + Intergenic
1133215946 16:4292618-4292640 GGTGAGTTTCCAGCTGGGAGAGG + Intergenic
1135252329 16:20911555-20911577 GGTGAGTAAGTAGCAAGGCCAGG - Intronic
1136270290 16:29144447-29144469 GGTGAATCACGAGCAGGGAGAGG - Intergenic
1142073880 16:88106281-88106303 GGTGAATCACGAGCAGGGAGAGG - Intronic
1144996308 17:19271618-19271640 AGGGAGTTACTTGCAGGGACTGG - Intronic
1146997627 17:37334760-37334782 GGGGAGCTACTGGCATGGACGGG - Intronic
1148124741 17:45230890-45230912 TGTGAGTCACTAGCAGGGCTGGG + Intronic
1148612305 17:48972470-48972492 GGTGAGTCACCAGTGGGGACTGG - Intergenic
1152739500 17:82012741-82012763 AGGGCGTTCCTAGCAGGGACCGG - Intronic
1154454572 18:14509373-14509395 GGTGAGATGCTAGCAGGGGTGGG + Intronic
1160246635 18:77164988-77165010 GGTGAATTTCTAGAAGGGAGGGG + Intergenic
1160857964 19:1225919-1225941 GGTTGGTGGCTAGCAGGGACTGG + Intronic
1161886732 19:7002552-7002574 TTTGAGTTATTAACAGGGACAGG - Intergenic
1162876651 19:13625720-13625742 GGTGAGTGATTGGCAGGGGCAGG + Intergenic
1163719183 19:18890222-18890244 GGGCAGTTTTTAGCAGGGACAGG - Intronic
1165944449 19:39433344-39433366 GGTCAGCTACCAGCAGGGTCCGG + Exonic
1167006824 19:46781693-46781715 TGTGACTTACAAGAAGGGACTGG - Intronic
1167952375 19:53037715-53037737 TGTGACTTACTAGCAGTGAGGGG + Intergenic
927147568 2:20176870-20176892 GGTGCCTGACAAGCAGGGACTGG + Intergenic
929527510 2:42719421-42719443 GGTGAGTTAGAAACAGGGAAGGG - Intronic
931566034 2:63616432-63616454 GGTGAGGGTCTAGCATGGACTGG - Intronic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
940848332 2:158664158-158664180 GGAGAGTTAGAAGCAGGGATTGG + Intronic
942333483 2:174853929-174853951 TGTGAGCTACTAGAAGGGAGAGG + Intronic
1169112371 20:3042585-3042607 ACTGACTTATTAGCAGGGACCGG - Intergenic
1171938064 20:31294479-31294501 AGGGAGTTACTACCAGGGAGTGG + Intergenic
1172064831 20:32211865-32211887 GGTTAGATTGTAGCAGGGACAGG - Intronic
1175160659 20:57005327-57005349 AGTGAGGTACCAGCAGGGAAGGG + Intergenic
1175282148 20:57811083-57811105 GGTGAGCTGGTAGGAGGGACAGG + Intergenic
1175991807 20:62793570-62793592 GGAGAGTACCTGGCAGGGACGGG + Intergenic
1176819596 21:13643935-13643957 GGTGAGATGCTAGCAGGGGTGGG - Intergenic
1182252619 22:29013316-29013338 GGGAAGTTACTAGCATGGAAGGG - Intronic
1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG + Intronic
950121373 3:10484367-10484389 GGTGAGATTCTAGAAGGGACAGG + Intronic
950428554 3:12937930-12937952 GGTGAGCTACATGCAGGGAGAGG + Intronic
953826224 3:46253178-46253200 AGTGACTTCCTATCAGGGACGGG - Intronic
963837003 3:150067934-150067956 GGTGAGGAAGTAGCATGGACAGG + Intergenic
969908004 4:10415565-10415587 GGTGAGATATTAGGAGAGACAGG + Intergenic
973366024 4:49210269-49210291 GGTGAGGTGCTGGCAGGGATGGG + Intergenic
975647070 4:76555783-76555805 GGTGAGGTGGTAGGAGGGACAGG - Intronic
976480102 4:85532782-85532804 TGTGACTTCCTAGCAGTGACAGG - Intronic
980410174 4:132406988-132407010 GGTCACTTACTAGCAGGCCCAGG - Intergenic
981266630 4:142791791-142791813 GGTGAGTAAGTAGCAGAGCCTGG - Intronic
985619659 5:947533-947555 AGTGAGTTAGCACCAGGGACAGG + Intergenic
985708713 5:1416076-1416098 GGTGAGCCCCTAGCAGGGCCAGG - Exonic
987241538 5:16005183-16005205 AGTTAGTTAATAGCAGGAACAGG + Intergenic
987876913 5:23691125-23691147 GGAGAGGCACTAGCAGGAACCGG + Intergenic
988526115 5:31988657-31988679 GGTTAGTTACCAGAAAGGACAGG - Intronic
996954211 5:129164105-129164127 GGTGGGGCACTAGCAGGGGCAGG + Intergenic
1002260729 5:177992496-177992518 GGTGAGCTACTGGAAGAGACAGG - Exonic
1002466138 5:179409866-179409888 GGGGAGTTACCATCAGGGGCTGG - Intergenic
1004510707 6:16282028-16282050 GGTGGGTTTCTAGCAGGTTCAGG - Intronic
1006427494 6:33975652-33975674 TGTCAGTTTCTAGCAGGAACCGG + Intergenic
1006444054 6:34069055-34069077 GGGGAGTTACACACAGGGACAGG + Intronic
1007410282 6:41657417-41657439 GGTGAGGGAGAAGCAGGGACAGG + Intergenic
1007871244 6:45041384-45041406 GGTGAGTAGCTACCAGGTACAGG + Intronic
1007924181 6:45638072-45638094 GGTGAGTGACAGGCAGGGAGAGG + Intronic
1012372778 6:98527762-98527784 GGTGAGTCCCTAAAAGGGACAGG - Intergenic
1013708366 6:112866974-112866996 GGTGAGATCATAGCAGGTACTGG - Intergenic
1013992079 6:116265350-116265372 GGTGGGGTGCTGGCAGGGACTGG + Intronic
1016881425 6:148915884-148915906 GGAGGGTTTCTAGCAGGGAATGG + Intronic
1021425650 7:20496311-20496333 AGTGAGGTGCTGGCAGGGACAGG - Intergenic
1023027481 7:36064021-36064043 GGAGAGGCAATAGCAGGGACAGG + Intergenic
1024923998 7:54593285-54593307 GGTAAGTTAACAGCAGAGACAGG + Intergenic
1026065505 7:67068543-67068565 GGTGGGGTACTAGAAGAGACTGG - Intronic
1026177770 7:68012947-68012969 GCTGTGTTACTAACAGGGAAGGG + Intergenic
1026711369 7:72743318-72743340 GGTGGGATACTAGAAGAGACTGG + Intronic
1029612983 7:101637203-101637225 GATGAGTAACTAGCAGGAAAAGG - Intergenic
1034622030 7:152463901-152463923 GGTGAGTTAGGGGCAGGGGCGGG + Intergenic
1039084251 8:33764135-33764157 GATGAGATACTGGCAGGTACAGG + Intergenic
1041144825 8:54862873-54862895 GGAGAGCAACTAGCAGTGACTGG + Intergenic
1042685201 8:71431084-71431106 GCTGAGTTAATACCAGGGAGAGG - Intronic
1048835646 8:138516382-138516404 GGTGATTTACTGCAAGGGACTGG - Intergenic
1050629703 9:7545465-7545487 GCTGAGTTCTTAGCAGGCACAGG - Intergenic
1052987956 9:34501832-34501854 GGTGGGTAACTGGCAGGGGCGGG - Intronic
1056110213 9:83387925-83387947 GGTGATTTTCTTGCAGGGCCAGG + Intronic
1056203972 9:84302721-84302743 GGTGAGCTACTATCAGAGAAAGG + Intronic
1060024795 9:120161958-120161980 GGTGAGCTTCTGCCAGGGACAGG + Intergenic
1061188544 9:129069129-129069151 GGTGAGTGACTGGCAGGCCCGGG + Exonic
1203527764 Un_GL000213v1:105635-105657 GGTGAGATGCTAGCAGGGGTGGG + Intergenic
1185516568 X:703423-703445 TGTGATTTACTACCAGGAACTGG + Intergenic
1186667472 X:11732650-11732672 GTAGAGTTACTAGCAGGGTGTGG + Intergenic
1186884580 X:13900393-13900415 GGTGAGTTACTGGGAAGGGCTGG + Intronic
1187262661 X:17701608-17701630 TGTGAGTTACTGGGAAGGACTGG + Intronic
1190620320 X:52280937-52280959 TGTGAGTTACAGGCTGGGACTGG + Intergenic
1194041384 X:88945765-88945787 GGTGAGTTCCTAGCCATGACAGG + Intergenic
1199743900 X:150759948-150759970 GGTGAGTCACTGCCAGAGACGGG - Intronic