ID: 1184089125

View in Genome Browser
Species Human (GRCh38)
Location 22:42283345-42283367
Sequence ACACCCGGGCTGGCTGCGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184089117_1184089125 -4 Left 1184089117 22:42283326-42283348 CCCGCCGCTCTGCACCCTCACAC 0: 1
1: 0
2: 0
3: 36
4: 312
Right 1184089125 22:42283345-42283367 ACACCCGGGCTGGCTGCGCACGG 0: 1
1: 0
2: 0
3: 13
4: 135
1184089119_1184089125 -8 Left 1184089119 22:42283330-42283352 CCGCTCTGCACCCTCACACCCGG No data
Right 1184089125 22:42283345-42283367 ACACCCGGGCTGGCTGCGCACGG 0: 1
1: 0
2: 0
3: 13
4: 135
1184089114_1184089125 -1 Left 1184089114 22:42283323-42283345 CCCCCCGCCGCTCTGCACCCTCA 0: 1
1: 0
2: 3
3: 47
4: 477
Right 1184089125 22:42283345-42283367 ACACCCGGGCTGGCTGCGCACGG 0: 1
1: 0
2: 0
3: 13
4: 135
1184089118_1184089125 -5 Left 1184089118 22:42283327-42283349 CCGCCGCTCTGCACCCTCACACC 0: 1
1: 0
2: 1
3: 39
4: 526
Right 1184089125 22:42283345-42283367 ACACCCGGGCTGGCTGCGCACGG 0: 1
1: 0
2: 0
3: 13
4: 135
1184089110_1184089125 9 Left 1184089110 22:42283313-42283335 CCAGCCCCAACCCCCCGCCGCTC 0: 1
1: 0
2: 7
3: 98
4: 1131
Right 1184089125 22:42283345-42283367 ACACCCGGGCTGGCTGCGCACGG 0: 1
1: 0
2: 0
3: 13
4: 135
1184089112_1184089125 4 Left 1184089112 22:42283318-42283340 CCCAACCCCCCGCCGCTCTGCAC No data
Right 1184089125 22:42283345-42283367 ACACCCGGGCTGGCTGCGCACGG 0: 1
1: 0
2: 0
3: 13
4: 135
1184089113_1184089125 3 Left 1184089113 22:42283319-42283341 CCAACCCCCCGCCGCTCTGCACC No data
Right 1184089125 22:42283345-42283367 ACACCCGGGCTGGCTGCGCACGG 0: 1
1: 0
2: 0
3: 13
4: 135
1184089115_1184089125 -2 Left 1184089115 22:42283324-42283346 CCCCCGCCGCTCTGCACCCTCAC 0: 1
1: 1
2: 2
3: 23
4: 321
Right 1184089125 22:42283345-42283367 ACACCCGGGCTGGCTGCGCACGG 0: 1
1: 0
2: 0
3: 13
4: 135
1184089116_1184089125 -3 Left 1184089116 22:42283325-42283347 CCCCGCCGCTCTGCACCCTCACA No data
Right 1184089125 22:42283345-42283367 ACACCCGGGCTGGCTGCGCACGG 0: 1
1: 0
2: 0
3: 13
4: 135
1184089111_1184089125 5 Left 1184089111 22:42283317-42283339 CCCCAACCCCCCGCCGCTCTGCA No data
Right 1184089125 22:42283345-42283367 ACACCCGGGCTGGCTGCGCACGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184089125 Original CRISPR ACACCCGGGCTGGCTGCGCA CGG Intronic
900140274 1:1136907-1136929 ACACCCCCGCTGGCTGGGCTGGG + Intergenic
900350926 1:2234213-2234235 CCACCCCAGCTGGCTGTGCACGG + Intronic
901111739 1:6802651-6802673 ACACCCAGGCTGGCTGACCAAGG - Intronic
901437128 1:9254063-9254085 AAACCGGGGCAGGCTGGGCACGG + Intronic
903360147 1:22772029-22772051 ACACCAGGGCTTGCTGGGGAAGG - Intronic
904694766 1:32323010-32323032 ACAGACAGGCTGGCTGGGCACGG + Intronic
905584233 1:39105038-39105060 AGACCCGGGCCGGCTCCACAGGG - Intronic
906715996 1:47969763-47969785 ACCCCAGGGCTGGCTCTGCAAGG - Intronic
917801564 1:178575640-178575662 ACAGCCAGGTTGGCTGGGCATGG - Intergenic
922535238 1:226374852-226374874 TCAGCCTGGCTGGCAGCGCATGG - Intronic
923561220 1:235043346-235043368 AGTCCCGGGCTGGCTATGCATGG + Intergenic
1063580314 10:7300553-7300575 ATTCCCGGGCTGGGTGGGCAGGG - Intronic
1064090370 10:12378149-12378171 TCACCCTGCCTGGCTGCCCAGGG + Intronic
1064156374 10:12906437-12906459 GCACCCGGCCTAGCTGGGCAGGG + Intronic
1075159554 10:120011459-120011481 AGACCCTGGGTCGCTGCGCATGG + Intergenic
1076885076 10:133258462-133258484 CCACCCGGGGTGGCAGGGCAGGG + Intergenic
1079695552 11:23477987-23478009 ACAGCCAGGGTGGCTTCGCAGGG - Intergenic
1084171107 11:67401507-67401529 TCTCCCGGGCTGGGGGCGCACGG - Intronic
1085453645 11:76654021-76654043 ACATCTGGGCTGGCTCTGCAAGG - Intergenic
1087151091 11:94860575-94860597 ACACGTGGGGTGGCTGTGCAGGG + Intronic
1089556264 11:119317258-119317280 GCTCCCGGGCTGGCGGCGCCGGG - Intronic
1089922122 11:122219268-122219290 ACACCAGGGCTGGCTAGGGAAGG - Intergenic
1090239742 11:125173741-125173763 ACACCTGGGCTGGCAGACCAAGG - Intronic
1090666494 11:128918203-128918225 ACAACCGGGAGGGCTGGGCAGGG + Exonic
1096232322 12:49903478-49903500 ACGCCCGGGCTGACTCCTCACGG + Intronic
1097187926 12:57205459-57205481 GCATCCGGGCTGGCCGGGCACGG - Exonic
1101089049 12:101266179-101266201 AAACCCAGGCTGGCTGGGCATGG + Intergenic
1103706422 12:122876417-122876439 ACACACAGTCTGGCTGGGCACGG + Intronic
1106121000 13:26860069-26860091 AGCCCAGGGCTGGCTGAGCAAGG - Intergenic
1106735717 13:32586479-32586501 ACGGCAGGGCTGGCTGCGGAAGG + Exonic
1112016511 13:95335737-95335759 ATAGCCGGGCAGGCTGGGCACGG - Intergenic
1114184623 14:20391148-20391170 CCTCCAGGGCTGGCTGGGCAAGG - Intronic
1116061215 14:39926564-39926586 AAAACAGGGCTGGCTGAGCACGG - Intergenic
1118126964 14:62916240-62916262 AAACCCTGGCTGGCTGGGCGTGG - Intronic
1119674495 14:76543850-76543872 ACACTCGGGCAGGTTGTGCAAGG + Intergenic
1121127655 14:91418095-91418117 ACACGCGGGGAGGCTGCGCTCGG - Intergenic
1121341566 14:93108116-93108138 ACACCCGGGCCGGCTCCCCAAGG + Intronic
1122311167 14:100795840-100795862 ACACCCTGGCTGGCCGGGCGCGG + Intergenic
1129819185 15:78585203-78585225 ACACTAGAGCTGGCTGGGCACGG - Intronic
1129856565 15:78829376-78829398 ATACCAGGGCTGGCTGGGCACGG + Intronic
1130986357 15:88847301-88847323 ACAGCAGGCCTGCCTGCGCACGG + Exonic
1133013881 16:2930030-2930052 ACCCACGGGGTGGCTGGGCAGGG - Intronic
1133770509 16:8864899-8864921 ACATGCGGGCAGGCTGAGCAGGG - Intronic
1136287544 16:29253334-29253356 ACACCCTGGCTCCCTGCACATGG + Intergenic
1138229078 16:55324638-55324660 GCGCACGGGCTGGCTGCGCTTGG + Exonic
1139796987 16:69491113-69491135 TCTCCCATGCTGGCTGCGCAGGG - Intergenic
1140829771 16:78740432-78740454 GGACCCCGGCTGGCTGCGGAAGG + Intronic
1142242101 16:88952265-88952287 ACACCCGGGGAGGCTGTGCCAGG + Intronic
1144138342 17:12320846-12320868 ACACCAGGGCAGGCTTGGCAGGG - Intergenic
1144808563 17:17983928-17983950 ACACCTGGTCTGGCTGGGTAAGG + Exonic
1146716950 17:35094390-35094412 ACAGCAGGGCTGGCTGAGCGTGG - Intronic
1146942300 17:36851772-36851794 ACACCCTGGGTGGCTGAGCCAGG + Intergenic
1148872103 17:50664412-50664434 ACACAAGAGCTGGCTGGGCACGG + Intronic
1153214699 18:2809002-2809024 ACAAAAGGGCTGGCTGGGCATGG + Intergenic
1153666511 18:7371473-7371495 ACACCCGGGCCAGCTGCCCAAGG - Intergenic
1157074417 18:44449487-44449509 ACACCTGAGCTGGCAGAGCAGGG - Intergenic
1160420388 18:78740003-78740025 AGACCTGGGCTGGCTGCACCAGG - Intergenic
1160691993 19:464414-464436 AGACCCGGCCTGGCTCCCCATGG + Intronic
1160928162 19:1556742-1556764 ACCCCCGGCCTTGCTGCGCGTGG + Exonic
1161053739 19:2179515-2179537 AGACATGGGCTGGCTGGGCACGG + Intronic
1161581885 19:5085690-5085712 ACACCAGGGGTGCCTGAGCAGGG - Intronic
1162523417 19:11194719-11194741 ACACCCAGCCTGGCTGCGGAAGG + Intronic
1162959442 19:14117448-14117470 AGGCCAGGGCTGGCAGCGCAGGG + Intronic
1163386728 19:17004577-17004599 ACACCCCGGCGGGCTTCGAAGGG + Intronic
1164713463 19:30375381-30375403 ACCCGCGGGCTGGGTGCGCGGGG + Intronic
1165433466 19:35784831-35784853 CCACCCGGGCTGGCAAGGCAGGG - Intronic
1166537666 19:43585153-43585175 AACCCCGGGCTGGCTGAGCATGG - Exonic
1166882311 19:45937128-45937150 TCACCCTGGCTGGCTGGGTAGGG + Exonic
1166966333 19:46531363-46531385 AGACCAGGGTTGGCTGGGCACGG - Intronic
1167080824 19:47275142-47275164 ACGCCCGGGCGGGCAGCACACGG - Exonic
1167224795 19:48230620-48230642 CCACCCGGGCTGGATGCTCCAGG + Exonic
1167249848 19:48393975-48393997 ACACCCAGGCAGGCAGCTCAGGG - Intergenic
1167798313 19:51724891-51724913 AGACCCCGGCTGGCTCCCCAGGG - Intergenic
1168215599 19:54923116-54923138 AGAACAGGGCTGGCTGCCCATGG + Intergenic
930156515 2:48112191-48112213 AGACCCGGGCTGGAGGAGCAAGG - Intergenic
930731249 2:54729978-54730000 ATACAAGGGCTGGCTGGGCATGG + Intronic
932327287 2:70871603-70871625 CCACCCGGGGTGCCTGCGCAAGG + Intergenic
932471520 2:71962503-71962525 ACACCAAGGCTGGCTGGGCCTGG + Intergenic
936452887 2:112646347-112646369 GCGCGCGGGCTGGCAGCGCAGGG + Intronic
946189410 2:218000363-218000385 ACTCCTGGGCTGACTGCCCAGGG - Intronic
946228296 2:218276549-218276571 ACACGAGGGCTGCCTGCCCATGG - Intronic
1169199244 20:3699684-3699706 ACACCTGGCTTGGCTGGGCATGG + Intronic
1174791243 20:53480357-53480379 ACACCTGGGTTGGCTGGGCACGG - Intronic
1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG + Intronic
1176378585 21:6100360-6100382 CCACCGGGGGTGGCTGGGCATGG + Intergenic
1177741246 21:25155729-25155751 AAACCTGGGCTGCCTGCACATGG + Intergenic
1179744890 21:43437877-43437899 CCACCGGGGGTGGCTGGGCATGG - Intergenic
1180026003 21:45162457-45162479 ACAGCCTGGCAGGCTGCGCTCGG - Intronic
1180646926 22:17347056-17347078 ACAGTCAGGCTGGCTGGGCATGG - Intergenic
1181920066 22:26313612-26313634 ACACACGTGCTGGCTGCCCGAGG + Intronic
1182654154 22:31876578-31876600 CCACCTGGGCTGGGTGGGCAAGG - Intronic
1182873766 22:33672468-33672490 AGAGCAGGGCTGGCTGAGCATGG - Intronic
1183122243 22:35739070-35739092 ACACCCGAGCTGCTTGCCCAGGG - Intronic
1184089125 22:42283345-42283367 ACACCCGGGCTGGCTGCGCACGG + Intronic
1184414945 22:44346804-44346826 AGACCAGGGCTGGCTGTCCATGG - Intergenic
1184620475 22:45672396-45672418 GCACCCGGACTGGCTGCGGTGGG - Intronic
1184688649 22:46107639-46107661 TCATCCAGGCTGGCTGCGAAGGG + Intronic
1184990070 22:48161542-48161564 ACACCCTGGCGGGATGCCCAAGG - Intergenic
954115961 3:48466920-48466942 ACAGCTGTGCTGGCAGCGCATGG + Exonic
959561870 3:107791636-107791658 ACAACCTGGTTGGCTGGGCATGG + Intronic
961566769 3:127769620-127769642 CCACCCGGGCTGGCAGCTCAGGG - Intronic
968950229 4:3687697-3687719 GCACCCGGCCTGGCTTCGCGGGG - Intergenic
968969516 4:3786297-3786319 AGACCCAGGCTGGCAGCCCAGGG + Intergenic
969819576 4:9709858-9709880 CCAGCAGGGCTGGCTGCTCATGG + Intergenic
973258346 4:48135936-48135958 ACACACAGGCTGGCTGCTCTGGG - Exonic
976729078 4:88244456-88244478 GCACCCAGGCTGTCTGCGCAAGG - Intergenic
985530991 5:433790-433812 ACACCAGGTCTGGCTGCCCTGGG - Intronic
985539778 5:482519-482541 ACCCCAGGGCTGGCTGGGCTGGG + Intronic
989108725 5:37887150-37887172 AGACACAGGCTGGCTGGGCACGG + Intergenic
992312770 5:75518999-75519021 ATACCTGGGCTGGCTGGGCTTGG - Intronic
995180346 5:109224989-109225011 ACAGCCTGGCTGGCTGTGCCAGG - Intergenic
997408050 5:133668156-133668178 ACTCCTGGGCTCGCTGCACAGGG + Intergenic
1001049536 5:168403385-168403407 ACAACAGAGCTGGCTGGGCACGG - Intronic
1006650520 6:35547448-35547470 GCTCCCGGGATGGCTGAGCAAGG - Intergenic
1012590606 6:100975363-100975385 ACACCGGGGCTGGCTGGGGGAGG + Intergenic
1012889464 6:104882122-104882144 TCACCCAGGCTGGCTGCTGATGG - Intergenic
1013088444 6:106876478-106876500 GCAGCCAGGCTGGCTGGGCATGG + Intergenic
1015288405 6:131510388-131510410 ACAGCCGTGCTGGCTGCTAATGG - Intergenic
1016820621 6:148342987-148343009 GCATCCGGGCAGGCTGCGCGCGG + Exonic
1018896750 6:168024758-168024780 CCAGCCTGGCTGGCTGGGCACGG + Intronic
1020189005 7:5980318-5980340 ACACAGGGGCTGGCAGGGCAGGG + Intronic
1020293911 7:6744435-6744457 ACACAGGGGCTGGCAGGGCAGGG - Intergenic
1025927278 7:65970174-65970196 AAACCCAGACTGGCAGCGCATGG + Intronic
1029405447 7:100372075-100372097 ACCCCCTGGCTGTCTGGGCAGGG - Intronic
1031718184 7:125134786-125134808 ACACCTGGGGTGGTTGGGCAGGG - Intergenic
1034417278 7:150971771-150971793 ACAGTCAGGCTGGCTGAGCACGG + Intronic
1036033360 8:4994643-4994665 AGACCCGGGCTGGCGGGGCCGGG + Exonic
1037535256 8:19817564-19817586 ACTCCCGGGCTCGCTGCACCAGG - Exonic
1038692481 8:29775764-29775786 ACAACTGGGCTGGCTGGGAATGG - Intergenic
1039921137 8:41895578-41895600 ATACCCGGGATGTCTGCCCATGG + Intronic
1048412772 8:134192555-134192577 ACACCCAGGCAAGCTGCTCATGG + Intergenic
1048888020 8:138924299-138924321 AGACCCAGGCTGGCCGCCCAGGG - Intergenic
1049629784 8:143647450-143647472 ACAGCAAGGCTGGCTGGGCATGG - Intronic
1050074444 9:1848767-1848789 ACAATCGGCCTGGCTGGGCATGG + Intergenic
1050136045 9:2465773-2465795 AAACCTGTGCTGGCTGGGCATGG - Intergenic
1050537934 9:6645946-6645968 ACACCCTGGCGGGCGGCGTACGG - Intergenic
1059345143 9:113623268-113623290 ACACCCGGACTGTCTGCTCAGGG - Intergenic
1060557023 9:124513187-124513209 ACACCAGAGATGGCTGTGCAGGG - Intergenic
1060782366 9:126422242-126422264 AGACCCGGGCAGGCTTCCCACGG + Intronic
1061038693 9:128127598-128127620 AGAGCCGGGCTGGCTTCGCGGGG - Exonic
1061043754 9:128153555-128153577 ACACCCAGGCTGGGTTCGCTAGG - Intergenic
1062041691 9:134407354-134407376 CCAGCCAGCCTGGCTGCGCAGGG - Intronic
1062596984 9:137303922-137303944 AGACCAGGGCTGGGTGTGCAGGG + Intergenic
1189212612 X:39296692-39296714 CCACCCGGGCAGGATGCGCCAGG - Intergenic
1190130695 X:47746176-47746198 ACACTGGGGCAGGCTGGGCACGG + Intergenic
1190320420 X:49176509-49176531 GCACCCGGGGTGGCTTCGGATGG + Intronic
1192034001 X:67544471-67544493 AAACTCGGGCTGGCAGCGCTGGG - Intronic
1192292272 X:69810464-69810486 AAACCTGGGCTGGCTGGGCACGG + Intronic
1193272365 X:79544376-79544398 ACATCAGGGCTTGCTGCCCAGGG - Intergenic